ID: 1091613552

View in Genome Browser
Species Human (GRCh38)
Location 12:2032064-2032086
Sequence ATCCCCATGCTGCAAGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 365}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091613552 Original CRISPR ATCCCCATGCTGCAAGGTAG AGG Intronic
900466526 1:2828318-2828340 ATGCCCAAGCTGGAAGGTTGTGG - Intergenic
900806566 1:4771493-4771515 CTCCCCATGCAGCAGGGGAGGGG + Intronic
901222724 1:7592750-7592772 ATCCTCATTTTCCAAGGTAGAGG - Intronic
902390678 1:16103207-16103229 AAGCCCATGCTGGAAGGTTGTGG - Intergenic
904574259 1:31492839-31492861 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
905563395 1:38944624-38944646 ATGCCCAGGCTGTAATGTAGTGG - Intergenic
906008906 1:42504262-42504284 ATGCCCACGCTGGAAGGTGGTGG - Intronic
906157779 1:43623987-43624009 ATCCCTCTCCTCCAAGGTAGTGG - Intergenic
907465184 1:54630385-54630407 ATGCCCACGCTGGAAGGTTGTGG + Intronic
907798850 1:57744044-57744066 ATGCCCAAGCTGGAAGGTTGTGG - Intronic
908315892 1:62932199-62932221 ATCCCCATGTGTCGAGGTAGGGG + Intergenic
909098154 1:71315727-71315749 ATGCCCAAGCTGGAAGGTTGTGG - Intergenic
909208519 1:72791993-72792015 ATGCCCATGCTGGAAAGTTGTGG - Intergenic
909830636 1:80185234-80185256 ATCCCCATGTGTCAAGGGAGCGG + Intergenic
910537010 1:88309922-88309944 ATGCCCAAGCTGGAAGGTTGTGG - Intergenic
911361412 1:96881690-96881712 ATCCCCATGCATCAAGGGCGGGG - Intergenic
912003439 1:104862811-104862833 GTCGCCAGGCTGGAAGGTAGTGG - Intergenic
912933826 1:113985991-113986013 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
913196511 1:116460809-116460831 GTCCCCACCCTACAAGGTAGAGG + Intergenic
913526980 1:119702951-119702973 ATCCACATGCTGCAAGATAAAGG - Intronic
914768276 1:150659325-150659347 ATGCCCATGCTGGAAGGTTGTGG + Intronic
914982182 1:152424567-152424589 ACACCCATGCTGGAAGGTTGTGG - Intergenic
915401321 1:155624054-155624076 AAGCCCATGCTGGAAGGTTGTGG + Intergenic
917073609 1:171179877-171179899 ATCCCCATGCTGGGAGGTGATGG + Intergenic
918151885 1:181803978-181804000 CTCCGCATGCTGTAAGTTAGGGG + Intronic
918629673 1:186701896-186701918 ATCCCCAGGCTGCAGTGCAGTGG + Intergenic
919282565 1:195510088-195510110 ATGCCCACGCTGGAAGGTTGTGG + Intergenic
920085683 1:203414565-203414587 ATGCCCACGCTGGAAGGTTGTGG + Intergenic
920428175 1:205895746-205895768 ATGCCCACGCTGGAAGGTTGTGG + Intergenic
921226548 1:213025871-213025893 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
923861099 1:237892816-237892838 ATGCCCACGCTGCAAGGTTATGG - Intergenic
923994762 1:239480923-239480945 ATCCTCACTCTGCAAGTTAGTGG - Intronic
1063468352 10:6263366-6263388 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
1064384072 10:14875762-14875784 TTGCCCAGGCTGCAATGTAGTGG + Intergenic
1064390248 10:14935946-14935968 TCCCCCAGGCTGCAAGGCAGTGG + Intronic
1065996045 10:31060352-31060374 ATTCCCATGTGGCAAGGTACTGG - Intergenic
1066396573 10:35030014-35030036 TTGCCCATGCTGCAACGCAGTGG + Intronic
1066541977 10:36457332-36457354 ACGCCCATGCTGGAAGGTTGTGG + Intergenic
1067233828 10:44430592-44430614 ATGTCCACGCTGGAAGGTAGTGG + Intergenic
1068154943 10:53186613-53186635 ATCCCCATGGTCGAAGGTGGAGG - Intergenic
1068166955 10:53342786-53342808 ATACCCATGCTGGAAGGTGGTGG - Intergenic
1068177873 10:53485546-53485568 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
1068221929 10:54056590-54056612 ATCCCCATGTGTCAAGGGAGGGG - Intronic
1068671210 10:59725449-59725471 ATGCCCATGCTGGAAGGTTGTGG - Intronic
1068847791 10:61699538-61699560 AGCCTCATACTGCAAGGCAGAGG - Intronic
1068940776 10:62678653-62678675 AACCCCATGTTCCAAGGTCGTGG - Intergenic
1069056215 10:63847529-63847551 ACGCCCATGCTGGAAGGTTGTGG + Intergenic
1069552747 10:69375885-69375907 AGCCCAATGCTGCAGGGGAGAGG - Intronic
1069631417 10:69899140-69899162 ATCCCCACTCTGCAATGTACTGG - Intronic
1072073293 10:91942242-91942264 TTGCCCAGGCTGCAATGTAGTGG - Intronic
1072576514 10:96705620-96705642 ATCCCCAGGCTGGAATGCAGTGG + Intronic
1073366626 10:102948011-102948033 ATCCCCAGGCTGGAGTGTAGTGG - Intronic
1073449578 10:103601628-103601650 ATCCCACAGCTGGAAGGTAGGGG - Exonic
1074980478 10:118615620-118615642 ACGCCCATGCTGGAAGGTGGTGG - Intergenic
1075680956 10:124330764-124330786 ATCCCCAGGCTGGAAGGCACAGG - Intergenic
1076416144 10:130290909-130290931 ACGCCCATGCTGGAAGGTTGTGG + Intergenic
1076505897 10:130972350-130972372 ATGCCCACGCTGGAAGGTTGTGG + Intergenic
1076621186 10:131789171-131789193 CTCCCCATCCAGCAGGGTAGGGG + Intergenic
1077647411 11:3937971-3937993 TTGCCCAGGCTGCAATGTAGTGG + Intronic
1078197068 11:9144964-9144986 ACCCTCAGGCTGTAAGGTAGAGG - Intronic
1078773090 11:14369102-14369124 TTGCCCAGGCTGCAACGTAGTGG - Intergenic
1079026391 11:16951252-16951274 TTCCCCATGCTGCATGGAGGAGG - Intronic
1079493225 11:21012424-21012446 ACCCCCATCCTGCATGGGAGTGG + Intronic
1082249837 11:49965851-49965873 ATGCCCAAGCTGGAAGGTTGTGG + Intergenic
1082304465 11:50553996-50554018 ATGCCCATGCTGGAAGGTTCTGG + Intergenic
1083322471 11:61856081-61856103 CTCCCCACACTGCAAGGGAGAGG + Intronic
1084237609 11:67798036-67798058 TGGCCCATTCTGCAAGGTAGAGG + Intergenic
1084598614 11:70131905-70131927 ATCTCCATGCTGCAAGAGAGGGG - Exonic
1084834797 11:71794792-71794814 TGGCCCATTCTGCAAGGTAGAGG - Intronic
1086376531 11:86206596-86206618 ATCCCCATTCTGCTGGGGAGGGG + Intergenic
1087064519 11:94014993-94015015 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
1087209060 11:95427725-95427747 ATCCCCAGGCTGGAATGTAGTGG - Intergenic
1087229139 11:95640172-95640194 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
1088216686 11:107518506-107518528 ATGCCCATGCTGGAAGGTTGTGG + Intronic
1088743389 11:112785016-112785038 AGCCCCATGCTGGAATGGAGCGG - Intergenic
1088983576 11:114886297-114886319 ATCCCAATGCTGGAAGGCCGAGG - Intergenic
1091169455 11:133507311-133507333 AGCCCCAGGCTCCAAGGCAGTGG + Intronic
1091613552 12:2032064-2032086 ATCCCCATGCTGCAAGGTAGAGG + Intronic
1092150613 12:6245824-6245846 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
1092292604 12:7171481-7171503 ACACCCATGCTGGAAGGTTGTGG - Intergenic
1092376449 12:7959579-7959601 CTCCCCAGGCTGGAGGGTAGTGG - Intergenic
1092598118 12:10030072-10030094 ACACCCATGCTGGAAGGTGGTGG + Intergenic
1094300708 12:28962091-28962113 ATCCCAATGCTGTGTGGTAGGGG + Intergenic
1095186023 12:39201101-39201123 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
1098246598 12:68525380-68525402 ATGCCCACGCTGGAAGGTTGAGG + Intergenic
1099072139 12:78058445-78058467 ATCCCCATGTGTCAAGGGAGGGG - Intronic
1101736140 12:107464797-107464819 ATCCCCTGGGTGCAAGGGAGAGG - Intronic
1102608770 12:114092253-114092275 ATGCCCATGCTAGAAGGTTGTGG + Intergenic
1103385330 12:120527945-120527967 ACCCCCAGGCTGGAAGGCAGTGG - Intronic
1105697472 13:22903061-22903083 ACACCCATGCTGGAAGGTTGTGG + Intergenic
1107579131 13:41763247-41763269 ATCACCAGGCTGTAATGTAGTGG - Intronic
1110027866 13:70565028-70565050 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
1110206074 13:72915285-72915307 TTTCCCATGCTACAAGGTATAGG - Intronic
1110903783 13:80860161-80860183 TTGCTCATGCTGCAAGGCAGTGG + Intergenic
1111056522 13:82957565-82957587 ATGTCCATGCTGGAAGGTTGTGG - Intergenic
1111385583 13:87522260-87522282 ATCCCCATGTGTCAAGGTTGGGG + Intergenic
1111812955 13:93115119-93115141 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
1113914117 13:113860874-113860896 ATCCGCCTGCTGGAAGGTGGGGG + Intronic
1114028876 14:18557624-18557646 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
1114264751 14:21067012-21067034 AGCCCCATGCCTCAAGTTAGGGG - Intronic
1114820983 14:26019099-26019121 ATCCCCATGTGTCAAGGAAGAGG - Intergenic
1115128342 14:30023416-30023438 ATGCCCATGCTGGAAGGTTGTGG + Intronic
1116232553 14:42235713-42235735 ATGCCCACGCTGGAAGGTTGTGG + Intergenic
1116672461 14:47861138-47861160 ACACCCATGCTGGAAGGTTGTGG + Intergenic
1117953356 14:61104126-61104148 CTCCCCATGCAGCAGGGAAGCGG + Intergenic
1118272133 14:64353286-64353308 GTCACCAGGCTGCAATGTAGCGG + Intergenic
1118687217 14:68302898-68302920 ATGCCCACGCTGGAAGGTTGTGG - Intronic
1119562375 14:75601309-75601331 ATGCCCAAGCTGGAAGGTTGTGG - Intronic
1119564207 14:75614965-75614987 ATCCCCATGTGCCAAGGAAGGGG - Intronic
1120323413 14:82994677-82994699 ATGCCCACGCTGGAAGGTTGTGG + Intergenic
1121085110 14:91139946-91139968 ATCCCCATGTTGCAAGAGAAAGG + Intronic
1123177798 14:106438248-106438270 ATGCCCACGCTGGAAGGTTGTGG + Intergenic
1123673457 15:22684219-22684241 ACACCCATGCTGGAAGGTTGTGG - Intergenic
1125527747 15:40388772-40388794 ATGCCCATGCTGGAAGGTTGTGG - Intronic
1126352561 15:47759696-47759718 ATCTCTATGCTGCAATGAAGCGG - Intronic
1126586156 15:50289810-50289832 ATGCCCAGGCTGGAGGGTAGTGG + Intronic
1126955449 15:53928450-53928472 ATGCCCAAGCTGGAAGGTTGTGG - Intergenic
1127349852 15:58140336-58140358 TTCCCCACTATGCAAGGTAGGGG + Intronic
1128017206 15:64357624-64357646 GTCTCCATGCTGCAGGGCAGTGG - Intronic
1129792308 15:78349540-78349562 ATGCCCATGCTGTAAGGTTGTGG - Intergenic
1130271324 15:82450756-82450778 TTGCCCAGGCTGGAAGGTAGTGG + Intergenic
1130463662 15:84178092-84178114 TTGCCCAGGCTGGAAGGTAGTGG + Intronic
1130489010 15:84416691-84416713 TTGCCCAGGCTGGAAGGTAGTGG - Intergenic
1130500604 15:84495450-84495472 TTGCCCAGGCTGGAAGGTAGTGG - Intergenic
1131821819 15:96281645-96281667 ATCCCCATGTGTCAAGGGAGGGG + Intergenic
1133349235 16:5090460-5090482 TGGCCCATTCTGCAAGGTAGAGG + Exonic
1135728538 16:24875754-24875776 CTCCCCATGCTGCATGGGTGAGG - Intronic
1135829241 16:25758914-25758936 TTACCCAGGCTGCAAGGCAGTGG - Intronic
1137660005 16:50197065-50197087 ATCCCCAGGCTGGAAGGCAGTGG - Intronic
1138162049 16:54763431-54763453 ATCCCCATGGTGCACTGCAGTGG + Intergenic
1138892715 16:61164668-61164690 TTGCCCATGCTGGAAGGCAGTGG + Intergenic
1139104762 16:63815351-63815373 AGCCCCATGCTGCAAGGGATAGG - Intergenic
1139335459 16:66227895-66227917 ATCCCCATGTGTCAAGGGAGAGG - Intergenic
1140065889 16:71610928-71610950 ATCCCCATTTTGCAAGCGAGAGG + Intergenic
1142544395 17:689335-689357 GTCCCCAGGCTGCAGTGTAGAGG + Intronic
1142874544 17:2843644-2843666 CGCCCCACCCTGCAAGGTAGTGG - Intronic
1144074065 17:11701264-11701286 ATCCCCATCCTCCATGGTTGGGG + Intronic
1144347977 17:14367216-14367238 ATCCCCATGTGTCAAGGGAGAGG - Intergenic
1146685041 17:34835874-34835896 ATCTCCATGGTGCAAGAGAGAGG + Intergenic
1146768107 17:35542473-35542495 TTCCCCAAGCTGCAGTGTAGTGG + Intergenic
1148204631 17:45772095-45772117 CTCCCCATGCTGCAAAGCTGAGG - Intergenic
1149783479 17:59416650-59416672 ATGCCCACGCTGGAAGGTTGTGG + Intergenic
1149914549 17:60597254-60597276 TTGCCCAGGCTTCAAGGTAGTGG + Intergenic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1151958625 17:77393219-77393241 CTCCCCATGCTGCCCGGTATGGG - Intronic
1152064273 17:78101853-78101875 ACGCCCATGCTGGAAGGTTGTGG - Intronic
1152600082 17:81257854-81257876 TGCCCCATGCAGCAAGGGAGGGG + Intronic
1153406697 18:4748834-4748856 GTCCCCATGCAGAAAGGCAGAGG + Intergenic
1154087088 18:11317327-11317349 ATCCACATGTTGCAAGATAAAGG + Intergenic
1156265646 18:35486074-35486096 CTGCCCATGCTGGAAGGCAGTGG - Intronic
1157550839 18:48580857-48580879 ATCCACATCCTGCCAGGCAGGGG - Intronic
1158087607 18:53671734-53671756 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
1159195669 18:65110879-65110901 AATCCCATGCTGGAAGGTTGTGG - Intergenic
1159672335 18:71237074-71237096 ATCCCCATGTGTCAAGGGAGAGG + Intergenic
1161808623 19:6459228-6459250 ATCCCCCTGCTGCGGGGCAGGGG - Intronic
1161823747 19:6547842-6547864 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
1162047800 19:8012633-8012655 ATCCCCACGCTGGAGTGTAGTGG - Intronic
1162283315 19:9717845-9717867 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
1163068033 19:14813829-14813851 ATCCCCATGTGTCAAGGAAGGGG - Intronic
1163895716 19:20057221-20057243 ATGCCCACGCTGGAAGGTTGTGG + Intergenic
1164024488 19:21338768-21338790 AAGCCCATGCTGGAAGGTTGTGG - Intergenic
1164261655 19:23572974-23572996 ATGCCCATGCTGGAAGGTTGTGG - Intronic
1164887929 19:31799117-31799139 ATCACCATGTTGCAAGGATGAGG - Intergenic
1165399425 19:35588447-35588469 ATCCCCATTCTCCATGGTGGTGG - Intergenic
1167530987 19:50016376-50016398 GTTCCCTTGCAGCAAGGTAGAGG + Intronic
1167917689 19:52755453-52755475 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
926273910 2:11388972-11388994 ATCCCCATCCTGGAGGGTGGTGG + Intergenic
927641456 2:24848159-24848181 ACGCCCATGCTGGAAGGTTGTGG + Intronic
928234373 2:29527154-29527176 ATAACCATGCTGCAAATTAGCGG + Intronic
928377345 2:30786486-30786508 CTCACCTGGCTGCAAGGTAGAGG + Intronic
928671731 2:33609956-33609978 ATGCCCATGCTGGAAGGTCGTGG + Intergenic
934498474 2:94832735-94832757 TTGCCCATGCTGCAGTGTAGTGG - Intergenic
937610248 2:123852685-123852707 ATGCCCAAGCTGGAAGGTTGTGG + Intergenic
938789746 2:134666175-134666197 AGCCCCATGGTGGAAGGTGGTGG - Intronic
940301184 2:152177756-152177778 ATGCCCACGCTGGAAGGTTGTGG + Intergenic
941239085 2:163014788-163014810 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
941258117 2:163259213-163259235 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
942839965 2:180348560-180348582 ATCCCCATGTATCAAGGGAGGGG - Intergenic
943062562 2:183053646-183053668 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
943286492 2:186008037-186008059 ACGCCCATGCTGGAAGGTTGTGG + Intergenic
943903671 2:193472159-193472181 ATGCCCACGCTGGAAGGTTGTGG + Intergenic
945529092 2:210927558-210927580 ATCCCCATGTGTCAAGGGAGGGG + Intergenic
946380760 2:219347194-219347216 ATGCCCAAGCTGGAAGGTTGTGG - Intergenic
946894971 2:224314340-224314362 ATCCTCATGCTGCAATGTTTAGG - Intergenic
947977974 2:234384223-234384245 ACGCCCATGCTGGAAGGTTGTGG + Intergenic
948331158 2:237166681-237166703 ATCCCCATGGCACAAGATAGAGG - Intergenic
1169022883 20:2342715-2342737 ATTCCTATGCTGCATGATAGAGG + Intergenic
1169404008 20:5308285-5308307 ATGCCCACGCTGGAAGGTTGTGG + Intronic
1169679615 20:8196130-8196152 ATCCCCATGTGTCAAGGGAGGGG - Intronic
1171093819 20:22312271-22312293 ATCCCCATGTTTCAAGGATGGGG - Intergenic
1172453924 20:35050959-35050981 GTCCCCATGCTGGAATGCAGTGG - Intronic
1175732992 20:61366761-61366783 ACGCCCATGCTGGAAGGTTGTGG - Intronic
1177683852 21:24410965-24410987 ATGCCCATGCTGGAAGGTTGTGG - Intergenic
1178089501 21:29146596-29146618 AGCCCCTTGCTGCAGGTTAGAGG - Intronic
1178321574 21:31610160-31610182 ATGCCCAAGCTGGAAGGTTGTGG - Intergenic
1178423770 21:32462641-32462663 ATGCCCATGCTGGAAGGTTGTGG + Intronic
1179251239 21:39673393-39673415 ATCCCCCTGTGGCAAGGTGGGGG + Intergenic
1180452996 22:15484686-15484708 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
1180721964 22:17916015-17916037 ATCCCCAGGCTGGAATGCAGTGG - Intronic
1181594189 22:23903723-23903745 TTGCCCATGCTGCAATGCAGTGG + Intergenic
1182063275 22:27412987-27413009 ATCCCCATGGCCCATGGTAGGGG - Intergenic
1182836624 22:33347274-33347296 ATCCCAATGCTGCCAGGTGCAGG - Intronic
1184220116 22:43094562-43094584 ACCTCCATGCTGCAAGGGGGAGG - Intergenic
1184291671 22:43500748-43500770 GCCCCCAGGCTGCAGGGTAGAGG + Intronic
949415109 3:3805641-3805663 ATCACCTTGCAGAAAGGTAGGGG - Intronic
950202815 3:11056908-11056930 ATCCCTCTGCTGCAGTGTAGAGG - Intergenic
950315221 3:11996095-11996117 TGCACCATGCTGCAAGGCAGGGG + Intergenic
951270765 3:20620369-20620391 ATGCCCATGCTGGAAGATTGTGG - Intergenic
952420735 3:33128943-33128965 ATTCCCATGCAGCTAGGTTGGGG - Intronic
953723446 3:45376717-45376739 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
953836221 3:46347501-46347523 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
956607707 3:71089622-71089644 ATCCCCATGTGGCAAGGATGGGG - Intronic
956709984 3:72030552-72030574 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
957053559 3:75427803-75427825 TGGCCCATTCTGCAAGGTAGAGG + Intergenic
958671413 3:97210449-97210471 ATCCCCACGTGTCAAGGTAGGGG - Intronic
959627520 3:108469578-108469600 AACTACATCCTGCAAGGTAGTGG + Intronic
959784815 3:110283252-110283274 CTACCCCTGCTGCAGGGTAGAGG + Intergenic
961301272 3:125923746-125923768 TGGCCCATTCTGCAAGGTAGAGG - Intergenic
961853994 3:129850994-129851016 ATGCCCACGCTGGAAGGTTGTGG - Intronic
961887228 3:130104194-130104216 TGGCCCATTCTGCAAGGTAGCGG + Intronic
963511414 3:146252526-146252548 ATGCCCAAGCTGGAAGGTTGTGG + Intergenic
963879930 3:150517738-150517760 ACGCCCATGCTGGAAGGTTGTGG + Intergenic
964957090 3:162373810-162373832 ATGCCCAAGCTGAAAGGTTGTGG + Intergenic
966978201 3:185105302-185105324 ACACCCATGCTGGAAGGTTGTGG + Intronic
966978797 3:185110637-185110659 ACGCCCATGCTGGAAGGTTGTGG + Intronic
968996353 4:3948115-3948137 CGGCCCATTCTGCAAGGTAGAGG + Intergenic
969367258 4:6703717-6703739 ATCCCCATGGTGGGAAGTAGAGG - Intergenic
969757633 4:9160573-9160595 TGGCCCATTCTGCAAGGTAGAGG - Intergenic
969817613 4:9698104-9698126 CGGCCCATTCTGCAAGGTAGAGG - Intergenic
970130037 4:12858752-12858774 GTCCCCATGCTGCAGTGCAGTGG + Intergenic
971112900 4:23609051-23609073 ATCCCCATGTGTCAAGGGAGGGG + Intergenic
971276765 4:25205787-25205809 GTCCCCAGGCTGCAATGCAGTGG + Intronic
971423923 4:26498112-26498134 TTCCCCAAGCTGGAAGGCAGTGG + Intergenic
971580634 4:28334999-28335021 ATCCCCATGTGTCAAGGGAGGGG + Intergenic
971813911 4:31462799-31462821 ACACCCATGCTGGAAGGTTGTGG + Intergenic
972080654 4:35144798-35144820 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
972484656 4:39529345-39529367 TTCCCCAGGCTGCAGGGCAGTGG - Intergenic
972876966 4:43374534-43374556 TTCCCCATGCTGGAATGCAGTGG + Intergenic
973008335 4:45042147-45042169 ATACCCACGCTGGAAGGTTGTGG + Intergenic
973009013 4:45048611-45048633 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
973607056 4:52598456-52598478 ATCCCCATGCTCCATGGAAAGGG - Intronic
974535084 4:63164203-63164225 ATGCCCATGCTGGAAGGTTGTGG - Intergenic
974581206 4:63804195-63804217 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
974978463 4:68922281-68922303 ATGCCCATGCTGGAAGATTGTGG + Intergenic
975412469 4:74069940-74069962 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
975434034 4:74330435-74330457 ATCACCAGGCTGGAATGTAGTGG - Intergenic
975575492 4:75858341-75858363 ACGCCCATGCTGGAAGGTGGTGG - Intergenic
975580071 4:75898210-75898232 ACGCCCATGCTGGAAGGTGGTGG - Intronic
975900933 4:79151678-79151700 AAGCCCATACTGCAAGGGAGGGG + Intergenic
976977971 4:91186905-91186927 ATGCCCATGCTGGAAGATTGTGG - Intronic
977554036 4:98470822-98470844 AGCCCCATGGTGCATGGTGGTGG - Exonic
977625696 4:99187517-99187539 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
977638469 4:99328145-99328167 ATGCCCATGCTGGAAGGCTGTGG - Intergenic
978011555 4:103691671-103691693 ATGCCCAAGCTGGAAGGTTGTGG + Intronic
979893495 4:126130848-126130870 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
983594742 4:169453520-169453542 ACGCCCATGCTGGAAGGTTGTGG + Intronic
983859433 4:172686986-172687008 ATCCCCATTCTCCAGGGAAGGGG + Intronic
984110743 4:175610338-175610360 AAGCCCATGCTGGAAGGTTGTGG - Intergenic
984790597 4:183611368-183611390 ATCCCCAGGCTGCAGTGCAGTGG - Intergenic
984955886 4:185045185-185045207 ATGCCCAAGCTGGAAGGTTGTGG - Intergenic
988134987 5:27158841-27158863 ATCCCCATGTGTCAAGGGAGGGG + Intergenic
989065220 5:37453554-37453576 ATGCCCACGCTGGAAGGTTGTGG - Intronic
989210439 5:38853977-38853999 AACCCTATGCTGTAAGGCAGAGG + Intronic
989426167 5:41298306-41298328 ATGCCCACGCTGAAAGGTTGTGG - Intergenic
989742389 5:44788677-44788699 ATGCCAATGCTGGAAGGTTGTGG + Intergenic
990306496 5:54498610-54498632 ATGCCCAAGCTGGAAGGTTGTGG - Intergenic
990307229 5:54505308-54505330 ATGCCCAAGCTGGAAGGTTGTGG - Intergenic
993303825 5:86249847-86249869 ATCCCCATGTGTCAGGGTAGAGG - Intergenic
993405753 5:87510430-87510452 ATGCCCAAGCTGGAAGGTTGTGG + Intergenic
994419035 5:99509375-99509397 ATGCCCATGCTGGAAGGTTGTGG - Intergenic
995195111 5:109358151-109358173 ATGCCCATGCTAGAAGGTTGTGG + Intronic
995592247 5:113712019-113712041 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
995592721 5:113716203-113716225 ATGCCCATGCTGGAAAGTTGTGG + Intergenic
995665687 5:114539522-114539544 ATGCCCAGGCTGGAAGGTTGTGG + Intergenic
995709517 5:115020931-115020953 TTCCCCAGGCTGCAGGGTAGTGG - Intergenic
996091156 5:119353377-119353399 GTCACCATGTTGCAGGGTAGGGG + Intronic
997223325 5:132188850-132188872 ATCCCCACTCTGCATAGTAGAGG + Intergenic
998343030 5:141434433-141434455 ATGCCCATGCTGGAAGGTAGTGG + Intronic
999420622 5:151439243-151439265 ATCCCCATGTGTCAAGGGAGGGG - Intronic
1002626365 5:180532303-180532325 ATCCTAATGCTGTAAGATAGGGG - Intronic
1003761596 6:9184787-9184809 ATGCCCACGCTGGAAGGTTGTGG + Intergenic
1005185497 6:23159659-23159681 ACACCCATGCTGGAAGGTTGTGG + Intergenic
1006050497 6:31339146-31339168 ATGCCCACGCTGGAAGGTTGTGG - Intronic
1007097553 6:39223136-39223158 ATTCCTATGCTGCAATGGAGCGG - Intronic
1007391548 6:41552260-41552282 ATCCGCATCCTGGAAGGAAGGGG + Intronic
1009518644 6:64653602-64653624 TTCCCCAGGCTGGAAGGCAGTGG + Intronic
1009749324 6:67862729-67862751 ATCCACATGTTGCAAGGGAAAGG + Intergenic
1009955247 6:70445742-70445764 ACGCCCATGCTGGAAGGTTGTGG - Intronic
1010433654 6:75806586-75806608 ACGCCCATGCTGGAAGGTTGTGG + Intronic
1012805650 6:103889406-103889428 ATACCTATAATGCAAGGTAGTGG + Intergenic
1013739218 6:113263800-113263822 ATGCCCATGCTAGAAGGTTGTGG - Intergenic
1014204738 6:118645385-118645407 ACCACCATGCTGCCTGGTAGTGG - Intronic
1014477153 6:121887963-121887985 ATTCTCATGCTGGAAGGGAGAGG + Intergenic
1015186475 6:130422306-130422328 TTGCCCAAGCTGGAAGGTAGTGG + Intronic
1015347617 6:132178557-132178579 ATGCCCAAGCTGGAAGGTTGTGG + Intergenic
1015467002 6:133558805-133558827 ATGCCCATGCTGGAATGTTGTGG - Intergenic
1015825384 6:137305496-137305518 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
1016346674 6:143120862-143120884 ATGCCCATGCTGGAAGGTTGTGG + Intronic
1017070036 6:150568029-150568051 ATCCACAGGCTGCAAGATGGGGG - Intergenic
1017281218 6:152628258-152628280 ATGCAGAGGCTGCAAGGTAGGGG - Exonic
1018007371 6:159635053-159635075 TCACCCATGCTGAAAGGTAGTGG - Intergenic
1019006278 6:168799267-168799289 ATCCCCCGGCTGCAAGGTGATGG + Intergenic
1020320634 7:6936529-6936551 TGGCCCATTCTGCAAGGTAGAGG + Intergenic
1021454498 7:20814673-20814695 ATCCCCAGGCTGGAATGCAGTGG - Intergenic
1021750418 7:23794176-23794198 ATCCCCATGTTTCAAGGGTGGGG + Intronic
1022390360 7:29938515-29938537 ATGCCCACGCTGGAAGGTTGTGG + Intronic
1023960671 7:44923371-44923393 ATGCCCATGCTGGAAGGTTGTGG - Intergenic
1024327434 7:48120667-48120689 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
1024737608 7:52322967-52322989 TTGCCCAGGCTGCAATGTAGTGG + Intergenic
1025122479 7:56317036-56317058 AAGCCCATGCTGGAAGGTTGTGG + Intergenic
1025728448 7:64088986-64089008 ATGCCCACGCTGGAAGGTTGTGG - Intronic
1026225514 7:68436701-68436723 ATGCCCAGGCTGAAAGGCAGTGG + Intergenic
1026775490 7:73228570-73228592 ATACCCACGCTGTAAGGTACTGG + Intergenic
1027071682 7:75163997-75164019 ATACCCACGCTGTAAGGTACTGG - Intergenic
1027518111 7:79167868-79167890 ACACCCATGCTGGAAGGTTGTGG + Intronic
1027578977 7:79968995-79969017 ATCCCCATGTGTCAAGGGAGAGG + Intergenic
1028309991 7:89319129-89319151 ATGCCCAAGCTGGAAGGTTGTGG - Intronic
1030277590 7:107737052-107737074 ACACCCATGCTGGAAGGTTGTGG - Intergenic
1030292336 7:107885124-107885146 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
1031126309 7:117777167-117777189 AACACCATGCTGCTAGTTAGAGG - Intronic
1031950518 7:127887041-127887063 TTACCCATGCTGCAGTGTAGTGG + Intronic
1032084393 7:128876505-128876527 ATCCCCAAGCCACAAGGAAGGGG + Intronic
1032993634 7:137421526-137421548 ATCCTCTGGCAGCAAGGTAGAGG - Intronic
1034012349 7:147543356-147543378 ACACCCATGCTGGAAGGTTGTGG - Intronic
1034259018 7:149742583-149742605 GTCACCATGCTGGAAGGTGGGGG + Intergenic
1034403904 7:150888502-150888524 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
1034754141 7:153598694-153598716 GACCCCATGCTGCTAGGTATGGG - Intergenic
1034911401 7:155001964-155001986 ATCCCCATCCTCCAAGGTGGGGG + Intronic
1034942343 7:155238584-155238606 ATGCCCAGGCTGGAAGGTTGTGG - Intergenic
1034943786 7:155249133-155249155 ATCTCCATGCGTCAAGGTTGGGG - Intergenic
1035588400 8:794654-794676 ATGCCCAAGCTGGAAGGTTGTGG - Intergenic
1036821230 8:11941881-11941903 ACACCCATGCTGGAAGGTTGTGG - Intergenic
1036848688 8:12186728-12186750 TGGCCCATTCTGCAAGGTAGAGG + Exonic
1036870049 8:12429009-12429031 TGGCCCATTCTGCAAGGTAGAGG + Exonic
1037051696 8:14381744-14381766 TTCCCCAGGCTGGAAGGCAGTGG - Intronic
1039580753 8:38664816-38664838 ACCCCCAGGCTGGAAGGCAGTGG - Intergenic
1039691584 8:39870483-39870505 ATGCCCAAGCTGGAAGGTTGTGG + Intergenic
1039692164 8:39875591-39875613 ATGCCCACGCTGGAAGGTTGCGG + Intergenic
1040023138 8:42758398-42758420 TTGCCCATGCTGGAATGTAGTGG + Intronic
1040381391 8:46876635-46876657 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
1040528436 8:48244906-48244928 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
1040529036 8:48250396-48250418 ATGCCCATGCTGGAAGGTTGTGG - Intergenic
1040554732 8:48468667-48468689 ATCCCCAGTGTGCAAGGTAAAGG + Intergenic
1040645373 8:49390958-49390980 ATGCCCAAGCTGGAAGGTTGTGG + Intergenic
1042055038 8:64755456-64755478 ATCCCCAGGCTGCAGGGCAATGG + Intronic
1044016294 8:87051768-87051790 ATGCCCATGCTGGAAGGTTGTGG - Intronic
1044442887 8:92242305-92242327 AAGCCCATGCTGAAAGGTTGTGG + Intergenic
1048101520 8:131357542-131357564 GACCCCATGCTGGAAGGTTGTGG + Intergenic
1049361725 8:142215266-142215288 ATCCCCAGGCAGCTAGGAAGTGG - Intronic
1049736077 8:144206460-144206482 TTGCCCAGGCTGGAAGGTAGTGG + Intronic
1049860903 8:144897961-144897983 ATGCCCACGCTGGAAGGTTGTGG - Intronic
1050906653 9:11013959-11013981 ATGCCCATGCTGGAAGGTTGTGG - Intergenic
1051313603 9:15804556-15804578 ATCCCCAGGATGCAAGGTTGGGG - Intronic
1051507406 9:17841777-17841799 GTCCCCAGGCTGAAATGTAGTGG - Intergenic
1051664766 9:19458258-19458280 TTGCCCAGGCTGGAAGGTAGGGG + Intergenic
1051844256 9:21433974-21433996 ACGCCCATGCTGGAAGGTTGTGG + Intronic
1052580104 9:30344353-30344375 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
1053288298 9:36864067-36864089 ATGCCCAGGCTGGAATGTAGCGG - Intronic
1053539607 9:38959665-38959687 ATGCCCATGCTGGAAGGTTGTGG - Intergenic
1053658679 9:40247798-40247820 TTGCCCATGCTGCAGTGTAGTGG + Intronic
1054370798 9:64394072-64394094 TTGCCCATGCTGCAGTGTAGTGG + Intronic
1054525919 9:66128424-66128446 TTGCCCATGCTGCAGTGTAGTGG - Intronic
1054626534 9:67404253-67404275 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
1054678431 9:67883820-67883842 TTGCCCATGCTGCAGTGTAGTGG + Intronic
1054911410 9:70458615-70458637 ATCCCAAAGTTTCAAGGTAGGGG + Intergenic
1055452512 9:76443585-76443607 ATAGCCATGCTGGAAGGTTGTGG - Intronic
1056148455 9:83759298-83759320 ATGCCCAGGCTGGAAGGGAGTGG + Intronic
1056487221 9:87071599-87071621 ATCCCCATGTTTCAAGGGTGGGG - Intergenic
1056915203 9:90740134-90740156 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
1057286113 9:93755692-93755714 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
1057625146 9:96669985-96670007 ATGCCCACGCTGGAAGGTTGTGG + Intergenic
1057627837 9:96693435-96693457 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
1061602479 9:131680472-131680494 ATGCCCACGCTGGAAGGTTGTGG + Intronic
1061603055 9:131685398-131685420 ATGCCCACGCTGGAAGGTTGTGG + Intronic
1061866333 9:133493486-133493508 CTCCCCAGGCTGCATGGCAGTGG + Intergenic
1061889251 9:133609070-133609092 GTTCCCATGCTTCAAGGTAAGGG - Intergenic
1185848459 X:3462968-3462990 TTGCCCATGCTGGAATGTAGTGG + Intergenic
1186095781 X:6100250-6100272 ACCCCCATGCTGGAAGGCTGTGG - Intronic
1186294009 X:8129093-8129115 ATCCACATGCTGCAAGTGAAAGG + Intergenic
1187115017 X:16340732-16340754 ATGCCCACGCTGGAAGGTTGTGG + Intergenic
1188863576 X:35286812-35286834 ATCCCCATGTGTCAAGGGAGGGG - Intergenic
1189629159 X:42933683-42933705 GTGCCCCAGCTGCAAGGTAGAGG + Intergenic
1190614878 X:52220152-52220174 ATGCCCAAGCTGGAAGGTTGTGG + Intergenic
1191937525 X:66441274-66441296 CTCCCCATGCTGCCAGATATAGG - Intergenic
1191949132 X:66569525-66569547 ACGCCCACGCTGCAAGGTTGCGG - Intergenic
1192767645 X:74158705-74158727 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
1193743236 X:85243903-85243925 CTACCCTTGCTGCAGGGTAGGGG - Intergenic
1193911401 X:87310721-87310743 ATCCCCATGTGTCAAGGGAGAGG - Intergenic
1193915978 X:87364473-87364495 ACGCCCATGCTGGAAGGTTGTGG + Intergenic
1194913264 X:99673425-99673447 ATGCCCATACTGGAAGGTTGTGG - Intergenic
1195546101 X:106114264-106114286 ACCCCCATGCTGGAAGGTTGTGG - Intergenic
1197109487 X:122756047-122756069 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
1197841945 X:130757576-130757598 ATCCCCATTCTGAAAAGCAGTGG - Intronic
1199040707 X:143111966-143111988 ATGCCCAAGCTGGAAGGTTGTGG + Intergenic
1200828299 Y:7665684-7665706 ATCCCCAGGCTGAAAAGCAGAGG - Intergenic
1200908380 Y:8509054-8509076 ATCCCCAGGCTGAAAAGCAGAGG + Intergenic
1200953489 Y:8923036-8923058 ATCCCCAGGCTGAAAAGCAGAGG + Intergenic
1200978359 Y:9238145-9238167 ACACCCATGCTGAAAGGTTGTGG + Intergenic
1201058260 Y:10017415-10017437 ATCCCCAGGCTGAAAAGCAGAGG - Intergenic
1201408583 Y:13674051-13674073 ATGCCCACGCTGGAAGGTTGTGG - Intergenic
1201558512 Y:15290328-15290350 ATCACCAGGCTGGAATGTAGTGG + Intergenic
1202083925 Y:21115132-21115154 ATGCCCATGCTAGAAGGTTGTGG - Intergenic
1202107936 Y:21389955-21389977 ATCCCCAGGCTGAAAAGCAGAGG - Intergenic
1202198987 Y:22327109-22327131 ATCCCCAGGCTGAAAAGCAGAGG + Intronic
1202231583 Y:22664390-22664412 ATCCCCAGGCTGAAAAGCAGAGG + Intergenic
1202311575 Y:23531775-23531797 ATCCCCAGGCTGAAAAGCAGAGG - Intergenic
1202559227 Y:26138819-26138841 ATCCCCAGGCTGAAAAGCAGAGG + Intergenic