ID: 1091610886

View in Genome Browser
Species Human (GRCh38)
Location 12:2007766-2007788
Sequence CTAAGAAGACAGATGGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 311}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091610886_1091610890 -2 Left 1091610886 12:2007766-2007788 CCTTTGCCCATCTGTCTTCTTAG 0: 1
1: 0
2: 2
3: 28
4: 311
Right 1091610890 12:2007787-2007809 AGCTTGGAATGACCTTTTCCTGG 0: 1
1: 0
2: 0
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091610886 Original CRISPR CTAAGAAGACAGATGGGCAA AGG (reversed) Intronic
900767093 1:4512987-4513009 GTTAGCAGACAGATGGGAAAGGG + Intergenic
900767812 1:4517153-4517175 CTAAGAAGCAAGAAAGGCAAGGG + Intergenic
902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG + Intergenic
904612702 1:31734043-31734065 CAAAGCAGAGAGATGGGCAGGGG + Intronic
904734201 1:32617878-32617900 CTAAGGAGCCAGGTGGGTAATGG - Intronic
905362981 1:37433092-37433114 CCAAGAACACAGATGTGCACAGG + Intergenic
905438727 1:37978828-37978850 CTAAGGAGACAGGACGGCAAAGG + Intronic
906007199 1:42485648-42485670 CAAAGAAAAAAGATGGGCAAAGG + Intronic
906086739 1:43142551-43142573 CTAGGGAGATAGATGGGCAGTGG - Intergenic
907980343 1:59474149-59474171 CTAAAGAGCCAGAAGGGCAAAGG + Intronic
908171300 1:61507481-61507503 CCAAGAATACACATGGGGAATGG + Intergenic
909428564 1:75557407-75557429 CACAGAAGAAAGGTGGGCAATGG + Intronic
910052263 1:82988828-82988850 CTAAGAAGTTAGAAGAGCAAGGG + Intergenic
910247901 1:85161966-85161988 CTTAGAAGCCAGATCAGCAAGGG - Intronic
910294653 1:85632325-85632347 CTAAGAAGACAGAAATGGAAAGG + Intergenic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
914193141 1:145428183-145428205 ATAGGAAGACTGAAGGGCAAAGG + Intergenic
915357827 1:155266896-155266918 CTGAGAAGAGAGATGGGGGAAGG + Intronic
916553723 1:165874818-165874840 CTAAGAAAACACCAGGGCAAAGG - Intronic
916925929 1:169520923-169520945 CTCAGAAGACAGACTGGCTAGGG + Intronic
917083652 1:171283400-171283422 TTAAGAAGAGAGAAGGGAAAGGG + Intronic
918474794 1:184912643-184912665 GTAAGAAGACAAATGGGGAGAGG - Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920827805 1:209438056-209438078 CTTAGAAGGCAGATGGTCACAGG - Intergenic
921430521 1:215059950-215059972 CAATGTAGACAGATGGGCATGGG + Intronic
921893718 1:220378065-220378087 ATATGAAGACAGATGAGCACTGG - Intergenic
922994258 1:229943664-229943686 TTAAGAAGACTGATGGCCAAAGG + Intergenic
924032721 1:239902996-239903018 GTAAGAAGAATGATGGCCAATGG + Intronic
1063518170 10:6716882-6716904 AAAAGGAGACAGATGGGCAAAGG + Intergenic
1063630990 10:7733625-7733647 CTGAGAAGTCAGAGGGGCCATGG - Intronic
1064507381 10:16047852-16047874 CTAAGATGGCATCTGGGCAATGG + Intergenic
1064853784 10:19741539-19741561 CTAGGAGGATAGATGGGCAATGG - Intronic
1067734058 10:48835406-48835428 CAGAGAGGACAGTTGGGCAATGG + Intronic
1070378547 10:75858173-75858195 CTGAGTAGACAGAGGGGCCAGGG - Intronic
1070673706 10:78397352-78397374 CCACGAAGTCAGATGGGCCATGG + Intergenic
1071238625 10:83678829-83678851 CAATGAAGACAAATGTGCAATGG + Intergenic
1071604743 10:86977683-86977705 CAAAGAAGAAAGCTGAGCAATGG - Intronic
1072833699 10:98688139-98688161 CTGAGAAGACTGATAAGCAAGGG - Intronic
1075031201 10:119025774-119025796 GTGAGAAGACAGGTGGGCATGGG - Intergenic
1075257346 10:120935768-120935790 AAAAGAAGACAGAAGGGAAAAGG - Intergenic
1076014205 10:127014834-127014856 GTAAGCAGACAGATGGGCAAAGG - Intronic
1076602564 10:131668289-131668311 CTAGGAACAGAGATGGGCCAGGG + Intergenic
1077404329 11:2376383-2376405 CCAAGAAAACTGATGGACAACGG - Intronic
1078098664 11:8315857-8315879 TTCTGAAGACAGATGGGCACGGG + Intergenic
1078642292 11:13108031-13108053 CTAAGAGAAGAGATGGGCCAAGG - Intergenic
1080375721 11:31708115-31708137 CCAAGAAGACTGAATGGCAAAGG - Intronic
1081556740 11:44170875-44170897 CAAAGAAGCCATCTGGGCAAGGG - Intronic
1082955579 11:58866586-58866608 CTAAGATGACAGGTGGACACTGG - Intronic
1084891270 11:72238223-72238245 CTGGGAAGTGAGATGGGCAAGGG - Intronic
1085453414 11:76652209-76652231 CTCAGTAGAAAAATGGGCAAAGG + Intergenic
1085547390 11:77332551-77332573 CTAAGAAAATAAATGAGCAAAGG + Intronic
1085833275 11:79925894-79925916 CTAAGAAAATAAAGGGGCAAAGG - Intergenic
1085944112 11:81245539-81245561 GAAAGAAGACAGATTTGCAAAGG + Intergenic
1087264545 11:96045949-96045971 CTAACAAAACAGAAGGCCAAGGG - Intronic
1088483319 11:110317183-110317205 CAAAGAAGAGAGAGGAGCAAAGG - Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089153500 11:116383622-116383644 CTAAGAAGAAAGACAGGCCAGGG + Intergenic
1089787125 11:120915685-120915707 CTAGGAAGACATGTGAGCAAGGG - Intronic
1090530026 11:127581189-127581211 CTAAGTAGACATACGGGAAAGGG - Intergenic
1090627595 11:128619787-128619809 CCAGGAAAACAGATGGGGAAGGG + Intergenic
1091358585 11:134957225-134957247 CTAAGAAGCCCCATGGGCAGAGG + Intergenic
1091610886 12:2007766-2007788 CTAAGAAGACAGATGGGCAAAGG - Intronic
1092917365 12:13201003-13201025 CTAGGAAGACAGAGGGGCAGTGG + Intronic
1093216716 12:16370266-16370288 TTAGGAAGACAGATGGGACAAGG + Intronic
1093370001 12:18354877-18354899 ATAAGAAGACAGAAGAGAAAGGG - Intronic
1093872232 12:24306347-24306369 CCAAAAGGACAAATGGGCAATGG + Intergenic
1094148468 12:27255841-27255863 TCTAGAAGACAGATGGACAATGG - Intronic
1095408686 12:41897649-41897671 CTAACAAAAAATATGGGCAAAGG + Intergenic
1095484895 12:42674518-42674540 TTAAGAAGAAAGGTGGTCAAGGG + Intergenic
1095752417 12:45727722-45727744 CTAAGAGGACCGATGGGGGAAGG + Intergenic
1095802512 12:46283190-46283212 ATAAGAAAAGAGATGGACAAAGG + Intergenic
1096035651 12:48467661-48467683 CTAAGATGACAGATTACCAAGGG + Intergenic
1097716610 12:62972719-62972741 GTAAGAATATAGATGGGAAAAGG - Intergenic
1098627935 12:72696466-72696488 GTGAAAAGACAGATGGGCAGAGG - Intergenic
1099148690 12:79080857-79080879 TTAAGATGACAGATGGGACAAGG + Intronic
1100755216 12:97743952-97743974 CCAAGAAGACACATGGGGAAAGG + Intergenic
1102443730 12:112985248-112985270 CTAGGAGAAGAGATGGGCAAAGG - Intronic
1103149716 12:118626554-118626576 CTAAAAAGACAGAATGGCATAGG + Intergenic
1106130442 13:26935022-26935044 CTCAGAAGACAGAAAGACAAGGG + Intergenic
1107032299 13:35865751-35865773 CTATGAAGAGAAATGGGTAAGGG + Intronic
1107097532 13:36552646-36552668 CTGAGAAGAAGGATGGGAAAGGG + Intergenic
1107790644 13:43998801-43998823 GGAAGGAGAGAGATGGGCAAAGG - Intergenic
1107892602 13:44927399-44927421 CTGTGTACACAGATGGGCAATGG - Intergenic
1108474452 13:50800007-50800029 CTGTGAAGAAAGATTGGCAAGGG + Intronic
1109268259 13:60225341-60225363 ATCAGTAGACAGATGAGCAAAGG - Intergenic
1109586138 13:64407267-64407289 TTAAAAAGAGAGCTGGGCAAAGG + Intergenic
1113708798 13:112450932-112450954 TTTAGAATACAGATGGCCAAAGG - Intergenic
1113923313 13:113926874-113926896 CTAAGAAGACAGGCTGGAAAGGG - Intergenic
1117406958 14:55413007-55413029 TTAAGAAGACGGAGGAGCAAAGG - Intergenic
1117434685 14:55704502-55704524 GGATGAAGACAGATGGGGAAAGG + Intergenic
1117480496 14:56139208-56139230 AAAGGAAGACAGATGGGCCAAGG + Intronic
1118412584 14:65497226-65497248 CTAAGATGAAAGATGGGAATGGG + Intronic
1119875981 14:78059802-78059824 TTCTGAAGACAGTTGGGCAATGG - Intergenic
1121427060 14:93859902-93859924 AAAAGAAGACAGATCAGCAAAGG - Intergenic
1122042148 14:98996397-98996419 CTAAGGAGAGAGATGAACAAGGG + Intergenic
1123059741 14:105589105-105589127 CTAAGAACACAGCTGGGCTCAGG + Intergenic
1123084063 14:105709354-105709376 CTAAGAACACAGCTGGGCTCAGG + Intergenic
1124472629 15:30001879-30001901 CCAAGAATACAAATGTGCAAAGG - Intergenic
1126391332 15:48156943-48156965 ATAAGTTGAAAGATGGGCAAGGG + Intronic
1127255931 15:57293329-57293351 CAAAGAAGACACATAGACAATGG + Intronic
1127763175 15:62160886-62160908 CCAAGAAGACACATTGGGAAAGG + Intergenic
1129025239 15:72565798-72565820 CTGAAAAGAAAGATGGGGAATGG - Intronic
1129229599 15:74189384-74189406 ATAAGAACACTGATGGGCAATGG - Intronic
1130430851 15:83845495-83845517 CTAAGAAGATAGATTGTCAGAGG - Intronic
1130723169 15:86409963-86409985 CTAAGAAGAGAGATGTCTAAAGG - Intronic
1130853500 15:87820656-87820678 CTAAGAGGAAAGATGGAGAATGG - Intergenic
1132854628 16:2039236-2039258 CAAATAAGAGAGATGGGCATGGG - Intergenic
1132915827 16:2342748-2342770 CTGTGAAGACTGATGGGGAAAGG - Intergenic
1135637429 16:24090510-24090532 ATAAAAAGAAAGAGGGGCAAGGG + Intronic
1137357623 16:47781709-47781731 CTAACTAGATAAATGGGCAAAGG + Intergenic
1137557688 16:49483056-49483078 TTAAGAAGACAGTAGGGCCAGGG + Intergenic
1138371167 16:56527495-56527517 CTAAGAACTCAGAAGGGTAAAGG + Intergenic
1141921483 16:87138560-87138582 CAGAGGAGACAGAAGGGCAAAGG + Intronic
1143991442 17:10966742-10966764 CTATGAAGTCAGATAGGGAATGG + Intergenic
1144157387 17:12519385-12519407 TAAAGAAGACAGATGGACAAAGG - Intergenic
1144877189 17:18404773-18404795 CTGAGATGACAGATGGGAAGGGG + Intergenic
1145155041 17:20539633-20539655 CTGAGATGACAGATGGGAAGGGG - Intergenic
1145833142 17:27933675-27933697 GGCAGAAGACAGAAGGGCAAGGG + Intergenic
1147431331 17:40372548-40372570 CAATGAAGAGAGATGGGGAAGGG + Intergenic
1149403158 17:56319647-56319669 CAAAGAATACAGATGGCCTAGGG + Intronic
1150008002 17:61481546-61481568 CAAAGGAGAGAGCTGGGCAAGGG + Intronic
1150310224 17:64122225-64122247 CAGAGCAGACAGATGGGAAAAGG - Intronic
1150379551 17:64709823-64709845 CTAATACCACAGATGGGGAAGGG - Intergenic
1152330065 17:79667643-79667665 AAACGAAGACAGATGGGCCATGG + Intergenic
1154468167 18:14669982-14670004 CAAAGAAGTCAGCTGGGCATAGG - Intergenic
1154496363 18:14963993-14964015 CTAAGAAGCCCCATGGGCAGAGG - Intergenic
1154979470 18:21490659-21490681 CTCAGAAAACAGATGGCCATGGG - Intronic
1155537825 18:26835253-26835275 ATAAGAAGACACTTAGGCAACGG + Intergenic
1157771954 18:50356811-50356833 TTAAGAAGAAAGATGGGGAGAGG + Intergenic
1157888290 18:51389799-51389821 AGAAGAAGACAGAGGGGCTAAGG - Intergenic
1158025525 18:52892385-52892407 CTGAGAAGAAAGATGGGGAAAGG - Intronic
1158793170 18:60806955-60806977 CTAGGAACACAGATGGAAAATGG + Intergenic
1162052958 19:8046230-8046252 CTCAGAAAACAGATGTGGAAAGG + Intronic
1162143215 19:8596933-8596955 CTGAGAAAACAGATGGTCCAGGG - Intronic
1162648023 19:12064306-12064328 CCCAGAAGACAGTTGTGCAAGGG + Intergenic
1163005486 19:14394537-14394559 ATAAGATGCCAGATGGGCAGGGG - Intronic
1163062279 19:14769260-14769282 ATAAGATGCCAGATGGGCAGGGG + Intronic
1163270665 19:16251562-16251584 CCAAGAAGAGAGATGGGTCATGG - Intergenic
1163432540 19:17276831-17276853 CAAAGAAGAAATATGGGCACTGG - Exonic
1164508883 19:28881643-28881665 CTTAGAAGGCAAATGGGCACCGG - Intergenic
1164830214 19:31314358-31314380 CTGAGAAGCCACATGGGCAGCGG + Intronic
1165016538 19:32885156-32885178 CCAAGGAAACTGATGGGCAAAGG - Intronic
1165583834 19:36894844-36894866 CTAGGAGAAGAGATGGGCAAAGG + Intronic
1167120444 19:47513632-47513654 CTGAGAAGAGGGATGGGAAAAGG - Intronic
925844840 2:8025976-8025998 ATCAGAACACAGCTGGGCAAAGG - Intergenic
926080598 2:9983116-9983138 GTAAGAACACAGATGATCAAGGG - Intronic
926783198 2:16494578-16494600 CTGAGAAGACAAATGAGTAAGGG - Intergenic
927408125 2:22795637-22795659 CTGAGTAGACAGGTGGGGAAGGG - Intergenic
928326369 2:30322738-30322760 CTGAGAAGAGAGAAGGGCCAGGG - Intronic
929332429 2:40699618-40699640 TTCAGAAGAAAAATGGGCAATGG - Intergenic
929781889 2:44962444-44962466 GTGAGAAGACAGATGGGATAGGG - Intergenic
930221663 2:48752685-48752707 GTAAGAAGACCTATGGGTAAAGG - Intronic
930449679 2:51519403-51519425 CTGAGATCACAGATGGGCTAAGG + Intergenic
930506284 2:52285965-52285987 GTAAGAAGAGTGAAGGGCAAAGG + Intergenic
932658172 2:73628111-73628133 CCCAGAAGACAGATGAGAAAAGG + Intergenic
933295930 2:80491373-80491395 CTTTGAAGACAGATAGACAACGG + Intronic
934555303 2:95284056-95284078 CCCAGAAGCCAGATGGGCACTGG + Intronic
934715247 2:96539276-96539298 CCAAGAGGACAGATGGGGCAAGG - Intronic
935254752 2:101299902-101299924 CTATGAAGGCGGATGGGGAAGGG - Intronic
935859142 2:107308945-107308967 CTAAGAAGGTAGATGTGCAAAGG + Intergenic
937129432 2:119496575-119496597 AGAAGAAGACAGATGGACTAGGG + Intronic
937691055 2:124755728-124755750 CCTATAAGACAGATGTGCAAAGG - Intronic
938574262 2:132589223-132589245 CCAAGAAGGCAGAGGGGCAATGG - Intronic
938969514 2:136419323-136419345 CTAAGATGAAAGATGGGTGATGG + Intergenic
941775282 2:169386840-169386862 CTAAGAAAACACCTTGGCAAAGG - Intergenic
942309826 2:174645713-174645735 CTTTGAAGACAGCTGGTCAAAGG - Intronic
942411587 2:175715061-175715083 CAATGAAGACATATGGGCACAGG + Intergenic
942983031 2:182105477-182105499 CACAGAAGAGAGAAGGGCAAAGG + Intronic
943271992 2:185817248-185817270 CTAGGAACTCAGATAGGCAATGG + Intronic
943649632 2:190442902-190442924 CTAAGAAGAGAAATGGGCTGAGG + Intronic
943655680 2:190506001-190506023 CTCAGAAGACAGATTTACAAGGG - Exonic
944709628 2:202324097-202324119 ATGAAAAGACAGAGGGGCAAAGG + Intergenic
946017984 2:216619555-216619577 CTACCAAGACAGAGGGGGAATGG - Intergenic
946778802 2:223171744-223171766 ATAACAAGACAGATGTGCCAAGG + Intronic
947871287 2:233440329-233440351 CTCAGAAGACAGACAGGCATAGG - Intronic
1169074674 20:2753277-2753299 CTAAGAAGCCAGATGGGATGTGG - Intronic
1170674151 20:18463532-18463554 CCCAGAAGAAAAATGGGCAAAGG - Intronic
1173504643 20:43577161-43577183 CCATGAAGACAGCTGGGCAAAGG + Intronic
1174963471 20:55184648-55184670 CTAAGAAGAAAGATGTGTATGGG + Intergenic
1175309074 20:57998942-57998964 CTTAGAAGTCAGATGGGTAGAGG - Intergenic
1176609946 21:8871694-8871716 AGAAAAAGACAGATGGGGAAAGG - Intergenic
1176806350 21:13487667-13487689 CAAAGAAGTCAGCTGGGCATAGG + Intergenic
1177349067 21:19911823-19911845 ATAAGAAGACACTTAGGCAATGG - Intergenic
1178193423 21:30314267-30314289 ATATAAAGACAGATGGACAATGG - Intergenic
1178795237 21:35737977-35737999 TCAAGAGGACAGATGGGCATGGG + Intronic
1182503383 22:30764696-30764718 CTAAGAAGATGGATGGGAACAGG + Intronic
1182643468 22:31788102-31788124 TTAAAAAAACAAATGGGCAAAGG + Intronic
1184880214 22:47299843-47299865 CTGAGAAGACAGTAGGACAAGGG - Intergenic
1185234166 22:49702050-49702072 TGAAAAAGACAGAGGGGCAAAGG - Intergenic
949268292 3:2185668-2185690 CTAAGAAGAAAGATGGTCTTCGG + Intronic
949490968 3:4588652-4588674 CTTGGGAGACAGATGGGCACTGG - Intronic
950003791 3:9678181-9678203 CTGAGAGGACAGAGGGCCAAAGG - Intronic
950158180 3:10739502-10739524 CTGTGAGGACAGAGGGGCAAGGG - Intergenic
950390190 3:12690459-12690481 ATAAGAAGACAGAGAGGCACAGG + Intergenic
952207032 3:31190570-31190592 CTTTGAAAACAGATAGGCAAGGG + Intergenic
953532732 3:43752796-43752818 CTCAGAAGGCAGAAAGGCAAGGG + Intergenic
956311067 3:67881164-67881186 CTCAGAAGACACATGAGGAAAGG - Intergenic
956554316 3:70501036-70501058 CAAAGAAGAAAGATGAGCATAGG + Intergenic
957296126 3:78335190-78335212 CTGCAAAGACAGATGGGTAATGG - Intergenic
957400563 3:79707371-79707393 CTAAGAAAAAAAATGGGCAAGGG - Intronic
957404427 3:79758746-79758768 CTTAGGAGACAGGTGGGGAAAGG + Intronic
958574169 3:95926287-95926309 CTCAGAAGGCAGCTGGGTAAGGG - Intergenic
960024682 3:112994970-112994992 AAAAGAAGACAGAAGGGAAATGG - Intronic
960435128 3:117617119-117617141 AGAAGAAGACAGATGGTCAGTGG + Intergenic
960648085 3:119912194-119912216 ATAGGAAGAGAGATGGGGAATGG + Intronic
961640715 3:128363316-128363338 CAAAGCAGACACTTGGGCAAAGG + Intronic
962877003 3:139542767-139542789 CCAAGGAGACAGGTGAGCAATGG + Intergenic
963373098 3:144427247-144427269 CTAATAACACTGATGGACAATGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
965177316 3:165351897-165351919 CTGAGAAGAAAGGAGGGCAAGGG + Intergenic
969233719 4:5850515-5850537 CCATGAAGATAGATGGGCAACGG - Intronic
969328476 4:6458422-6458444 CTCACATGACAGAAGGGCAAGGG + Intronic
969525547 4:7702220-7702242 CCTGGGAGACAGATGGGCAAGGG + Intronic
971141669 4:23931304-23931326 CTAAGAGGACACAAAGGCAAGGG + Intergenic
971883950 4:32418109-32418131 CCAAGAAGACACATGGGGAAAGG - Intergenic
971884456 4:32424920-32424942 ATAAGAAGACACTTAGGCAATGG + Intergenic
973015917 4:45136674-45136696 CTAAGTAAATAGATGGGCAGTGG + Intergenic
974883260 4:67785334-67785356 ATGAGAAGACAGAGGGTCAAAGG - Intergenic
977146955 4:93455003-93455025 CTAAGAAGACACATTAGAAAGGG + Intronic
977220221 4:94329333-94329355 CTAAGAAAACAGCTGAGCAAGGG - Intronic
977531822 4:98209311-98209333 TTAAGCAGACAGATGGACTACGG - Intergenic
983568310 4:169177402-169177424 ATAAGAAGACAAATAAGCAAAGG + Intronic
983931085 4:173454120-173454142 CTAGGAAGGCAGCTGGGCCAGGG + Intergenic
984581309 4:181512980-181513002 GTAAGGAAACAAATGGGCAAGGG + Intergenic
985004254 4:185517463-185517485 CTAAGAAGAAATAAGGGCAGAGG - Intronic
985521440 5:375739-375761 CTGAGAGGACTGAGGGGCAAGGG - Intronic
987097287 5:14561102-14561124 CTAAGAGGGGAGATGGGCACAGG + Intergenic
987117958 5:14741336-14741358 CTCAGCAGACAGATGGGCCTGGG + Intronic
987607757 5:20159692-20159714 CTAAAGAGACTGATGGGCATTGG + Intronic
988266518 5:28958551-28958573 TGAAGAAGACTGATGGGGAAGGG + Intergenic
989162223 5:38402320-38402342 CAAGGCAGACAGATGGGGAATGG - Intronic
990195570 5:53311271-53311293 CTTTGGAGACAGATGGTCAAGGG - Intergenic
990372296 5:55132498-55132520 CTGAGAAGACAGATTGGCAGAGG - Intronic
990745181 5:58951587-58951609 CTAAGAAGAAAAATGGGCAAAGG + Intergenic
990920990 5:60966617-60966639 CCAAGAACACAGATGGGAAGAGG - Intronic
993291206 5:86073755-86073777 CTAAGAAGACATATCAACAAAGG + Intergenic
993332495 5:86617926-86617948 CTGAAAAGAAAGATGGGAAATGG - Intronic
994634427 5:102326502-102326524 CTCAGAAGACAGAGGGGATAAGG - Intergenic
994690295 5:103010457-103010479 CTGAGAAGACAGAAGGGCCATGG - Intronic
995263342 5:110131126-110131148 CAATGAAAACATATGGGCAAAGG - Intergenic
996457949 5:123706688-123706710 CCAAGAAGACAGATACCCAAAGG - Intergenic
997026700 5:130072419-130072441 CCAAGAACACACATGGGGAAAGG - Intronic
997677449 5:135723738-135723760 CTATGAAGACTGCAGGGCAAGGG - Intergenic
998379712 5:141715641-141715663 CTAAAAATACAGAGGAGCAAGGG - Intergenic
998545674 5:143025382-143025404 GTAAGAAGACAGATAGGTAAAGG + Intronic
1000783493 5:165513827-165513849 AGAGGAAGACAGAAGGGCAAAGG + Intergenic
1001417611 5:171557363-171557385 CTAATAGGAAAGATGAGCAAAGG - Intergenic
1001635627 5:173208117-173208139 CTATGGAGACACTTGGGCAAAGG + Intergenic
1005018585 6:21396460-21396482 CCAAGGAGATAGATGGGCCAAGG - Intergenic
1005416480 6:25605332-25605354 CTAAGAAGTCAGAGGGACAAGGG - Intronic
1005738443 6:28770182-28770204 CTACAAAGACAGATGTGCTATGG - Intergenic
1006059171 6:31406812-31406834 CCAAGAACACACATTGGCAAAGG - Intronic
1006150109 6:31982549-31982571 CTTACAAGACAGATGGGAACAGG - Intronic
1006156410 6:32015287-32015309 CTTACAAGACAGATGGGAACAGG - Intronic
1007051452 6:38835291-38835313 CTAAGAATGCAGGTGGGAAAGGG - Intronic
1007064327 6:38974616-38974638 GTAAGGAGACAGAGCGGCAACGG - Intronic
1007485450 6:42178090-42178112 CTAGGAAGACAGATAGGTCACGG + Intronic
1008757338 6:54812015-54812037 CCAAGAATACACATGGGGAAAGG - Intergenic
1009026190 6:58003080-58003102 CTCACAAGGCAGAAGGGCAATGG - Intergenic
1009201739 6:60754553-60754575 CTCACAAGGCAGAAGGGCAAGGG - Intergenic
1009444828 6:63729812-63729834 AAAAGAAGAGAGATGGGCTATGG - Intronic
1011128310 6:84029956-84029978 CTTAGAAGGCACATGGGCACAGG + Intergenic
1011262878 6:85486942-85486964 CTCAGTAGCCAGATGGGAAAGGG + Intronic
1011424136 6:87207855-87207877 CCAAGAAGACAGTTGTGCAATGG - Intronic
1012294013 6:97496732-97496754 CTCAGAAGATAGATGTTCAAGGG + Intergenic
1013697673 6:112723431-112723453 CCAAAAAGAAAGATGGTCAAGGG + Intergenic
1014698729 6:124656707-124656729 CTAAGAAGACTGGTGGGTAGGGG - Intronic
1016061027 6:139630462-139630484 CTAAGAACACACATTGGGAAAGG - Intergenic
1016336196 6:143007648-143007670 CTAACAAGACAGAGGGGCTGTGG - Intergenic
1016462792 6:144295900-144295922 GGAAGAAGAGAGATGTGCAAAGG - Intronic
1016861393 6:148722014-148722036 GGAAGAAGACAGATGGGAGAGGG - Intergenic
1017063633 6:150508649-150508671 CTAAGAAGACATGTGCACAATGG - Intergenic
1017086325 6:150716481-150716503 ACAGGAAGACGGATGGGCAAAGG - Intronic
1017645355 6:156535020-156535042 CTGAGAAGCCAGATGGGCTGGGG - Intergenic
1018326649 6:162677278-162677300 ATAAAAAGACAGACGGGCAAGGG + Intronic
1019950171 7:4365709-4365731 CTAAGAAGACACCTTGTCAATGG + Intergenic
1021441116 7:20677764-20677786 CTAGGTAGAAAGAGGGGCAAAGG - Intronic
1021552452 7:21885851-21885873 CTAAGATGAGAAATGGGAAAAGG - Intronic
1022229096 7:28395835-28395857 CTCAGAAATCAGATTGGCAAGGG + Intronic
1022916398 7:34958909-34958931 CCCAGTAGACAGATGGGCAGTGG - Intronic
1023092780 7:36632291-36632313 CTGAGGAGCCCGATGGGCAAAGG - Intronic
1023190440 7:37574886-37574908 CTAAAAAGACAAATGACCAATGG + Intergenic
1024035458 7:45504302-45504324 CTCAGAAGTCACATGGCCAAAGG + Intergenic
1024100372 7:46026698-46026720 CTTAGAAGACAGGTTGGGAAGGG + Intergenic
1028671674 7:93407723-93407745 CTGGGAAGACAGAGTGGCAAAGG + Intergenic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1029403213 7:100358099-100358121 ATAAGAAGCCAGATGGATAAAGG + Intronic
1030543827 7:110867635-110867657 CAAAGAAGAGAGATGCTCAAGGG - Intronic
1031688093 7:124757152-124757174 CTAAGAAAGAAGATGGACAAGGG - Intronic
1032362413 7:131268345-131268367 CCAAGAGGAAAGTTGGGCAAAGG + Intronic
1032689140 7:134265361-134265383 AAAAGAAGGCAGATGGGCTATGG + Intergenic
1033132867 7:138760069-138760091 CAAAGAAAACAGAAGGTCAAAGG - Intronic
1033454888 7:141493675-141493697 CAAGGAAAAGAGATGGGCAATGG + Intergenic
1033659604 7:143394344-143394366 CTAAGAAGGCACATGGGTCAGGG + Intronic
1034645512 7:152642962-152642984 ATAAGTAGAAAAATGGGCAAAGG - Intergenic
1037490371 8:19391813-19391835 CTAACAAGACAAAAGGGCTATGG + Intronic
1037919406 8:22794138-22794160 CTAAGTAGAAAAATGAGCAAAGG - Intronic
1041888192 8:62837614-62837636 ATCAGCAGACAGATGGGAAATGG - Intronic
1043614895 8:82113594-82113616 CCAAGAAGACACATGGGAAAAGG + Intergenic
1043668080 8:82843798-82843820 CTATGAAGAGAAATGGACAATGG - Intergenic
1044307007 8:90649565-90649587 CAAACAAGAAAGATTGGCAAGGG - Intronic
1044602548 8:94020200-94020222 ATAAGAGGACAGATGGGGAGGGG + Intergenic
1045283128 8:100766644-100766666 CAAAGAAGACATTTGGACAAAGG + Intergenic
1045841178 8:106583564-106583586 CTAAGAAGACATATGCCAAAAGG + Intronic
1046418799 8:113951223-113951245 CAAAGAAGACATATAGACAATGG - Intergenic
1046707915 8:117476811-117476833 TTCAGAAGACAGATGGCCATAGG - Intergenic
1047643619 8:126846852-126846874 GTAAGAATGCAGAAGGGCAAGGG - Intergenic
1048264699 8:132975211-132975233 GTAAGAGGACAGATGGGGCAAGG - Intronic
1051180432 9:14406149-14406171 CTATGAAGACCAATGGACAAGGG + Intergenic
1051313904 9:15808405-15808427 ACAAGAAGACAGAGGGGCAAGGG + Intronic
1051498366 9:17750289-17750311 CCGAGAATACAGATGAGCAAAGG - Intronic
1052033682 9:23656944-23656966 CTACAAAGACAGATCGGCACAGG + Intergenic
1054737744 9:68772590-68772612 CTGGGAAGAGAGATGGGCACTGG - Intronic
1055387013 9:75773213-75773235 AAATGAAGACAGACGGGCAAGGG - Intergenic
1055633306 9:78247251-78247273 GTAAGAAGACAGATGGGGGCAGG + Intronic
1055828145 9:80351304-80351326 CTCAGAAGAAAGAGGGCCAAAGG - Intergenic
1056318026 9:85410138-85410160 CCAACAAGATAGATGGACAAAGG + Intergenic
1056337263 9:85584856-85584878 CTAAATAGACACATAGGCAATGG + Intronic
1057159272 9:92875060-92875082 CTGAGAAAACAGATGGGTAGAGG + Intronic
1058608607 9:106750866-106750888 TTTAGAAGACAGATGAGAAATGG - Intergenic
1059137773 9:111823453-111823475 ATAAAAAAACTGATGGGCAAGGG + Intergenic
1059654493 9:116345338-116345360 CTAACTAGACAGATCAGCAAAGG + Intronic
1060285960 9:122252744-122252766 TAAAGAATACAGATGGTCAAGGG + Intronic
1060309687 9:122448179-122448201 CCAAGAAAACATATGTGCAAAGG + Intergenic
1061427752 9:130510852-130510874 CTGAGAAGACAGATGGGGTTTGG - Intergenic
1062018440 9:134304176-134304198 CTAAATAGACAGCAGGGCAAAGG + Intergenic
1186148663 X:6650896-6650918 AGAGGAAGACAGATGAGCAAGGG + Intergenic
1187766560 X:22648996-22649018 GGCAGAAGAAAGATGGGCAAGGG + Intergenic
1188296216 X:28452454-28452476 ATAAGAAGACATTTAGGCAATGG + Intergenic
1188487009 X:30692943-30692965 ATAAGAATACAGATGGGGAGGGG + Intronic
1188992127 X:36834194-36834216 CTAAGAAGACCAATAGGGAAAGG + Intergenic
1189068426 X:37836836-37836858 CTCAGAAGACATTTGGGGAAAGG + Intronic
1189429176 X:40932101-40932123 CCAAGAGGACAGACAGGCAATGG + Intergenic
1191776840 X:64823757-64823779 GAAAGAAGACAGATGGGCTAGGG + Intergenic
1191853045 X:65600134-65600156 CTAAGGAGAGAGATGAGCAGAGG + Intronic
1192271409 X:69583237-69583259 CTAAGAAGACAGACTGGGCAAGG - Intergenic
1192499469 X:71640152-71640174 CAAAAAAGACAGGTGGGCCAGGG - Intergenic
1193386653 X:80880728-80880750 CTAAGAAGGCAAATTGGCTAGGG + Intergenic
1196161053 X:112482984-112483006 CCAAGAAGACACATGGGGAAAGG - Intergenic
1197883063 X:131189634-131189656 CTAACATGGCAGAAGGGCAAAGG - Intergenic
1199763134 X:150920764-150920786 CCTAGAAAACAGAAGGGCAAAGG - Intergenic
1200943880 Y:8812255-8812277 GTAAGAGAACAGCTGGGCAAGGG - Intergenic