ID: 1091622174

View in Genome Browser
Species Human (GRCh38)
Location 12:2097576-2097598
Sequence TTTCGATAATAGCCGTCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091622172_1091622174 12 Left 1091622172 12:2097541-2097563 CCACATGATTGCCAATACTTGTT 0: 1
1: 0
2: 75
3: 553
4: 1708
Right 1091622174 12:2097576-2097598 TTTCGATAATAGCCGTCCTAAGG 0: 1
1: 0
2: 2
3: 30
4: 66
1091622173_1091622174 1 Left 1091622173 12:2097552-2097574 CCAATACTTGTTATTTTCTGATT 0: 4
1: 39
2: 270
3: 765
4: 2130
Right 1091622174 12:2097576-2097598 TTTCGATAATAGCCGTCCTAAGG 0: 1
1: 0
2: 2
3: 30
4: 66
1091622171_1091622174 21 Left 1091622171 12:2097532-2097554 CCAATTTTTCCACATGATTGCCA 0: 1
1: 1
2: 58
3: 581
4: 3459
Right 1091622174 12:2097576-2097598 TTTCGATAATAGCCGTCCTAAGG 0: 1
1: 0
2: 2
3: 30
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091622174 Original CRISPR TTTCGATAATAGCCGTCCTA AGG Intronic
905757783 1:40526112-40526134 TTTTGATAATAGCCATCCTGAGG - Intergenic
907204962 1:52761851-52761873 TTTTGTTAATAGCCATCCTGAGG + Intronic
910993907 1:93083751-93083773 TTTTGATTATAACCATCCTAGGG + Intronic
912662660 1:111546960-111546982 TTTTAATAATAGCCATCCTAAGG + Intronic
919584527 1:199419682-199419704 TTTCAATAATAGCCATTCTGGGG - Intergenic
921411792 1:214843926-214843948 TTATGATAATAGCCATCTTAAGG - Intergenic
1063619241 10:7630506-7630528 GTTCCATTATAGCCATCCTAGGG + Intronic
1064141211 10:12791995-12792017 TTTCAATAATAGCCCTCTAATGG + Intronic
1064717629 10:18193373-18193395 TTTCGATTATAGCCATCCTGTGG + Intronic
1065457360 10:25921025-25921047 TTTTTATAGTAGCCATCCTAAGG - Intergenic
1079795953 11:24803330-24803352 TTTTGGTAATAGCCATCCTAAGG - Intronic
1081131020 11:39380495-39380517 TTTTAATAATAGCCATCCAATGG + Intergenic
1081974831 11:47226583-47226605 TTTTGATAGTGGCCATCCTAAGG + Intronic
1086057039 11:82658899-82658921 TTTTGATAATAGCCATTCTAAGG - Intergenic
1091622174 12:2097576-2097598 TTTCGATAATAGCCGTCCTAAGG + Intronic
1092724555 12:11472523-11472545 TCTTGATAGTAGCCATCCTAAGG + Intronic
1093517243 12:20003198-20003220 TTTTGATAATAGCCATTCTGGGG + Intergenic
1095061119 12:37690589-37690611 TTTCCATATTAGGCCTCCTAGGG + Intergenic
1095061403 12:37696078-37696100 TTTCCACAATAGGCCTCCTAGGG + Intergenic
1097951400 12:65432942-65432964 TTTTAATAATAGCTATCCTAAGG - Intronic
1099323884 12:81186673-81186695 TTTTGATAATAGCCATCTAATGG - Intronic
1110571731 13:77011801-77011823 TTTTGATTATAGCCATGCTAGGG - Intronic
1118702355 14:68446060-68446082 TTTCTATAATAGCCGCTCCAGGG + Intronic
1127192964 15:56551800-56551822 TTTTGATAATAGTCATCCTTTGG - Intergenic
1131464175 15:92642128-92642150 TTTTGCTTATAGCCATCCTAAGG - Intronic
1131733460 15:95306482-95306504 TTTTGATATTAGCCATCCTGTGG - Intergenic
1133160168 16:3906218-3906240 TTTGGATAGTAGCCATCCTAAGG - Intergenic
1134371338 16:13628273-13628295 TTTACATAATAGCGGTCCTCAGG - Intergenic
1146115927 17:30138858-30138880 ATTTGATAATAGCTATCCTAAGG + Intronic
1150908089 17:69359999-69360021 TTTTAATAATAGCCATTCTATGG - Intergenic
1155467656 18:26156114-26156136 TTTTGATAATAGCCATTCTGAGG - Intronic
1155590108 18:27418295-27418317 TTTTGATTATAGCCCTCCTAGGG + Intergenic
1163308638 19:16498621-16498643 TTTTGATTATAGCCATGCTAGGG + Intronic
1168198923 19:54799189-54799211 TTTTGATGATACCCATCCTAAGG - Intronic
930757936 2:54997321-54997343 TTTTGATTATAGCCATCCTAGGG - Intronic
930985628 2:57584217-57584239 TTTGAATTATAGCCATCCTAGGG + Intergenic
931698001 2:64886339-64886361 TTTTAATTATAGCCATCCTAAGG + Intergenic
937844401 2:126563804-126563826 TTTTGATTATAGGCATCCTAGGG - Intergenic
938321020 2:130363956-130363978 TTTTAATTATAGCCATCCTAGGG + Intronic
939735236 2:145835790-145835812 TTTTGATAATAGCTACCCTAAGG + Intergenic
942948657 2:181697859-181697881 TTTTGATAGTAGCCATCTTATGG + Intergenic
1171103448 20:22408718-22408740 TTTTGATAATAGCCATCCTGAGG - Intergenic
1172249303 20:33467654-33467676 TTTTTATAATAGCCATCCGATGG + Intergenic
1172724874 20:37031509-37031531 TTTTGATAATGGCCATCCAATGG - Intronic
1175772954 20:61635314-61635336 TTTTTATAATAGCCATCCTAAGG + Intronic
1178047163 21:28708637-28708659 TTTTGTTAATAGCTTTCCTAAGG - Intergenic
1183897396 22:40980316-40980338 TTTTGATAATAGCCATCCTGGGG + Intergenic
952479055 3:33741410-33741432 TTTTGATAATAGCCATTCTAAGG + Intergenic
953813811 3:46136650-46136672 TTTTGATTATAGCCGTCCTGGGG + Intergenic
955153711 3:56394680-56394702 TTTTGATTATAGCCGTACTAGGG - Intronic
955895257 3:63693170-63693192 TTTTGATAATATCCATCCTAGGG - Intergenic
956852536 3:73243528-73243550 TTTTGATTATAGCCATTCTAAGG - Intergenic
959293615 3:104506291-104506313 TTTTGATAATAGCCATTTTAAGG + Intergenic
960098062 3:113707362-113707384 TTTTAATAATAGCCATTCTAGGG - Intergenic
963805723 3:149719790-149719812 CTTTGATAGTAGCCATCCTAAGG + Intronic
964981521 3:162687684-162687706 TTTTCATTATAGCCGTCTTAGGG - Intergenic
967604373 3:191426838-191426860 TTTCTCTAATAGCCAGCCTAAGG - Intergenic
971005618 4:22371374-22371396 TTTTGATAATAACCGTTCTAAGG - Intronic
972111271 4:35562192-35562214 TTTTGAAAATAGCCATTCTATGG - Intergenic
974909722 4:68102495-68102517 TTTTGGTAATAGCCATCCTAAGG + Intronic
975200232 4:71578968-71578990 TTTCGATAATAGCCATTGTATGG - Intergenic
976762112 4:88560265-88560287 TTTTTATAATAGCCATCCTAAGG + Intronic
977063604 4:92286664-92286686 TTTTTATAATAGCCCTTCTAAGG + Intergenic
977403509 4:96564883-96564905 TTTCAATAATACCCATTCTAAGG - Intergenic
979982036 4:127268860-127268882 TTTTGATGATAGCCATCCTATGG - Intergenic
981860740 4:149353249-149353271 TTTTGATAATAGCCATCCTAAGG - Intergenic
983100216 4:163616568-163616590 TTTTGATAATAGACATCCTAAGG - Intronic
990394336 5:55360627-55360649 TTTGGTTAATAGCCATCCTTGGG + Intronic
990769981 5:59232485-59232507 TTTTAATAATAGCCATTCTAAGG - Intronic
997505893 5:134416577-134416599 TTTAAATTATAGCCATCCTAGGG + Intergenic
1005625149 6:27655552-27655574 TTTTTCTAATAGCCATCCTAAGG - Intergenic
1009933303 6:70202893-70202915 TTTAGATTTTAGCCGTCCCATGG + Intronic
1010006888 6:71005295-71005317 TTTTGATAATTGCCATCCTAAGG + Intergenic
1015837565 6:137437697-137437719 TTTTGATAATAGCCATTCTAAGG + Intergenic
1018263591 6:161995718-161995740 TTTTGATAATAGCCATACTGAGG - Intronic
1022751364 7:33229935-33229957 TTTTGATAATAGCCATCTAACGG + Intronic
1022970914 7:35516394-35516416 TTTTAATAATAGCCATCCAATGG + Intergenic
1026712733 7:72756947-72756969 TTTTGATTATTGCCATCCTAGGG - Intronic
1032709866 7:134452138-134452160 TTTCAAAAATAGATGTCCTATGG + Intronic
1033170818 7:139082309-139082331 TTTTAATAATAGCCATCCTAAGG - Intronic
1037997208 8:23361528-23361550 TTTTGATAGTAGCCATCCTAAGG - Intronic
1040562325 8:48534629-48534651 TTCTGATAGTAGCCATCCTAAGG - Intergenic
1044826466 8:96202984-96203006 TTTTGATAACAGCCATCCTAAGG + Intergenic
1045537283 8:103043281-103043303 TTTTGATTATAGCCATCCCAGGG + Intronic
1049029873 8:140026511-140026533 TTGTGATAATGGCCATCCTAAGG + Intronic
1051529890 9:18090080-18090102 TTTTCATAATAGACATCCTATGG - Intergenic
1058299321 9:103350908-103350930 TTCTGATAATAGCCATCCTAGGG - Intergenic
1059621997 9:116016234-116016256 TTTTGATAATAGCCATCCTAAGG + Intergenic
1060074127 9:120576749-120576771 TTTTGATTATAGCCATCCTTTGG - Intronic
1061530462 9:131208036-131208058 TTTAAATGATAGCCATCCTAGGG - Intronic
1203372961 Un_KI270442v1:329302-329324 TTTCCATAATAGGCGTCAAAGGG - Intergenic
1188407188 X:29826222-29826244 TTTCTATAAAAGCTGTCCTTTGG + Intronic
1189887040 X:45557838-45557860 TTTTCATTATAGCCCTCCTATGG + Intergenic
1192536322 X:71931075-71931097 TTTTTATTATAGCCATCCTAGGG + Intergenic
1195019687 X:100814514-100814536 TTTTTATAATAGCCATCCTAGGG - Intergenic
1196724195 X:118881281-118881303 TTTTGATTATAGCCATACTAGGG + Intergenic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1200335302 X:155344694-155344716 TTTTAATAATAGCCATCCTAAGG + Intergenic
1200351166 X:155496527-155496549 TTTTAATAATAGCCATCCTAAGG - Intronic