ID: 1091611215

View in Genome Browser
Species Human (GRCh38)
Location 12:2011341-2011363
Sequence AGGAGCCTTGTCCTGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091611215 Original CRISPR AGGAGCCTTGTCCTGGGACA TGG Intronic
900228361 1:1543392-1543414 TGGAGCCGTGTCCTGGGAGAGGG + Intronic
900522222 1:3111252-3111274 AAGAGGCTTGTCCTCGGCCACGG + Intronic
901039271 1:6354454-6354476 AGAAGCGATGTCCTGAGACAGGG + Intronic
901136655 1:7001277-7001299 GAGAGCATTGTCCTGGGACCTGG - Intronic
901160837 1:7175723-7175745 AGAAGCCTCGGCCAGGGACAGGG - Intronic
901841795 1:11958292-11958314 AGGAGCCCAGGCCTGGAACAAGG - Intronic
902329023 1:15721576-15721598 AGGAGCCCTGCACTGGGAGAAGG - Intronic
903137923 1:21321414-21321436 AGCAGCCATGTCCTGGAAGAGGG + Intronic
903179571 1:21598381-21598403 AGCTGCCTTGTCCTGGTACCTGG + Exonic
904027964 1:27516586-27516608 TGGAGCCATGTGCTGGGACCTGG + Intergenic
904888632 1:33761258-33761280 AGTAGCCTTTGCTTGGGACATGG - Intronic
904951988 1:34250054-34250076 GGAAGTCTTGTCATGGGACATGG + Intergenic
906478454 1:46185320-46185342 AGGAGGCTGGGACTGGGACATGG + Intronic
911147660 1:94568227-94568249 AGAAGCTTTGTCCTGAGCCATGG + Intergenic
911939371 1:104022080-104022102 TTGAGCTTTGTTCTGGGACATGG + Intergenic
915922066 1:159983410-159983432 AGGACCCTTTTCCTAGGAAAGGG - Intergenic
916075508 1:161198031-161198053 AGGAGCCTTGACGTTGCACATGG + Exonic
917530352 1:175829476-175829498 AGTAGCCTTGCCAGGGGACAAGG - Intergenic
917681012 1:177367421-177367443 AGGAGCCTTGACCAAGGAGAGGG + Intergenic
918451585 1:184664326-184664348 AGGAGACTCGACCTGGGACGAGG - Intergenic
919829662 1:201531604-201531626 AGGGGACTTGTCCTGGGAGGTGG - Intergenic
919918339 1:202152884-202152906 AGGAGCATTGTCCTGGGAGAGGG + Intronic
920277211 1:204815307-204815329 AGGTGCCATGTCCTGAGACTGGG + Intergenic
921363658 1:214353721-214353743 ATGGGCCATCTCCTGGGACATGG - Exonic
923517560 1:234710170-234710192 GGGAGTCTTGTCCAGGGCCAGGG + Intergenic
1063979365 10:11441326-11441348 TGGATCCTTGTCGTGGGTCAAGG + Intergenic
1064482242 10:15751260-15751282 GGCAGCCTTGTCCTGTGACTAGG - Intergenic
1066354504 10:34668952-34668974 ATGAGCATTGTTCTAGGACATGG + Intronic
1067944765 10:50682773-50682795 AGCAGCTTTCTCCTGGGACTGGG + Intergenic
1069688700 10:70335474-70335496 AAGAGCCTGGGCCTGGGCCAGGG - Intronic
1070259592 10:74841791-74841813 AAGAGCCTTGGCCTGGGAATTGG - Intronic
1070693195 10:78542867-78542889 AGGAGTCTTGTGCTGATACAAGG - Intergenic
1070880061 10:79847775-79847797 AGCAGCTTTCTCCTGGGACTGGG + Intronic
1071213096 10:83367057-83367079 AGGAACAATGTCCTGGGAAAGGG - Intergenic
1071633173 10:87231865-87231887 AGCAGCTTTCTCCTGGGACTGGG + Intronic
1071646622 10:87364083-87364105 AGCAGCTTTCTCCTGGGACTGGG + Intronic
1072697229 10:97612699-97612721 AGGAGACTTGGCCTGAGATAGGG + Exonic
1072795734 10:98353147-98353169 GGGAGCATTTTCCTGGGAGAGGG + Intergenic
1074549940 10:114433398-114433420 TGGAGCCTTTTGCTGGGAAATGG + Intronic
1076222192 10:128743228-128743250 AGGAGAGTTGTGCTGAGACAGGG + Intergenic
1077103344 11:831756-831778 AGGAGGCTTGTCATGGGTCGGGG + Exonic
1077293949 11:1815339-1815361 AGGAGGCTGGGCCTGGGGCATGG + Intergenic
1078329739 11:10409501-10409523 AGGAGCATTGACATGGGGCAGGG + Intronic
1080886061 11:36369409-36369431 AGGTGACTGGTCCTGGGACTGGG - Intronic
1081645576 11:44787958-44787980 AGGAGCCTGGTCCAGGCCCAGGG + Intronic
1081940123 11:46934452-46934474 TGGAGCATTATCCTGGGACTTGG - Intergenic
1082024865 11:47564969-47564991 GGGAGCCCTGCCCTAGGACAGGG + Intronic
1082044164 11:47711442-47711464 AGGAACTTTGTCCCAGGACATGG + Intronic
1082266528 11:50124557-50124579 AGGACTGTTGTTCTGGGACATGG + Intergenic
1082289561 11:50354011-50354033 AGGACTGTTGTTCTGGGACATGG - Intergenic
1083366377 11:62143873-62143895 ACTAGCCTTGTCCTTGGCCAGGG + Intronic
1083638887 11:64134883-64134905 AGCAGCCTTCTCCTAGGGCAGGG + Intronic
1084336301 11:68459997-68460019 AGTGCCCTTGTCCTGGGAGAAGG - Intergenic
1084616992 11:70243091-70243113 TGAAGCCTGTTCCTGGGACAAGG - Intergenic
1084942465 11:72620316-72620338 AGGGGCCTTCTCCTGGGCCTTGG - Intronic
1085112375 11:73899294-73899316 AGAAGCCTTGGACTGGGACATGG + Intronic
1087534980 11:99431610-99431632 AGGAGTTTTGTCATGGGTCAGGG + Intronic
1087674345 11:101141648-101141670 AGGAACCTTGCACAGGGACAGGG + Intergenic
1089340784 11:117755928-117755950 AGGTCCTTTGTCCTGGGAGAAGG + Intronic
1089683674 11:120133554-120133576 AGAATGCTTGCCCTGGGACAGGG - Intronic
1091027207 11:132152229-132152251 GGGAGCCTTGTCCTGCCAGAAGG - Intronic
1091611215 12:2011341-2011363 AGGAGCCTTGTCCTGGGACATGG + Intronic
1091628432 12:2140175-2140197 AGAACCTCTGTCCTGGGACAGGG + Intronic
1092888174 12:12943724-12943746 AGGAGCCTTGTTATGACACAAGG - Intronic
1096670494 12:53195710-53195732 AGAAGGGTAGTCCTGGGACAGGG + Exonic
1096848637 12:54421282-54421304 AGGAGCCTTGGTGGGGGACAGGG + Intergenic
1099931601 12:89081894-89081916 AGTAGCCTTGCCCTGGTCCAAGG - Intergenic
1101563815 12:105885552-105885574 TTGAGCTTTGTTCTGGGACAGGG - Intergenic
1101838543 12:108311785-108311807 TGCAGCCCTGTCCTGGGTCAGGG - Intronic
1103928917 12:124438641-124438663 AGGAGGCACGTCCTGGGAGACGG + Intronic
1103969511 12:124661281-124661303 AGGAACCCAGTCCTGGGAAATGG - Intergenic
1103995738 12:124828885-124828907 CGAAGCCTAGTTCTGGGACAAGG + Intronic
1104640995 12:130467165-130467187 AGGAGGCTTGTTTTGGGAAAGGG - Intronic
1104852422 12:131883592-131883614 AGGAGCCTGCTCCAGGGCCAAGG - Intergenic
1104880979 12:132069902-132069924 AGGAGCCTGGAACTGGGAGAGGG - Intronic
1109824275 13:67697418-67697440 AGGAGCTTGGGCCTGGGAAAGGG - Intergenic
1111189973 13:84794444-84794466 AGGAACCTTGTACAGGGACTGGG - Intergenic
1112196265 13:97229655-97229677 AGGAACCTTGACCTTGGAGATGG + Intronic
1112508357 13:99988910-99988932 AGGAGCCTGGGCCTGGGCCTGGG + Intergenic
1113336515 13:109382171-109382193 GGGTGCCTTTTCCTGGGACAGGG - Intergenic
1113348985 13:109509612-109509634 AAGAGTGTTGTCCTGGGATATGG - Intergenic
1113567472 13:111327433-111327455 TGCAGCCTTGGCCTGGGGCATGG + Intronic
1114309750 14:21456077-21456099 AGGCGCCTTGTTCTCGGAGAGGG - Intronic
1115598179 14:34929217-34929239 TGGAGCCTTTTCCTGAGACATGG + Intergenic
1116614558 14:47118242-47118264 AGGAGCATTGTCCTAGAACATGG - Intronic
1119604477 14:76002796-76002818 AGGAGTATTGTCTTGGGACTTGG + Intronic
1119852068 14:77873334-77873356 AGGAGGCCTGGCCTGGGAAATGG - Intronic
1121413203 14:93762055-93762077 AGGGGCCTTGCCCTGGGCCAGGG + Intronic
1122070270 14:99201517-99201539 AGCAGCCTTGTCATGGGAGGTGG - Intronic
1122913567 14:104845413-104845435 AGGAGCCAGCTCCAGGGACATGG - Intergenic
1123409122 15:20044031-20044053 AGGAGACATGTCCTGGGAATAGG - Intergenic
1123518453 15:21050739-21050761 AGGAGACATGTCCTGGGAATAGG - Intergenic
1127873062 15:63089321-63089343 AAAAGCCTTGTCCTGAGAGACGG + Intergenic
1130382079 15:83379649-83379671 CAGTGCCTTGTCCCGGGACAGGG - Intergenic
1131047585 15:89325942-89325964 AGGAGCCCTGCCCTGGGTCAGGG - Intronic
1131118533 15:89808990-89809012 AGGGGCCTTGGTCTGGGACCAGG + Intronic
1131539079 15:93260963-93260985 AGGAGCCCTGTCCTTAGATAAGG + Intergenic
1132103939 15:99049479-99049501 AGAAGCCTTGTCCTGAGACGGGG + Intergenic
1136091474 16:27923290-27923312 AGGAGCCTTCTCGGGGTACAGGG - Intronic
1136355605 16:29743491-29743513 AGGAGCGTTGTCCTAGAGCAGGG - Exonic
1136356235 16:29746145-29746167 AGGAGGCTTTTCCTGGGGTAAGG + Intergenic
1136577996 16:31135495-31135517 GGGGCCCTTGTCCTGGGCCATGG - Exonic
1139119992 16:64004057-64004079 AGGAGGCTTGTGCAGGGAGAGGG - Intergenic
1139940991 16:70605172-70605194 GAGAGCCTTGACCTGGGAGAGGG + Intronic
1139964761 16:70739187-70739209 AGGACCCTTGTCCGAGGTCACGG + Intronic
1141423983 16:83933819-83933841 AGGACACTTGTCGTGGGATATGG + Intronic
1142106172 16:88304079-88304101 AGGAGGCTTGTTCTGGGAGGAGG + Intergenic
1142223633 16:88866900-88866922 TGGAGCCTTGGTCTGTGACAGGG + Intergenic
1142672745 17:1494767-1494789 AGGTGTCTTCTCCTGGGAAAAGG + Exonic
1143705616 17:8696044-8696066 ATGAGCCTTGGCCTGGGAGTTGG - Intergenic
1144173698 17:12684446-12684468 AGGAACCTTTTCCTTGAACAAGG + Intronic
1144639609 17:16930324-16930346 GGGAGACTGGTCCAGGGACAGGG - Intronic
1144640208 17:16932685-16932707 AGGAGCCTACTCCTGGTCCAGGG - Intronic
1145922939 17:28624826-28624848 AGGAGCTTAGACCTGGGAGAAGG - Intronic
1146160199 17:30555433-30555455 AAGAGCCTGGTCCAGGGACGGGG + Intergenic
1146319877 17:31838846-31838868 AAGAGCCTTTTGCAGGGACAAGG + Intergenic
1146925594 17:36742679-36742701 AGGAGGGCTGTCCTGGGTCAAGG + Intergenic
1147191475 17:38740431-38740453 GGGAGCGTTGCCCTGGGAAACGG + Exonic
1148912865 17:50952432-50952454 AGGAGCCTTGTTCCAGGATAAGG + Intergenic
1148912866 17:50952437-50952459 ATGATCCTTATCCTGGAACAAGG - Intergenic
1150650211 17:67005267-67005289 AGGAGCCTTGGCTGGGGGCAGGG + Intronic
1151723926 17:75874023-75874045 GGGAGCCCTGGCCTGGGAGAAGG - Intergenic
1152011714 17:77723119-77723141 GGGAGCCTAGTCCTGGGCTAGGG - Intergenic
1152443898 17:80329131-80329153 AGGAGCCTTTGCCTGGCACCTGG + Intronic
1152648359 17:81480761-81480783 AGGAGCCCTGACCTTGGAGAGGG - Intergenic
1152943798 17:83187152-83187174 AGGACACTTGTCCTGGGGCTGGG - Intergenic
1153493867 18:5677519-5677541 AGAAGCCCTGTCCTAGGAGATGG + Intergenic
1154289618 18:13095855-13095877 AGGAGTGTGGCCCTGGGACAAGG - Intronic
1155073564 18:22336450-22336472 AGGAGCCCTGACCTGGGATTAGG - Intergenic
1155252930 18:23968641-23968663 AGGAGGCTTGGCCAGAGACAGGG + Intergenic
1155557160 18:27032570-27032592 AGGTGCGTTGTTCTGGCACAGGG - Intronic
1155713015 18:28905756-28905778 AAGGGCCTTGTCCTGCAACACGG - Intergenic
1156459322 18:37312847-37312869 AGGACCCTTGGCCAAGGACATGG + Intronic
1157482246 18:48062885-48062907 AAGATGCTTGTCCTGGCACAGGG + Intronic
1157625347 18:49045972-49045994 AGGAGCCTAGTCCAGGGAAGGGG + Intronic
1157810932 18:50695312-50695334 TGGAGCCTTGACCTAGGCCAGGG - Intronic
1158644587 18:59233361-59233383 AGGAGCCTTTTCCATGCACATGG - Intergenic
1159080588 18:63731286-63731308 AGGAGCCAGGTCCTGGAACGGGG - Intergenic
1159819682 18:73124414-73124436 AGGAGCCTTCTCCTGGTACATGG + Intergenic
1160115022 18:76070564-76070586 TGTAACCTTGTCCTGGGACATGG + Intergenic
1160143477 18:76346760-76346782 AGGAGCCCAGGCCTGGGATAGGG + Intergenic
1160502944 18:79411242-79411264 AGCAGCCTGGACCTGGGAGATGG + Exonic
1162322323 19:9977520-9977542 AGGAGCCATGTCCTGGGATGTGG + Intronic
1163473729 19:17512696-17512718 AGGAGCCTTGGCCTGGCCGAGGG + Intronic
1163835604 19:19571590-19571612 AGGATTCGTGTCCTGGGACACGG + Intronic
1165140822 19:33698950-33698972 GAGAGCCTTGCCCTGGGAGAGGG + Intronic
1165314247 19:35045135-35045157 AGGAGCCCTGACCTGGGACCTGG + Intronic
1166195287 19:41201904-41201926 AGGTGCCTTATCCTGAGCCATGG + Intronic
1167255015 19:48422103-48422125 AGGAGCCTGCTCCTGGGAGGAGG - Intronic
925134167 2:1514934-1514956 AGGAGCCACGTCCTGGGCCGTGG - Intronic
925195944 2:1925911-1925933 AGGAGGCATATCCTGTGACATGG - Intronic
925414411 2:3659372-3659394 AGGAGCATTGTCATGGGTTACGG - Intronic
927671945 2:25075883-25075905 TGGAGCCTTGTCCTCGGGTAGGG + Intronic
929855133 2:45631069-45631091 ATGAGCCTTATTCTGGGGCATGG + Intergenic
930323101 2:49880277-49880299 AGGAGCTTTGTTTTGGGAAAGGG - Intergenic
930802742 2:55459702-55459724 AGGAAGTTTGTCCTGGGAAAGGG - Intergenic
931266680 2:60666689-60666711 AGGATCTTTGTCCTGGAACACGG - Intergenic
932526199 2:72471763-72471785 AGCATCCTTGTCCTGGGGAATGG + Intronic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
935051941 2:99531542-99531564 AGGAACCTAGTCCAGGAACAAGG - Intergenic
936835401 2:116703620-116703642 TGGAGCCTCGTCCTTAGACATGG - Intergenic
938618127 2:133020864-133020886 GGGAGACTAGTCCAGGGACAGGG + Intronic
939840359 2:147180851-147180873 ATGAGCCTGGTCATGTGACAAGG - Intergenic
941005393 2:160242006-160242028 AGCTGCCTTGGCCTGGGGCAGGG - Intronic
944260411 2:197669864-197669886 AGGAGCATTGTGATGGGAAAGGG - Intronic
946707848 2:222476285-222476307 AGCAGCAATGTCCTGGGCCAGGG + Intronic
948302155 2:236915579-236915601 AAGGGCCTTGTCCTGGTACCTGG - Intergenic
1169218679 20:3807998-3808020 AGGAGCCTGGGCCTGGGCCTGGG + Intergenic
1170470418 20:16662934-16662956 AGCAGCCTTGTCCTGCTATAGGG + Intergenic
1172162559 20:32878811-32878833 AGGAGCCTCTTCCTGGGCCTTGG + Intronic
1172608367 20:36231032-36231054 CTCAGCTTTGTCCTGGGACAGGG - Exonic
1173037868 20:39429897-39429919 TGTAGCCTTGTCCTGGTCCAGGG - Intergenic
1173182610 20:40816081-40816103 GGGAGCCCTGTCCTGGGCCCAGG + Intergenic
1173927830 20:46793898-46793920 AGGTGCCATGGACTGGGACAGGG - Intergenic
1174133707 20:48364004-48364026 AGGAGCCTTGTTATGGAACCTGG + Intergenic
1175961225 20:62637443-62637465 TGGAGCTTTGTCCAAGGACATGG - Intergenic
1175961666 20:62640405-62640427 AGGACCCTTCACCTGGGTCAAGG + Intergenic
1178097548 21:29232181-29232203 AGGAGGCTTGTTTTGGGAAAGGG + Intronic
1179790187 21:43751943-43751965 AGGAGCCTGGTCCTGAGAATGGG + Intronic
1180037569 21:45257612-45257634 GAAAGCCCTGTCCTGGGACAGGG + Intergenic
1180219245 21:46347570-46347592 AGGAGCGTTCTCATGGGACCTGG - Intronic
1180968954 22:19805016-19805038 AGGAGCCTTGTGTGGGCACATGG + Intronic
1181484570 22:23222593-23222615 AGGAGACATGACCTGGGAGAGGG + Intronic
1181934069 22:26427482-26427504 AGGAGGTGGGTCCTGGGACAGGG + Intergenic
1181934112 22:26427620-26427642 AGGAGGTGGGTCCTGGGACAGGG + Intergenic
1181934155 22:26427758-26427780 AGGAGGTGGGTCCTGGGACAGGG + Intergenic
1181934235 22:26428057-26428079 AGGAGGTGGGTCCTGGGACAGGG + Intergenic
1182679785 22:32069939-32069961 AGGAGCCTTGTGCAGGGAAAAGG - Intronic
1182777161 22:32839570-32839592 AGATACCTTGGCCTGGGACAGGG - Intronic
1183739830 22:39663372-39663394 AGGAGCCTGGTGCAGGGGCAGGG + Intronic
1184197551 22:42940558-42940580 ATGAGCCCCGCCCTGGGACAGGG + Intronic
1184336766 22:43858421-43858443 AGGAGGCTTGACCTGGGGAAGGG - Intronic
1184417884 22:44362794-44362816 TGGAGCCTTGTGCTGGGTCCTGG - Intergenic
1185382994 22:50518698-50518720 AGAAGCCGAGTGCTGGGACAGGG - Exonic
950964050 3:17133982-17134004 AAGAGACTTGTGCTGGGACTTGG + Intergenic
951622387 3:24617183-24617205 AGGAGTTATGTCCTTGGACAAGG + Intergenic
952066637 3:29578652-29578674 ACTAGCATTTTCCTGGGACAGGG - Intronic
952875874 3:37943847-37943869 AGGAGCGTTCTACTGGGAAAAGG + Intronic
952917104 3:38254976-38254998 AGTAACACTGTCCTGGGACATGG - Exonic
953283172 3:41578696-41578718 AGGAGTCTTGTGGTGGGAAAAGG + Intronic
953407510 3:42666755-42666777 TGAAACCCTGTCCTGGGACATGG + Intergenic
953885741 3:46713495-46713517 AGGAGCTTAGGCCAGGGACAGGG - Intronic
954629523 3:52040433-52040455 AGGTGCTTTATCCTGGGACAAGG + Intergenic
954744298 3:52778301-52778323 AGGAGCTGTGGCCTGAGACAGGG - Intronic
955070022 3:55564827-55564849 AGAATCCATGTCCTAGGACAGGG + Intronic
955137876 3:56238053-56238075 GGGACTCTTGTCCTGGGCCATGG + Intronic
955826022 3:62948795-62948817 AAGAGCCTGGCCCTGGGGCAAGG - Intergenic
957716111 3:83930961-83930983 AGGAGATTTGTTCTTGGACAGGG + Intergenic
960298061 3:115968135-115968157 AAGAGCCATGTCCTGGAATAAGG + Intronic
960923066 3:122767928-122767950 TGGAGCCTTGGCCTGAGTCAGGG + Intronic
961623060 3:128239849-128239871 TGGAGCCTTCTCCTGTGACTGGG + Intronic
961806828 3:129495616-129495638 TGGAGCTTGGGCCTGGGACAGGG - Intronic
963365003 3:144323533-144323555 AGAAGCTATGGCCTGGGACAGGG - Intergenic
963528720 3:146447133-146447155 AGGAGCCACGGCCTGGAACATGG + Intronic
968541357 4:1169954-1169976 AGGCGCCTTGGCCTGGGGCGGGG - Intronic
968870834 4:3241369-3241391 AGGAGGCTGGTCCAGGGACCTGG - Exonic
972194529 4:36637392-36637414 ATGAGCCTTGGCCTAGGCCAAGG - Intergenic
972278390 4:37580979-37581001 AGGATCCTTTGCCTGGGAAAAGG - Intronic
972771678 4:42203243-42203265 AGGGGACTTGTCCTGCAACATGG + Intergenic
973777794 4:54259107-54259129 AGAAGCCTTGTCCTAGGAAAAGG - Intronic
975643496 4:76524241-76524263 AGGAAGCAAGTCCTGGGACATGG + Intronic
975718579 4:77228839-77228861 AGGTGCCTTTTCCTAGGAAAGGG - Intronic
978347158 4:107783631-107783653 AGGGGCCTTGTACAGGCACAGGG - Intergenic
978876442 4:113645517-113645539 GGGAGCTCTGTCCTGGAACAAGG - Intronic
979615961 4:122743117-122743139 GTGAACCTTGTCCTGGTACAAGG + Exonic
980777228 4:137452761-137452783 AGGAGGTTTGTTCTGGGAAAGGG + Intergenic
981495401 4:145385947-145385969 AGGAGCCATGCCCTACGACAAGG - Intergenic
982399894 4:154954572-154954594 TGTATCCTTGTTCTGGGACATGG - Intergenic
985355358 4:189113558-189113580 AGGGCCTTTGGCCTGGGACAGGG - Intergenic
986756271 5:10839565-10839587 AGGAGCCAGGTCCTGGAATAGGG - Intergenic
987022608 5:13890040-13890062 AGGAGCTTACTCCTGGCACAGGG + Intronic
987395362 5:17418034-17418056 AGGAGGCTTGTTTTGGGAAAGGG - Intergenic
987967372 5:24893722-24893744 AGGGCCCTTGTCCTGGTTCAGGG + Intergenic
993847520 5:92962967-92962989 AGGAGTGTTTTCCTGGCACATGG - Intergenic
996909639 5:128640515-128640537 AAGACCCTTTTCCTGGGAAAAGG + Intronic
997870519 5:137501519-137501541 ATGAGACTTGTGCTGGGACTGGG - Intronic
999262541 5:150246686-150246708 AGGATCCTTGTCCAGGGAGAGGG + Intronic
1000444364 5:161301714-161301736 AGGAGCCTTGTACTGAAGCAAGG - Intronic
1001171372 5:169422552-169422574 ACCAGATTTGTCCTGGGACATGG - Intergenic
1001667413 5:173444767-173444789 GGGTGCCATGTCCTGGGGCAAGG + Intergenic
1001925184 5:175630994-175631016 AGGAGGCTAGTCTTGGGAAAAGG + Intergenic
1002017912 5:176340537-176340559 AGGAGCCCTGTCCACGGACGGGG + Intronic
1002643202 5:180640367-180640389 GGGAGCCTGGTCCTGGGGCAGGG - Intronic
1003093326 6:3122450-3122472 TGGAGCCTGGTCCTGGTGCAGGG + Intronic
1012383902 6:98654824-98654846 GGGAGCCATTTCCAGGGACAAGG + Intergenic
1013193803 6:107827628-107827650 AGCACCCTTTTCATGGGACAGGG - Intergenic
1013494615 6:110686010-110686032 TGAAGCCTTGCCCTGGGACATGG + Intronic
1015265218 6:131284928-131284950 TGTAGCCTTGTCTTGTGACAGGG + Intergenic
1016214025 6:141573483-141573505 AGGAGCCTTGGCCTGAGAATTGG + Intergenic
1018678166 6:166241151-166241173 AGTAGTCTTGTCCTAGGACAAGG - Intergenic
1018710058 6:166492547-166492569 AGAAGGCTTGTCCTTGGAAATGG - Intronic
1019207622 6:170376004-170376026 AGGAGCCTTGCCCAGATACACGG + Intronic
1019336497 7:485328-485350 ATGGGCTTTCTCCTGGGACAGGG - Intergenic
1019338833 7:498533-498555 CGCAGCCCTTTCCTGGGACATGG - Exonic
1020774902 7:12441151-12441173 AAGAGCCTTACCCAGGGACATGG - Intergenic
1021953387 7:25797657-25797679 AGGAACCTAGCCCTGGGAAAAGG - Intergenic
1022475229 7:30705716-30705738 AGGAGCCTGCACATGGGACAGGG - Intronic
1022482429 7:30752741-30752763 AAAAGCCCTGCCCTGGGACAAGG + Intronic
1026228893 7:68466407-68466429 AGGAGCTTTGTTTTGGGAAAGGG - Intergenic
1028455216 7:91030929-91030951 AGGAGCCTTGTCCTGCTGCCTGG + Intronic
1031380938 7:121085218-121085240 AGGTGCCATGTCCAGGGTCAGGG + Intronic
1033882510 7:145902721-145902743 AGGAGCTTGGGCCTGGGACAGGG + Intergenic
1033987856 7:147248462-147248484 AGGAGGATTGTCCTGGGTTAGGG + Intronic
1034449088 7:151127907-151127929 AGGAGCCTGCCCCGGGGACAGGG - Intronic
1035573099 8:687371-687393 AGGAGCCTTATCCTGGCGCCTGG - Intronic
1036243894 8:7100758-7100780 AGGAGCCCTGTGCTGGGATGTGG - Intergenic
1037458349 8:19084801-19084823 AAGAGGCCTGTCCTGGGACTTGG + Intergenic
1037561493 8:20078929-20078951 AGGAGCCTTGGTTTGGAACAGGG + Intergenic
1039480780 8:37871792-37871814 AGGAGCTTTGTCCTTGGGCTTGG - Exonic
1039556930 8:38483222-38483244 GGGGGCTTTGTCCTGGGACTGGG + Intergenic
1048164489 8:132050410-132050432 ATAAGCCTCTTCCTGGGACATGG + Intronic
1048791347 8:138106990-138107012 CAGAGCCTTTGCCTGGGACATGG - Intergenic
1050625695 9:7501667-7501689 AAGAGCTTGGTCCTGGGATAAGG - Intergenic
1056459980 9:86800181-86800203 GGTGGCCTTGTCCTGGGACTTGG + Intergenic
1057211381 9:93202780-93202802 AGGAGCTTTTCCCTGGGGCAGGG + Intronic
1058274542 9:103023893-103023915 AGGATCCTGGGCCTGGGCCATGG - Intergenic
1059349522 9:113654622-113654644 AGGAGCCTTAGCATGGGACAGGG - Intergenic
1060752484 9:126182543-126182565 GGGAGACTTGTCCTGGGAATAGG + Intergenic
1061217042 9:129227512-129227534 AGGAGCCTAGACCTGGGAGCAGG + Intergenic
1061237318 9:129350671-129350693 AGGATCCTGGTCCTTGGTCAAGG + Intergenic
1062208925 9:135352801-135352823 GGGGCCCTTCTCCTGGGACAAGG + Intergenic
1062582155 9:137233500-137233522 CTGGGCCCTGTCCTGGGACAGGG + Intronic
1187448020 X:19374719-19374741 AGGAGCTTTGGACTGAGACATGG - Intronic
1189176094 X:38958991-38959013 TGGGGCCGTGTCCTGGGCCATGG - Intergenic
1189848164 X:45155474-45155496 AGGTACCTTGTTCTCGGACAGGG + Intronic
1189944836 X:46167622-46167644 TGGAGCATTGGCCAGGGACAGGG - Intergenic
1190428173 X:50352110-50352132 AGGAGCTTTCTCCTTGGACTGGG - Intergenic
1192172767 X:68867262-68867284 ATGAGCCTGGCCCTGGGACTGGG - Intergenic
1192381350 X:70619717-70619739 AGTAGCCTTGCCCTGGGACCTGG + Intronic
1194793932 X:98186490-98186512 AGAAGCCTTCTCCTAGGTCATGG - Intergenic
1195676452 X:107510847-107510869 AGGAGCACAGTCCAGGGACAGGG - Intergenic
1198274879 X:135090810-135090832 TGGGGCCTTCTCCTTGGACATGG - Intergenic
1200000300 X:153056617-153056639 AGGGACCTTGCCCTGGGAGAAGG + Intronic