ID: 1091621627

View in Genome Browser
Species Human (GRCh38)
Location 12:2093474-2093496
Sequence TGAGCTGCACAGATGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091621627 Original CRISPR TGAGCTGCACAGATGGAAGT GGG Intronic
900081960 1:865175-865197 TGAGCTGCACAGGTGGGTGGTGG - Intergenic
900758977 1:4457727-4457749 TGTGCTGCACTGAAGGAAGCAGG + Intergenic
901274772 1:7982648-7982670 TGAGATGCACAGCTGAGAGTGGG - Intronic
902691518 1:18112755-18112777 TCATCTGCACAGATGGGAGAGGG + Intronic
903293095 1:22326935-22326957 AGAGCTGAACAGACAGAAGTGGG - Intergenic
904826756 1:33278183-33278205 TGAGCTGCTCAGTTGGGAGCTGG - Intronic
904846962 1:33427086-33427108 TGAGTGGCACAGATGGGATTTGG - Intronic
905163467 1:36058966-36058988 GGAGCTGCACAGATTCATGTGGG + Exonic
906129926 1:43449997-43450019 TGAGGTGTGGAGATGGAAGTAGG + Intronic
906181570 1:43824712-43824734 TGAGCTGCAAAGTGGGAATTTGG - Exonic
907420321 1:54342643-54342665 TGAGCAGCAGAGATTGAACTTGG - Intronic
907487431 1:54787563-54787585 TGAGGTGCACAGATGAGTGTAGG + Intronic
913683233 1:121206844-121206866 TGAGCTGCCGAGATGGGTGTGGG + Intronic
914035075 1:143994469-143994491 TGAGCTGCCGAGATGGGTGTGGG + Intergenic
914154378 1:145073502-145073524 TGAGCTGCCGAGATGGGTGTGGG - Intronic
914829455 1:151160062-151160084 TGAGGGGAACAGATGGAAGAAGG - Exonic
915974945 1:160379221-160379243 GGAGCTGCCCAGAAGGAAGTTGG + Intergenic
916451590 1:164926294-164926316 TCAGATGCACAGATGGGGGTAGG + Intergenic
916677371 1:167075236-167075258 TGGGGTGAACAGATAGAAGTGGG + Intronic
917265087 1:173212250-173212272 TGAGCTCCAGTGTTGGAAGTGGG - Intergenic
917611035 1:176689239-176689261 CAAGCTACACAGATAGAAGTTGG + Intronic
917737479 1:177933713-177933735 TGACCTGCTCAGAAGGCAGTGGG + Intronic
920470543 1:206225354-206225376 TGAGCTGCCGAGATGGGTGTGGG + Intronic
921368765 1:214400673-214400695 TGGGCTGCAGAAATGTAAGTGGG + Intronic
921921255 1:220672695-220672717 TGAGCTGGAGGGATGGGAGTGGG - Intergenic
922084537 1:222333386-222333408 TTACCTGCATAGATGAAAGTTGG - Intergenic
924051580 1:240084922-240084944 TCAGCTGTAGGGATGGAAGTGGG + Intronic
924880366 1:248155069-248155091 TCAGCAGGACTGATGGAAGTGGG - Intergenic
924885643 1:248213275-248213297 TCAGCAGGACTGATGGAAGTAGG - Intergenic
1063947847 10:11194580-11194602 CGAGCTGCACAAAGGGAAGATGG + Intronic
1064104470 10:12489613-12489635 CGAGCTGCACAGAAGTAAGCAGG - Intronic
1064462716 10:15550665-15550687 TGAAATGGACAGATGGAAGTAGG + Intronic
1065021282 10:21503448-21503470 GGACCTGGACAGATGGTAGTGGG - Intergenic
1067018428 10:42774712-42774734 TGAACTTCACAGATGAAAGGGGG - Intergenic
1067937060 10:50622305-50622327 AGAGCTGCCCAGATGGAAAGGGG - Intronic
1072777405 10:98212708-98212730 TGATCAGTACAGATGGCAGTAGG - Intronic
1074735246 10:116424586-116424608 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1074897762 10:117791870-117791892 GGAGCTTCCCAGATGGGAGTTGG - Intergenic
1076007098 10:126956496-126956518 TGAGCTGCTCAGTGGGAAGATGG + Intronic
1077341242 11:2027305-2027327 TGAGCTCCAGGGCTGGAAGTAGG - Intergenic
1078108560 11:8373777-8373799 TGAGCTGGAAAAATGTAAGTGGG + Intergenic
1080273629 11:30478160-30478182 GGAGGTGCACAGAAGCAAGTAGG - Intronic
1080754246 11:35180317-35180339 TTTGCTGCACAGATGGAGTTGGG - Exonic
1080897466 11:36458609-36458631 TGAGCTTTGCAGATGGATGTAGG + Intronic
1086087023 11:82966037-82966059 TGTGCTGCACAGAGGCAAGCAGG - Intronic
1088485317 11:110334757-110334779 TAAGCTGCCCAGAAGTAAGTGGG - Intergenic
1089159034 11:116423824-116423846 TGAGCTGGAGAGAGGGCAGTGGG - Intergenic
1090490174 11:127153696-127153718 TGAACTACACAGATGAAATTCGG + Intergenic
1202824227 11_KI270721v1_random:82494-82516 TGAGCTCCAGGGCTGGAAGTAGG - Intergenic
1091621627 12:2093474-2093496 TGAGCTGCACAGATGGAAGTGGG + Intronic
1092041288 12:5387062-5387084 TGAGCTGCAAAAATCAAAGTTGG - Intergenic
1093957321 12:25236012-25236034 TGGGCTGCACAGCCGGAAGGAGG - Intronic
1097711510 12:62922527-62922549 AGAGCTACAGAGATGTAAGTTGG + Intronic
1098098248 12:66983946-66983968 TGTGCTGCAAAGATAGGAGTCGG - Intergenic
1099116980 12:78639465-78639487 TGAGCTGTACATATTTAAGTAGG + Intergenic
1099139189 12:78949365-78949387 TGACCTGCACAGAAGTTAGTTGG - Intronic
1103839039 12:123847907-123847929 TCTGGTGCACAGAAGGAAGTGGG - Intronic
1104200044 12:126579706-126579728 TGAGCTGCACATATGGAGGTAGG - Intergenic
1104294745 12:127501918-127501940 TAAGCTGCATAGATGGGAGCAGG + Intergenic
1104633163 12:130421949-130421971 GGAGGTGCCCAGATGGATGTGGG + Intronic
1107239079 13:38210776-38210798 TGGGTAGTACAGATGGAAGTAGG - Intergenic
1107896904 13:44974446-44974468 TGAGCTGGACGGATGGAAAGAGG + Intronic
1108124855 13:47231481-47231503 TGATTTGCAGAGATGGAAGTAGG - Intergenic
1108369985 13:49759785-49759807 TGGGCTGCACAGTAGGAGGTAGG - Intronic
1108558349 13:51619028-51619050 TGAGCTGCAGAGCTCCAAGTAGG + Intronic
1112022489 13:95383776-95383798 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1112621916 13:101061940-101061962 TGAACTGCACACATGCAGGTTGG - Intronic
1112719332 13:102225165-102225187 GGAGCTGCAAAGAAGGAAGCAGG - Intronic
1113370703 13:109722496-109722518 TGACATGCTCAGATGAAAGTGGG + Intergenic
1113963064 13:114136075-114136097 TGTGCTGCACAAATGGATGCTGG + Intergenic
1114918680 14:27298212-27298234 TGTTCAGCACAGATAGAAGTTGG - Intergenic
1116079252 14:40152628-40152650 TCAGCTGCACAGTTGGAAATAGG + Intergenic
1117620544 14:57581858-57581880 TGTGCTGCACAGATGTATGAGGG - Intronic
1117718206 14:58602353-58602375 TGAACTGCACATATGGAATTGGG + Intergenic
1119565846 14:75628737-75628759 TGGGCAGCACAGATGGATGAAGG - Intronic
1119718644 14:76876257-76876279 TGAGATGCACAGAAGAAAATAGG + Intergenic
1119722420 14:76900204-76900226 TGAGCTTTGAAGATGGAAGTAGG + Intergenic
1120004172 14:79338112-79338134 TGAACTTCACATATGGGAGTTGG + Intronic
1122028563 14:98895633-98895655 TTAGCGGCAGAGCTGGAAGTAGG + Intergenic
1122587903 14:102823123-102823145 TGAGGTAGACAGATGGCAGTGGG + Intronic
1123039447 14:105484413-105484435 TGACCTGCTCAGATGGAGGTGGG + Intergenic
1123679158 15:22745244-22745266 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1124331377 15:28819694-28819716 TGGGCTGCACAGCAGGAGGTGGG + Intergenic
1125445062 15:39745545-39745567 TGAGCTGCACAGATAGACTCTGG - Intronic
1125605061 15:40935409-40935431 TGAGCTGGAGAGAGGGATGTTGG + Intronic
1133781627 16:8943430-8943452 CGAGCTGCACAGATGCAGTTAGG + Intronic
1140298633 16:73734190-73734212 CGGGCTGCACAGCAGGAAGTGGG - Intergenic
1140871464 16:79110432-79110454 TGAGCTACACAGCTGGAGGCAGG - Intronic
1140976720 16:80066919-80066941 TGAGCTGCACAGGTTGAAGGCGG - Intergenic
1141042496 16:80684216-80684238 TGAGCTGCCCTCAGGGAAGTGGG + Intronic
1141784218 16:86187721-86187743 TGGGCTCCACAGATGGGAGAAGG + Intergenic
1142245117 16:88966797-88966819 AGAGCCACCCAGATGGAAGTCGG + Intronic
1142641401 17:1288085-1288107 AGAGCTGCAAAGAGGGAAGGGGG - Intronic
1145039677 17:19567893-19567915 TGAACAGCACAGAAGGAAGGGGG + Intronic
1146483548 17:33225016-33225038 AGAGCAGCAGAGATGGGAGTGGG - Intronic
1147357064 17:39906462-39906484 TGAGCTGGGGAGATGGAAGATGG - Intronic
1147920279 17:43912111-43912133 TGGGTGGCACAGATGGATGTGGG - Intergenic
1148111869 17:45148999-45149021 TGAGCTCCCCAGATTGCAGTTGG + Exonic
1148794904 17:50192316-50192338 GGAGCAGCACAGAGGGAAGTGGG - Intronic
1151505921 17:74526989-74527011 TGAGCTGCAAATATGGATTTGGG - Intronic
1151578656 17:74965187-74965209 TGAGCTGCAGCGCTGGAGGTGGG - Intronic
1151665927 17:75545132-75545154 TCAGCTGCACAGACAGAACTTGG - Intronic
1152528331 17:80902387-80902409 TGAGCTGCACGGATGGCAGAGGG - Intronic
1154309943 18:13259700-13259722 TGAGCAGCACAAATGGAGGGAGG - Intronic
1156539854 18:37898735-37898757 GGAGCCCCACAGCTGGAAGTAGG + Intergenic
1158485530 18:57862690-57862712 TGTGCTGCACAGAGGAATGTAGG + Intergenic
1159109261 18:64037838-64037860 TCAGATGCACAGATGAAATTGGG - Intergenic
1159251084 18:65877644-65877666 TGGGATGCACAGATGGAGGCAGG - Intronic
1159985821 18:74840068-74840090 AGAACTGTACAGTTGGAAGTTGG + Intronic
1162333319 19:10044099-10044121 TTGGCTGCACAGGAGGAAGTGGG + Intergenic
1164414951 19:28039291-28039313 TGACCTGAACAGGTGGAAGAAGG + Intergenic
1165686533 19:37826074-37826096 TGAGCTGCACCCATGTAAGATGG + Intergenic
1167188777 19:47967831-47967853 CAAGCAACACAGATGGAAGTAGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1168012047 19:53540870-53540892 TGAGATGAACAGAAAGAAGTAGG - Intronic
925072644 2:983322-983344 GAAGCTGCAGAGGTGGAAGTCGG + Intronic
926297790 2:11581097-11581119 TGGGCTGCACAGCTGGAGGATGG + Intronic
926867238 2:17373147-17373169 TGAGCTGCTCAGATGAAAGGTGG - Intergenic
932050107 2:68389584-68389606 TGAGTTTCACAGGGGGAAGTGGG + Intronic
932522176 2:72426594-72426616 TGAGCTGCAAAGCTAGAACTGGG + Intronic
933452090 2:82467486-82467508 AGAGATGCACAGACAGAAGTTGG + Intergenic
933950188 2:87322643-87322665 TGAGCTGGCCAGAGGGAAGCTGG - Intergenic
934569896 2:95362746-95362768 TGGGCTGCACAGCAGGAGGTGGG - Intronic
935062500 2:99620699-99620721 TGAGCTGCATTGTTGGAGGTGGG + Intronic
936329999 2:111538954-111538976 TGAGCTGGCCAGAGGGAAGCCGG + Intergenic
936791082 2:116153019-116153041 TTAAGTGCACAAATGGAAGTGGG - Intergenic
937503621 2:122511489-122511511 TGAACTGAAGAGATGGAACTGGG - Intergenic
937790219 2:125952422-125952444 GCAGCTGAACATATGGAAGTTGG - Intergenic
938337485 2:130512355-130512377 GGACGTGCACAGATGGACGTAGG - Intergenic
938352353 2:130608380-130608402 GGACGTGCACAGATGGACGTAGG + Intergenic
939015778 2:136902481-136902503 GGAGCAGCAGAGATGGAACTGGG + Intronic
941316758 2:164003359-164003381 TGAGCATCACAGAAGGAAGCAGG - Intergenic
941427386 2:165365991-165366013 TGAGTTACACAGAAGGAAATAGG - Intronic
941890098 2:170571447-170571469 TGAGCTGGAGAGAGGTAAGTAGG + Intronic
942085358 2:172438341-172438363 TGAGGGGCACAGATGCAGGTAGG + Intronic
942591143 2:177547994-177548016 TGACCTTCACAGATGGTATTGGG + Intergenic
942616593 2:177797174-177797196 TTGGCTGCCCTGATGGAAGTGGG - Intronic
943001204 2:182330656-182330678 AGAGCTGCAGCGATGGTAGTGGG - Intronic
947588290 2:231370420-231370442 TGAGCTCCACAGAGGGAAGTGGG - Intronic
948127941 2:235578434-235578456 TGAGCTGCACACTTAAAAGTGGG + Intronic
948396923 2:237651504-237651526 GGAGCTTCCCAGATGGAAGGAGG - Intronic
948589426 2:239039684-239039706 AGAGCTGAACAGATGCCAGTCGG + Intergenic
948949606 2:241240422-241240444 TGATCTGCACAGGGGGAGGTGGG + Intronic
1173251230 20:41365222-41365244 TGAGGCCCACAGATGGAGGTGGG - Intronic
1173268538 20:41510035-41510057 AGATCTGCAGAGATGGCAGTGGG + Intronic
1173566318 20:44040959-44040981 GGAGCTGAACTGATGGAGGTGGG + Intronic
1174087706 20:48020710-48020732 TGGGATGCACAGCTGGAAGAAGG + Intergenic
1174128343 20:48325127-48325149 TGGGCTGCACAGCTGGAAGAAGG - Intergenic
1175962494 20:62644185-62644207 CCAGCAGCACAGAGGGAAGTCGG - Intronic
1178788137 21:35673426-35673448 TGAGCTCCACTGAGGGAAGATGG - Intronic
1179146599 21:38773931-38773953 TGAGCTGCACACATGCAGGATGG + Intergenic
1179617693 21:42592732-42592754 TGATCTGGACAGATGGGAGGTGG + Intergenic
1182794414 22:32980364-32980386 AGAGCTGCTCTGATGGAAATGGG - Intronic
1182817730 22:33181030-33181052 TGAGCTGCACACTTGAAAGTGGG + Intronic
1183228924 22:36568845-36568867 TGAGCTGCATATAGGGAAGCAGG + Intronic
1185060224 22:48602818-48602840 TGAGCTTCACAGATGGAACCTGG + Intronic
1203274634 22_KI270734v1_random:79212-79234 GCAGCTGCACAGAGGGAAGCAGG - Intergenic
949373854 3:3365242-3365264 TGCTCTGTACAGATGGAAGTTGG + Intergenic
950354915 3:12399098-12399120 TGTGCTGCACAGATGGGGCTGGG - Intronic
950492337 3:13313695-13313717 TGAGCTGGTCTGAGGGAAGTGGG + Intergenic
951062549 3:18226630-18226652 TCAGTTGCAGAAATGGAAGTTGG + Intronic
951477859 3:23127355-23127377 TGAGCTGGAAAGATGGAAAGCGG - Intergenic
952489683 3:33855958-33855980 TGGGCTGCACAGTAGGAGGTGGG + Intronic
953693477 3:45139508-45139530 TTAGCTTCCCAGCTGGAAGTTGG - Intronic
953821875 3:46213999-46214021 TTAACTTCACAGATGCAAGTGGG - Intronic
954107768 3:48418539-48418561 TGAGCTGGAGAAATGGGAGTGGG + Exonic
955043372 3:55337538-55337560 GGACCTGCTCAGATGGAGGTTGG + Intergenic
955076695 3:55620656-55620678 ACAGCTGCACAGAGGGAACTGGG + Intronic
956406450 3:68932810-68932832 TGAGCTCCACATAAGGAAGACGG + Intergenic
957038040 3:75312977-75312999 TGAGTTCGACAGATGGAGGTGGG - Intergenic
959228280 3:103614871-103614893 TGTACTGCTCTGATGGAAGTGGG - Intergenic
960595290 3:119402788-119402810 AGAGCTGCAGAGCTGGAATTGGG + Intronic
960691162 3:120348270-120348292 TGAACTCCACAAATGGTAGTTGG + Intronic
961086048 3:124068242-124068264 TGAGTTCCACAGATGGAGGTGGG - Intergenic
962500060 3:135982169-135982191 TGGGCTGCACATGTGGCAGTTGG + Intronic
965102588 3:164320058-164320080 TAAGCTGCAGAGATAGAAATTGG - Intergenic
965658084 3:171011386-171011408 TGTGCTTCAAAGATGGAAGAAGG + Intronic
966055617 3:175685221-175685243 AGACCTGCATAGATGGAGGTGGG - Intronic
967713579 3:192737734-192737756 TGGGCAGCACAGATGGAGGTGGG + Intronic
968344043 3:197985188-197985210 AGAGCTGAAAAGATGGAAGCTGG - Intronic
968607936 4:1544357-1544379 TGAGCTGCACACATTGACCTAGG - Intergenic
969079367 4:4606579-4606601 TGAGAAGCACAGAGGGAAGAAGG - Intergenic
969157685 4:5225881-5225903 TGTGCTGCACAGTGGGAAGCAGG + Intronic
969453804 4:7289751-7289773 TGAGCTGCAGAGGCGGACGTGGG + Intronic
973182310 4:47284135-47284157 TGAGCTGCCCTGATGGAAAATGG - Intronic
975622006 4:76305721-76305743 TGAGCTGCAGACATAGACGTGGG + Intronic
975698776 4:77041831-77041853 TGAGCTGGACAGATAGAAACAGG + Intergenic
976837898 4:89396653-89396675 TGAGTTGGAGAGATGGAATTGGG - Intergenic
979419408 4:120485684-120485706 TTAGATGCCCAGTTGGAAGTTGG + Intergenic
980989651 4:139728392-139728414 TGTGCTGCACACATGTATGTGGG - Intronic
981298743 4:143163249-143163271 TGAGCTGGAAAGATAGGAGTTGG - Intergenic
982397198 4:154925504-154925526 TGAACTGCAGAGCTGGCAGTTGG + Intergenic
984700198 4:182814174-182814196 CTAGCTGCCCAGATGGAAGTAGG + Intergenic
985111230 4:186547540-186547562 TGAGGTGCTCAGATGGAACAGGG - Intronic
985570193 5:640702-640724 GGGGCTGCAGAGATGGCAGTTGG - Intronic
986082534 5:4409593-4409615 TGAGCTTCACAGAGGGAGGCAGG - Intergenic
986180696 5:5390573-5390595 TCAGAGGCAGAGATGGAAGTTGG - Intergenic
986977734 5:13412062-13412084 TGAGCTCCACACTTGGATGTTGG - Intergenic
987058892 5:14223046-14223068 TCAGCTGCACTCATGGAAGGAGG - Intronic
987078765 5:14407540-14407562 GGAGCTGCTCTGATGGAAATGGG + Intronic
987707438 5:21473964-21473986 TCAGAGGCAGAGATGGAAGTTGG + Intergenic
988094958 5:26594424-26594446 TGAGCTGCTCACCTGGAAGCTGG + Intergenic
990380636 5:55219466-55219488 TGAACTGCACAGATAAAACTGGG - Intergenic
991687868 5:69198367-69198389 TGAACCGCAGAGATGGAGGTTGG - Intronic
994324895 5:98436899-98436921 GGTCCTGCACAGATGGAACTTGG - Intergenic
995061645 5:107817184-107817206 GGAGCTCCAGAGATGGAGGTGGG + Intergenic
997007416 5:129834438-129834460 TGGGATGCACAGAACGAAGTGGG - Intergenic
998521561 5:142805706-142805728 TGAGCTGGACAGATTTTAGTAGG + Intronic
999682616 5:154074230-154074252 TGAGTCACACAGATAGAAGTGGG - Intronic
1001052333 5:168423484-168423506 TGAGATGCACACAGTGAAGTGGG - Intronic
1001388722 5:171361217-171361239 TGAGCTGCAGAGATGAGATTAGG - Intergenic
1005571025 6:27145862-27145884 TGGGCTGCAGAGATGGAATCAGG + Intergenic
1005781731 6:29200534-29200556 TGAGCTCCACATCTGAAAGTGGG - Intergenic
1006315957 6:33291861-33291883 TGTGCTGCACTCATGGAAGGTGG + Exonic
1006407959 6:33856115-33856137 TGCGCTGGACAGAAGGGAGTTGG - Intergenic
1007275192 6:40668229-40668251 GGAGCTGCAGATGTGGAAGTAGG - Intergenic
1008087608 6:47261037-47261059 TGAGATGTACACATGGAAGACGG + Intronic
1009020786 6:57946548-57946570 TCAGAGGCAGAGATGGAAGTTGG - Intergenic
1009414616 6:63401611-63401633 TGAGTTGCCCAGCTGTAAGTGGG + Intergenic
1009700661 6:67174495-67174517 TAAACTGAAGAGATGGAAGTTGG + Intergenic
1015415070 6:132939092-132939114 TGATCTGCATTGTTGGAAGTGGG + Intergenic
1017477690 6:154814764-154814786 TGAACTGTACAGCTGAAAGTAGG + Intronic
1017810109 6:157978327-157978349 TGAGCTGCACAAAGGAAAGTGGG - Intergenic
1019057052 6:169231529-169231551 GGAGCTGCTCAGCTGGAAGAAGG - Intronic
1020260735 7:6529497-6529519 CCAACTGCACAGATGGAAGAAGG + Intronic
1022492194 7:30829622-30829644 TGAGCTGCGGAGGTGGAGGTGGG + Intronic
1023981825 7:45074876-45074898 TGAGCAGCAGAGTTGGATGTTGG + Intronic
1028388768 7:90291007-90291029 TGAGCTGCACAAACCAAAGTAGG + Intronic
1030058840 7:105607151-105607173 TGAGCTGCACAGCTGGACAGTGG + Exonic
1031067060 7:117116433-117116455 AGAGCTGCACAGATCCAAATGGG - Intronic
1031998216 7:128246760-128246782 GGAGCTGCACAGATGAAATGTGG - Intronic
1033909450 7:146246757-146246779 TGTCCTGCACAGATGGGACTCGG + Intronic
1037170750 8:15888809-15888831 AGAGCTGCCTAGATGGAAGCAGG - Intergenic
1037690374 8:21176836-21176858 TGGGCTGCACAGCAGGAGGTGGG - Intergenic
1042184803 8:66126156-66126178 TGAAATGCAGATATGGAAGTAGG + Intergenic
1045133350 8:99183404-99183426 TGAAATGCTCAGATGGAATTGGG + Intronic
1045939238 8:107718571-107718593 TGAGCTGACGAGATGAAAGTGGG + Intergenic
1046327818 8:112672979-112673001 TTAGGTGCTCAGAAGGAAGTTGG + Intronic
1048073896 8:131048029-131048051 TGAACTGCACACTTGGAAATTGG - Intergenic
1049056893 8:140243888-140243910 TGAGCCGCACAGCAGGAGGTGGG + Intronic
1049724487 8:144139251-144139273 AGAGCTGCACAGCTGGGAGCCGG + Exonic
1051447822 9:17159740-17159762 TGAGCTGGAAAGGTGGAAGGAGG + Intronic
1057911455 9:99023153-99023175 TGGGCTGCACAGCTGGGAGGCGG + Intronic
1059514538 9:114880731-114880753 TGATCTGGACTGATGGAAGGTGG + Intergenic
1059889339 9:118784112-118784134 TAAGCTGAACAGATAGGAGTTGG + Intergenic
1185853798 X:3513453-3513475 TGAGCTGCTCAGACAGAAGTTGG + Intergenic
1186996683 X:15131189-15131211 TGAGCCACACAGAAGGAGGTGGG + Intergenic
1188446666 X:30259971-30259993 TGAACTGCTCAGATGGCAATAGG - Intergenic
1189083048 X:37994613-37994635 TGAGCAGCTCAGATGGATCTTGG + Intronic
1189865397 X:45322094-45322116 TCAGCTCCCCAGATGGATGTGGG - Intergenic
1193691300 X:84647526-84647548 TAAGTTGCACATATGGAATTTGG + Intergenic
1194061099 X:89199145-89199167 TGAGCTGCTCTGTTTGAAGTGGG - Intergenic
1194200900 X:90951888-90951910 TGATCTGTACGGATGGAAGTCGG + Intergenic
1197457938 X:126701318-126701340 TGAGCTGCACTGTTTGAGGTTGG - Intergenic
1198843799 X:140887557-140887579 TGAGCTTCAAATATTGAAGTTGG - Intergenic
1199712056 X:150476643-150476665 TGTGCAGCACAGAGGGAAGAGGG + Intronic
1199825187 X:151491629-151491651 GGAGCTGCAGGGATGGGAGTGGG - Intergenic
1199973339 X:152876630-152876652 TGTGCTTCAAAGATGGAAGAAGG - Intergenic
1200809659 Y:7471071-7471093 TGAGCTGCTCAGACAGAAGTTGG - Intergenic
1200972192 Y:9164510-9164532 AGGGCTGCACAGATGAAAGTAGG + Intergenic
1201163082 Y:11181681-11181703 TGGGCTGCACAGGATGAAGTAGG + Intergenic
1202138838 Y:21699803-21699825 AGGGCTGCACAGATGAAAGTAGG - Intergenic
1202304743 Y:23456693-23456715 TGAACTTCACAGCTGGAGGTGGG - Intergenic
1202566067 Y:26213898-26213920 TGAACTTCACAGCTGGAGGTGGG + Intergenic