ID: 1091624994

View in Genome Browser
Species Human (GRCh38)
Location 12:2115054-2115076
Sequence TGTGAGATGCTGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 849
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 794}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091624994_1091625003 29 Left 1091624994 12:2115054-2115076 CCCTCTTCCCTCAGCATCTCACA 0: 1
1: 0
2: 4
3: 50
4: 794
Right 1091625003 12:2115106-2115128 GCCTGCAATAGCTTGAAATAAGG 0: 1
1: 0
2: 1
3: 11
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091624994 Original CRISPR TGTGAGATGCTGAGGGAAGA GGG (reversed) Intronic
900556578 1:3283782-3283804 TGGAAGATGCTGGGGGAAGCAGG - Intronic
900610898 1:3544262-3544284 GCTGTGATGCTGAGGGGAGAGGG - Intronic
900657296 1:3765155-3765177 TCTGTGATGCTGAAGGAAAATGG - Intronic
900856622 1:5190511-5190533 TTAGGGATGCTGTGGGAAGATGG + Intergenic
901785867 1:11624146-11624168 TTTGAGAGGCCGAGGCAAGAGGG - Intergenic
902701496 1:18175493-18175515 TGAGGGATGCTGCGGGGAGAGGG + Intronic
902718438 1:18288740-18288762 TCCGAGAGGCTGAGGGAGGAAGG + Intronic
903054997 1:20629722-20629744 TTTGGGAAGCTGAGGGAGGAAGG + Intergenic
903347311 1:22695001-22695023 CGTGAAGTGCTGAGGGATGAGGG + Intergenic
903415149 1:23177498-23177520 GGTGAGATGCTGAGGCCTGAGGG - Exonic
904036509 1:27561925-27561947 TGTCAGAGGCTGAGGGGAGGGGG + Intronic
904414882 1:30354296-30354318 TTTGAGAGGCTGAGGTGAGAGGG - Intergenic
904463580 1:30694700-30694722 AGTGAGATGCTCAAGGAAAAAGG + Intergenic
904824045 1:33263314-33263336 TGCTAGATGCTGAGGATAGATGG + Intronic
904862706 1:33550769-33550791 TGTAAGATGCAGATGGAAAAGGG - Intronic
905242123 1:36588178-36588200 TGTGGTATGCTGAGGGAGGGAGG + Intergenic
905540481 1:38756426-38756448 TGGGAGATGTGGAGGGCAGAAGG + Intergenic
905722795 1:40220881-40220903 TTTGAGAGGCTGAGGGAGGAGGG + Intronic
905901683 1:41585577-41585599 TGTGGGATGCTGAGAACAGAAGG + Intronic
906857866 1:49327859-49327881 TGGGAGATGATATGGGAAGAGGG + Intronic
906920582 1:50060397-50060419 TTTGAGCTGCTGAGGGGAAAAGG - Intronic
906948212 1:50313645-50313667 TGTGAGATCCTAAGAGGAGAGGG + Intergenic
907818037 1:57939158-57939180 TGTGAGAATATGAGAGAAGAAGG - Intronic
907863625 1:58378164-58378186 TTTGACAAGCTGAGAGAAGAAGG - Intronic
907937645 1:59057199-59057221 TGGGAGGTGCAGAGTGAAGAGGG + Intergenic
908299499 1:62749620-62749642 TTTGGGATGCTGAGGCAAGCAGG - Intergenic
908575882 1:65459542-65459564 AGAAAGATGCTGAGGGAAGAAGG - Intronic
910074830 1:83264626-83264648 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
910836413 1:91517401-91517423 TGTGGTATGGTGAGGGAAAAAGG + Intronic
911074232 1:93856879-93856901 TTTGACATGTTGAGAGAAGAAGG + Intergenic
911615302 1:100004407-100004429 CTTGGGAGGCTGAGGGAAGATGG - Intronic
912659273 1:111513945-111513967 TGGGAGGGGCTGTGGGAAGAAGG + Intronic
912948275 1:114102820-114102842 TCTGAGCTGATGAGGGAAGGAGG + Intronic
913372815 1:118119399-118119421 TGTGTGAAGCAGAGAGAAGAGGG + Intronic
913931198 1:124966825-124966847 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
914562579 1:148835419-148835441 TTTGACAAGTTGAGGGAAGAAGG - Intronic
914610251 1:149294803-149294825 TTTGACAAGTTGAGGGAAGAAGG + Intergenic
915908654 1:159898784-159898806 TGTAAGGTGCTGAGAGAAGATGG + Intronic
916402147 1:164460223-164460245 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
916794182 1:168150415-168150437 TGTGTGATACTGGGGGAACAGGG + Intergenic
916966905 1:169956838-169956860 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
917378936 1:174382774-174382796 TTTGACAAGCTGAGAGAAGAAGG - Intronic
917639851 1:176972972-176972994 TCTGAAATGAGGAGGGAAGATGG - Intronic
917706014 1:177634939-177634961 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
918062955 1:181077986-181078008 TGTGAGATCTTGAAGGCAGAGGG - Intergenic
918130138 1:181620213-181620235 GGTGAGCTGGTGAGGGAAGGGGG + Intronic
918219358 1:182421963-182421985 TTTCAGAGGCTGAGGCAAGAGGG - Intergenic
918352887 1:183675901-183675923 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
918624175 1:186638351-186638373 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
919762472 1:201106697-201106719 TGTGGGATGGTGAGGGTGGAGGG - Intronic
919772927 1:201174215-201174237 TGTGGGATGCTGTGTCAAGAGGG + Intergenic
919873659 1:201844476-201844498 TGTGGGATCCTGAAGGAAAAAGG + Intronic
920077015 1:203344589-203344611 AGGGAGATACTGATGGAAGAGGG + Intronic
920241108 1:204551286-204551308 TTTGAGAGGCTGAGGCAGGAGGG - Exonic
920668731 1:207986504-207986526 TCTGAGACGCTGAGGGGTGAAGG - Intergenic
921179827 1:212623555-212623577 TGTGAAATGCCGGGAGAAGAGGG - Intergenic
921569933 1:216765610-216765632 GGTTCCATGCTGAGGGAAGAAGG + Intronic
921590115 1:216993295-216993317 AGGGAGATGGTGAGGGAGGAGGG - Intronic
921676612 1:217983161-217983183 AGTGAGCTGTTGAGGGAGGAGGG + Intergenic
922294272 1:224235683-224235705 TTTGGGATGCTGAGGCATGAGGG + Intronic
922323391 1:224507105-224507127 TGTGAGAAGCTGAGGCCAGCAGG - Intronic
922635117 1:227160547-227160569 TGTCTGAAGCTGATGGAAGATGG - Exonic
922848265 1:228707815-228707837 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
922944042 1:229495144-229495166 TTTGGGATGCTGAGGCAGGAGGG + Intronic
923039514 1:230309626-230309648 GGTGTGATGCTGAGGAAACATGG + Intergenic
923339003 1:232992209-232992231 GCTGACATGCTGAGGAAAGAAGG - Intronic
924099059 1:240584911-240584933 TGACAGAAGCTGAGGGATGACGG + Intronic
924460974 1:244258296-244258318 TTTGGGAGGCTGAGGCAAGAGGG + Intergenic
924927068 1:248693320-248693342 TTTGAGAGGCTGAGGGAACCAGG - Intergenic
924947779 1:248857785-248857807 GGTGAGAGCCAGAGGGAAGAGGG - Intronic
1062812582 10:477583-477605 TGGGAGATGGGGAGGGAGGAAGG + Intronic
1063052305 10:2465927-2465949 TGTGGGATGATGAGTGAACAGGG - Intergenic
1063425045 10:5944138-5944160 TTTGGGAGGCTGAGGGAGGAGGG + Intronic
1064689219 10:17896686-17896708 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
1064745875 10:18477668-18477690 AGTGGGCTGCAGAGGGAAGATGG + Intronic
1064761785 10:18628412-18628434 TTTGAGGAGCTGAGAGAAGAAGG + Intronic
1067606545 10:47668986-47669008 TGTGAGAGAGTGAGGGAAGTAGG + Intergenic
1068160069 10:53252249-53252271 TGTGAGATACAGTGAGAAGATGG + Intergenic
1069699507 10:70411695-70411717 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1070732505 10:78841097-78841119 GGTCAGAGGCTGAGGGAAAAGGG + Intergenic
1070949253 10:80417948-80417970 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1071077455 10:81772200-81772222 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1071486088 10:86103645-86103667 CGTGAGATGCTGTGGAATGAAGG - Intronic
1071938622 10:90560734-90560756 TGTGATATGATGAGGTAAAATGG - Intergenic
1072029468 10:91504284-91504306 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1072542624 10:96409919-96409941 TGTAAGATGCTTAGGGAAGTGGG + Intronic
1072696161 10:97604561-97604583 TTTGGGAGGCTGAGGAAAGATGG - Intronic
1073080139 10:100854437-100854459 GGTGGGGTGCTGGGGGAAGAGGG + Intergenic
1073331514 10:102672994-102673016 TGTCAGAGGCTGAGGGGAGGAGG + Intergenic
1073665493 10:105528139-105528161 TATCAGAGGCTGAGGGAAGGGGG + Intergenic
1074158530 10:110818500-110818522 TGTGAGCTGCTGTGGGCAGCTGG + Intronic
1075099536 10:119496401-119496423 CGTGAGGTGCTTAGGGCAGATGG - Intergenic
1075742823 10:124706198-124706220 TGGGAGATGATGGGGAAAGAAGG - Intronic
1075944014 10:126416920-126416942 AGTGAGACACAGAGGGAAGAGGG + Intergenic
1076160161 10:128237535-128237557 TTACAGATGCTGAAGGAAGATGG + Intergenic
1076181941 10:128416204-128416226 TGGGAAATTCTGAGGGAAGGTGG - Intergenic
1076427658 10:130379197-130379219 TGTGAGCTGAGGAGGGAAGGAGG - Intergenic
1076900631 10:133335851-133335873 CGTGGGATGCTGATGGCAGATGG + Intronic
1077003980 11:342189-342211 TTTGGGAGGCTGAGGGAGGAGGG - Intergenic
1077483717 11:2828783-2828805 TGGGAGTTGATGAGGGAAGTGGG - Intronic
1077487511 11:2845852-2845874 TGTGAGAGGCTGAGATGAGAGGG - Intronic
1077549714 11:3194602-3194624 TGGGGGATGCTGAGGACAGAGGG + Intergenic
1077667386 11:4125277-4125299 TGTCAAGGGCTGAGGGAAGAAGG - Intronic
1077988747 11:7382349-7382371 TGTGGGAAGCTGAGAGAAGAGGG + Intronic
1078065250 11:8074493-8074515 TGTGGGAGGCTGAGGCAGGAGGG + Intronic
1078541559 11:12217508-12217530 TCTGTGAGGCAGAGGGAAGAAGG - Intronic
1078754221 11:14193588-14193610 TGTGGGATGCTTGGGGAAGAGGG + Intronic
1078758848 11:14235569-14235591 TTTGGTATGCTGAGGGTAGAAGG + Intronic
1079149590 11:17885564-17885586 TTTGAGAGGCCGAGGGAGGAGGG - Intronic
1079296967 11:19242194-19242216 TGGGAGACCCTGAGGAAAGACGG - Intergenic
1079646588 11:22870565-22870587 GGTGAGATGCTGGCGGATGATGG + Intergenic
1080326935 11:31085973-31085995 TTTGGGAGGCTGAGGGAGGAGGG - Intronic
1080793086 11:35538624-35538646 CATGTGATGCTGAGGGGAGAGGG - Intergenic
1080943323 11:36943800-36943822 TGTTAGAAGCTGTGGGAAAAAGG + Intergenic
1081169356 11:39847676-39847698 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1081755123 11:45538855-45538877 TGACGGATGGTGAGGGAAGAGGG + Intergenic
1081815120 11:45934810-45934832 TGTGGGAAGCTGAGGGCAAAAGG - Intronic
1082227585 11:49726306-49726328 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1082829756 11:57607272-57607294 TGTGAGGATCTGAGTGAAGAGGG - Intronic
1083774161 11:64885076-64885098 TGTCAGATGCTGAAGGAAGGTGG - Intronic
1083987063 11:66222439-66222461 TGTGATCTGCTGAGGGAGCAGGG - Intronic
1084133469 11:67156004-67156026 TTTGGGAGGCTGAGGGCAGACGG + Intronic
1084937372 11:72594333-72594355 TGCCAGATCCTGAGGGCAGAGGG - Intronic
1086519864 11:87657544-87657566 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1086548651 11:88028386-88028408 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1087228493 11:95631308-95631330 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1087824182 11:102746424-102746446 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1088012258 11:105017314-105017336 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1088430200 11:109750393-109750415 TGTGAGCCGAAGAGGGAAGATGG + Intergenic
1088433385 11:109783037-109783059 TGTGAGACCCTGTGGGAAGCAGG - Intergenic
1088503821 11:110510061-110510083 TTTGAGATGCAAAGAGAAGATGG - Intergenic
1088663519 11:112072300-112072322 TTTGAGAGGCTGAGGTAGGAGGG + Intronic
1089206832 11:116771157-116771179 TGTGGGATGGTGAGGGAATTGGG - Intronic
1089422490 11:118342276-118342298 TTTGAGAGGCTGAGGCAGGAGGG - Intronic
1089596234 11:119582506-119582528 TGGGAGATGCCCAGGGAAAAAGG + Intergenic
1089724992 11:120468917-120468939 TGTGAAATTCTGAGGGGAGAAGG + Intronic
1090035633 11:123247134-123247156 TGTGAGATGAGCAGGGAGGAAGG + Intergenic
1090097456 11:123756929-123756951 TGTGAGATGCAGAGGGAGGTGGG + Intergenic
1091049561 11:132355167-132355189 TATGAGAGGCAGAGGCAAGAGGG - Intergenic
1091286113 11:134409456-134409478 TGTGAGATGCTCAGGGGTGAAGG + Intronic
1091624994 12:2115054-2115076 TGTGAGATGCTGAGGGAAGAGGG - Intronic
1091853633 12:3721289-3721311 TTTGGGAGGCTGAGGCAAGAGGG + Intronic
1092628076 12:10349427-10349449 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1092906771 12:13107460-13107482 TATGAGAAGCTGAGGGAGGATGG + Intronic
1093152011 12:15632995-15633017 TGGTAGATGCTGAGGGAAGAAGG + Intronic
1094160080 12:27381151-27381173 TGTGAGACACTGGGGGAAGGAGG + Intronic
1094725489 12:33110377-33110399 TGTGTAATGCTGAGGGAAAGAGG + Intergenic
1096258612 12:50077468-50077490 GGTGAGATGCTGGAGGGAGAGGG - Intronic
1096390953 12:51228785-51228807 CTTGAGAGGCTGAGGCAAGAGGG - Intergenic
1096712827 12:53470141-53470163 TGTGGGAGGCTGAGGCAAGTGGG + Intronic
1097288327 12:57894478-57894500 TGTGAATGGCTGAGGGAAGCTGG + Intergenic
1098186442 12:67901224-67901246 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1098337864 12:69422139-69422161 TGTGAGATCCTTAGGGAGAAGGG + Intergenic
1098717504 12:73849878-73849900 TGTGAGCTACAGAGAGAAGATGG + Intergenic
1098767457 12:74508506-74508528 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
1099058445 12:77874451-77874473 TTTGAGAGGCTGAGGCAGGAAGG - Intronic
1099930152 12:89064858-89064880 TGTTTCAGGCTGAGGGAAGAGGG + Intergenic
1100238238 12:92683183-92683205 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1100243440 12:92732841-92732863 TCTGGCATGCTGTGGGAAGAGGG + Intronic
1100326714 12:93546442-93546464 TTTGGGAAGCTGAGGCAAGAAGG - Intergenic
1100634893 12:96426218-96426240 TGCCAGAGGCTGGGGGAAGATGG - Intergenic
1100939413 12:99709400-99709422 TGTGGGATGTTGAGAGGAGAAGG + Intronic
1101210547 12:102531358-102531380 TAGGAGGTGCTGAGGGGAGAGGG + Intergenic
1101533436 12:105595663-105595685 TGTGTGATGCCATGGGAAGAGGG + Intergenic
1101577013 12:106007057-106007079 TGGGGGATGCAAAGGGAAGAGGG - Intergenic
1102521862 12:113482565-113482587 TGTAAGAATCTGAGGGCAGAGGG - Intergenic
1103221751 12:119252192-119252214 TGTGTGACGCTGAAGGAAGCAGG - Intergenic
1103487833 12:121295425-121295447 TGTGGGGTGATTAGGGAAGAGGG + Intronic
1103820141 12:123691307-123691329 TGCCAGGAGCTGAGGGAAGAGGG - Intronic
1103912967 12:124362289-124362311 GGTGACCTGCTGAGGGAAGCAGG + Exonic
1103976477 12:124705879-124705901 TCTGACAGGCTGTGGGAAGATGG + Intergenic
1104333213 12:127866875-127866897 TTTGATAAGCTGAGAGAAGAAGG + Intergenic
1104895538 12:132161944-132161966 GGAGAGGAGCTGAGGGAAGAGGG - Intergenic
1105251548 13:18703163-18703185 AGTGAGAAGGTTAGGGAAGAAGG - Intergenic
1105338607 13:19497807-19497829 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1106028198 13:25974863-25974885 TGTGGGATGGTGGGTGAAGAGGG - Intronic
1106090540 13:26589034-26589056 TTTGAGAGACTGAGGCAAGAGGG - Intronic
1106171761 13:27294739-27294761 AGAGATATGCAGAGGGAAGATGG + Intergenic
1106284426 13:28306608-28306630 GGGGAGATGCTGGGGGAAGGTGG - Intronic
1106737875 13:32607045-32607067 TGTGACAAGTTGAGAGAAGAAGG - Intronic
1107045472 13:35988072-35988094 TGGGAGGTGCTGGGGAAAGAGGG - Intronic
1107406415 13:40118161-40118183 TGTGGGAAGCTGAGGCAGGAGGG + Intergenic
1107577784 13:41745890-41745912 AGTGATATTCTGATGGAAGAGGG - Intronic
1108607581 13:52054956-52054978 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1108712478 13:53047278-53047300 GGTGAGAAGCTCAGTGAAGATGG + Intronic
1109222889 13:59658623-59658645 TGAGAGAGGCTGAGTGATGAGGG + Intergenic
1109633118 13:65079340-65079362 AGTGAGAAGCTGAGGGATCATGG + Intergenic
1109719480 13:66258748-66258770 TTTGACAGGCTGAGAGAAGAAGG - Intergenic
1111337760 13:86845718-86845740 TATGTTATGCTGAGGGAACATGG + Intergenic
1112596992 13:100816399-100816421 TCAGAGATGCTGGGGGAAGTGGG + Intergenic
1113233730 13:108244814-108244836 TTTGAGAGGCTAAGGCAAGATGG + Intergenic
1113593299 13:111515301-111515323 TGTGAGAGTCTGAGGGAGGAGGG + Intergenic
1113593316 13:111515359-111515381 TGTGAGAGTCTGAGGGAGGAGGG + Intergenic
1113593323 13:111515388-111515410 TATGAGAGTCTGAGGGAGGAGGG + Intergenic
1114311095 14:21468031-21468053 TGTCAGGGGCTGAGGGATGAGGG + Intronic
1115149742 14:30270711-30270733 TGTGACAGGCTGAGGGGAGCTGG - Intergenic
1116156628 14:41214320-41214342 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1116286004 14:42972502-42972524 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1116363924 14:44037250-44037272 TGTGAGTCTCTGAGGGAAGCAGG + Intergenic
1117175792 14:53145254-53145276 TGTGGGAGGCTGAGGCAGGAGGG + Intronic
1117522658 14:56566254-56566276 TGAGGGCTGCTGGGGGAAGAAGG - Intronic
1117797682 14:59410593-59410615 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1117835816 14:59804949-59804971 TGTGACCTGCTTGGGGAAGAGGG - Intronic
1118342625 14:64907736-64907758 TGTGGGAGGCTGAGGCAGGAGGG + Intergenic
1118779252 14:68995639-68995661 GGTGAGATGTGGATGGAAGATGG + Intergenic
1118837305 14:69485936-69485958 TGGGAGGTATTGAGGGAAGAGGG + Intronic
1118960122 14:70522134-70522156 GGAGTGATGATGAGGGAAGAAGG - Intergenic
1119319453 14:73720985-73721007 TCTGAGATTCAGAGGGAAAAAGG - Intronic
1119423149 14:74519907-74519929 GGAGAGAGGCTGAGGGAAGGAGG - Intronic
1119604437 14:76002445-76002467 TGTTAGATGAGGAGGGAAGGAGG + Intronic
1120081053 14:80216553-80216575 TTTGGGATGCTGTGGGAAGAGGG + Intronic
1120709653 14:87780436-87780458 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1120746837 14:88159816-88159838 TGGGGGATCCTGAAGGAAGAGGG - Intergenic
1120791123 14:88583358-88583380 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1121139433 14:91528302-91528324 GCTGAGAGGCTGAGGCAAGAGGG - Intergenic
1121348941 14:93157339-93157361 TGTGAGGTGCTAAGGGAATCTGG + Intergenic
1122781480 14:104145679-104145701 TATGAGCTGGGGAGGGAAGATGG - Intronic
1122813808 14:104302328-104302350 TGTGGGATGCTGAGTGGAGCGGG + Intergenic
1123681187 15:22765437-22765459 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
1124333400 15:28839899-28839921 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
1124443686 15:29709180-29709202 GGTGTGATGCTGAGGGATGAGGG + Intronic
1124855749 15:33386685-33386707 TGCCAGAAGCTGAGGGAAGGGGG - Intronic
1124920385 15:34020546-34020568 TGTGAGGTGGTGTGAGAAGAGGG - Intronic
1125141817 15:36417418-36417440 TTTGAGAGTCTGAGGGATGATGG - Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1125825177 15:42670284-42670306 AGTGTGATGGTGGGGGAAGAGGG + Intronic
1126005567 15:44253043-44253065 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1126059006 15:44760787-44760809 TGTTAGAGGCTGAGAGTAGAAGG - Intronic
1126265054 15:46744470-46744492 TTTGAGGAGCTGAGGGAAGAAGG - Intergenic
1126658248 15:51004446-51004468 TGTAAGATGCTGAGAGCACATGG + Exonic
1126664934 15:51067577-51067599 TGTGGCATTCTGAGGGATGAGGG + Intronic
1126775285 15:52094979-52095001 TGTAAGAGGCAGAGGGAGGATGG + Intergenic
1127599618 15:60522465-60522487 TTTGAGAGGCTGAGGCAGGAAGG + Intronic
1128146704 15:65335983-65336005 AGTGCGCTGCTGAGGGCAGAAGG + Intronic
1128774736 15:70311473-70311495 TGGGAGATTATGAGAGAAGATGG + Intergenic
1129168839 15:73795690-73795712 TGAGAGATGTAGAGGGAACAGGG + Intergenic
1129617555 15:77111452-77111474 TGTGAGATAGAGAGGGAAGGGGG - Exonic
1130198031 15:81798951-81798973 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1130240041 15:82179577-82179599 TGGGAGATACTGAGGAAACATGG - Intronic
1130364576 15:83222669-83222691 TTTGAGAAGTTGAGAGAAGAAGG + Intergenic
1131530690 15:93189288-93189310 TTTGGGAGGCTGAGGGAAGGGGG - Intergenic
1131838804 15:96415566-96415588 AGAGGGATGCCGAGGGAAGAGGG + Intergenic
1132346911 15:101114098-101114120 GGTGAGATGCTCGGGGAAGAGGG - Intergenic
1132535131 16:475150-475172 GGAGAGAGGCTCAGGGAAGAAGG + Intronic
1132923409 16:2412664-2412686 TGCGAGGGGCTGGGGGAAGAAGG - Intergenic
1133657419 16:7879420-7879442 TCTGAGAGGCTGAGAGAGGAGGG - Intergenic
1133845099 16:9446316-9446338 TGTGGGATGCTGAGAGGAGGAGG + Intergenic
1135525966 16:23213760-23213782 TGTGAGGTGCTGGGGGAACCAGG + Intronic
1135633435 16:24054217-24054239 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1135764372 16:25164813-25164835 TGTGAGAGGCTGGAGGCAGAAGG - Intronic
1135826639 16:25734549-25734571 TGTGAGGTGCTGGGGTATGATGG + Intronic
1135966190 16:27037185-27037207 TGGGAGATGCAGGGGGAAGGAGG - Intergenic
1136393011 16:29977287-29977309 TGTGAGAGGTTGAGGGAGGAGGG + Intronic
1137025504 16:35469692-35469714 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1137584190 16:49654288-49654310 TGTGAGATGCTTGGGGAGGTGGG - Intronic
1137608954 16:49806183-49806205 TGGGAAATGCTGATGGAAGGTGG + Intronic
1138011366 16:53383740-53383762 TTTGAGAGGCTGAGGTGAGAGGG - Intergenic
1138398654 16:56728107-56728129 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1138695996 16:58814109-58814131 TTTGGGAGGCTGAGGAAAGAGGG - Intergenic
1138778457 16:59754065-59754087 AGTGAGGTGCTGAAGGAAGGTGG - Intronic
1138922282 16:61546279-61546301 GGTGTGGTGCTGAGGGAAGGAGG + Intergenic
1138935959 16:61723500-61723522 GGTGGGATGCTGAAGGGAGAAGG - Intronic
1138951635 16:61919322-61919344 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1139050699 16:63120971-63120993 TTTGACGAGCTGAGGGAAGAAGG + Intergenic
1139244593 16:65429130-65429152 AGTGAGATGCTGAAGGAAGAAGG + Intergenic
1139915792 16:70427722-70427744 TGTGAGAGGTTGAGGAAGGAGGG - Intronic
1139940337 16:70601007-70601029 TGGGAGATGCTGGGAGAAGTAGG + Intronic
1141480555 16:84303829-84303851 TGCCAGAGGCTGCGGGAAGAGGG - Intronic
1141794737 16:86263188-86263210 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1142497042 17:311410-311432 TCTGAAAGGCTGAGGGCAGAGGG - Intronic
1142676507 17:1516735-1516757 TGCGAGAGGCTGAGCGAAGACGG + Exonic
1142917272 17:3152382-3152404 TGTGACGAGCTGAGAGAAGAAGG - Intergenic
1142918993 17:3167971-3167993 TTTGTGAGGCTGAGGCAAGAGGG + Intergenic
1143061126 17:4202034-4202056 TATGAGATACTCAGGGGAGAAGG + Intronic
1143362726 17:6384697-6384719 TGTGGGATGTGGAGGGAGGAAGG - Intergenic
1143476581 17:7206853-7206875 TGTGGGATGCTCTGGGAAGGGGG - Intronic
1143618427 17:8067367-8067389 TCTGAGATGGTGAGGGCTGAGGG + Intergenic
1144009317 17:11131236-11131258 TGGGAAAGGTTGAGGGAAGACGG - Intergenic
1144208781 17:12997548-12997570 GCTGAGATCCTGGGGGAAGAAGG - Intronic
1144347115 17:14359395-14359417 TGAGAGATGCTGAGGGTGCATGG - Intergenic
1144426903 17:15151711-15151733 TCTGAAATGGAGAGGGAAGAGGG - Intergenic
1145122410 17:20272540-20272562 TGCCAGAGGCTGGGGGAAGAGGG - Intronic
1145819349 17:27819593-27819615 TTTGGGAGGCTGAGGCAAGAGGG + Intronic
1146600839 17:34214735-34214757 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1146752607 17:35394960-35394982 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1147034935 17:37672801-37672823 TCTGAGAACCTGTGGGAAGAAGG + Intergenic
1147192086 17:38743851-38743873 TGTGAGAAGGTGAGGGAAAAAGG + Intronic
1147338719 17:39741453-39741475 TGAGTGATGCAGAGGGGAGAAGG - Intronic
1147498198 17:40937501-40937523 TGTGACCTGCAGAGGGACGATGG + Intronic
1147757703 17:42779863-42779885 AGGGAGATGGTGAGGGAAGGGGG - Intergenic
1148088354 17:45007882-45007904 TGGGAGATGGTGGAGGAAGATGG - Intergenic
1148134314 17:45282445-45282467 TGTGGGAAGCTGAGGCAACAGGG + Intronic
1148282558 17:46360427-46360449 TTTGGGAGGCTGAGGCAAGAGGG + Intronic
1148304776 17:46578352-46578374 TTTGGGAGGCTGAGGCAAGAGGG + Intronic
1148496961 17:48058781-48058803 TCAGAGCTGCTTAGGGAAGAAGG - Exonic
1148737549 17:49873292-49873314 GGTGGGATGCTGAGGGGGGAGGG + Intergenic
1148786117 17:50147105-50147127 TTTGATAGGCTGAGAGAAGAGGG - Intronic
1148813725 17:50311943-50311965 TTTGGGAGGCTGAGGGCAGAAGG + Intergenic
1148889322 17:50796446-50796468 TGTCAGATGATGTGGCAAGAAGG - Intergenic
1149039010 17:52165246-52165268 TGTGAGCTAGTCAGGGAAGAAGG + Intergenic
1149864671 17:60144618-60144640 TTTGAGAGGCTGAGGCAGGAAGG - Intergenic
1149942564 17:60886429-60886451 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1149961194 17:61111243-61111265 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1150879131 17:69004102-69004124 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1150952082 17:69814824-69814846 TGCCAGCTGCTGAGGGGAGAAGG - Intergenic
1151083623 17:71356932-71356954 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1151486603 17:74404765-74404787 TCTGGGATCCTGATGGAAGAGGG - Intergenic
1151839998 17:76610887-76610909 TGAGAGATAGTGAGGGAAGTTGG + Intergenic
1152564347 17:81093449-81093471 TCTGAGATGATGGGGGAGGAGGG + Intronic
1153105445 18:1521173-1521195 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1153164712 18:2248192-2248214 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1153625120 18:7016034-7016056 CAGGAGATGCTGAGGGAAGCGGG + Intronic
1153662772 18:7340040-7340062 TGTGAGAGGAAGAGGGCAGAGGG + Intergenic
1154005184 18:10521277-10521299 TCTGGGAGGCTGAGGCAAGAGGG + Intergenic
1154021190 18:10665419-10665441 TGTGAGATGATCAAGGAATATGG + Intergenic
1155039183 18:22050635-22050657 TGTTAGAAGGTGAGGGAAGGAGG - Intergenic
1155044396 18:22091077-22091099 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
1155321500 18:24624032-24624054 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1155523800 18:26696239-26696261 ATTGGGAAGCTGAGGGAAGATGG + Intergenic
1155662442 18:28265734-28265756 AGCGAGATGCTTAAGGAAGATGG - Intergenic
1155697309 18:28698253-28698275 TGAGGGATAGTGAGGGAAGATGG + Intergenic
1155897923 18:31352954-31352976 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1156430232 18:37064735-37064757 TGTGTGATGATGATGGAAGCAGG + Intronic
1156445121 18:37230951-37230973 TGTGAGCTGCAGAGGGGAGAAGG - Intronic
1156476929 18:37411389-37411411 TGTGTGAGGGTGAGGGAACATGG + Intronic
1156843169 18:41632761-41632783 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1156964378 18:43072885-43072907 TGTGGGATGCTGTGGGAGAAAGG + Intronic
1157604941 18:48920537-48920559 GGGGAGAGGCTGAGGGGAGAGGG + Exonic
1158020355 18:52834187-52834209 TCTGTGATGCTGATTGAAGATGG - Intronic
1158447683 18:57535381-57535403 TTTGGGAGGCTGAGGCAAGAGGG - Intergenic
1158720959 18:59924071-59924093 AGTGAGATGCTGAAAAAAGATGG - Intergenic
1158741216 18:60144453-60144475 GGTGAGATGTTCAGGGAAAATGG - Intergenic
1159022465 18:63154907-63154929 TGTGTTATGCTCAAGGAAGATGG + Intronic
1159461473 18:68726442-68726464 TGAGAGAGGCTGATGGACGATGG + Intronic
1159964193 18:74579823-74579845 TGTGAGATGCTGTGGTTGGAAGG + Intronic
1160088562 18:75803536-75803558 TGAGAGATGCTGAGTGCAGGAGG + Intergenic
1160378411 18:78430849-78430871 AGTGAGAGGCGGAGGGAGGAAGG - Intergenic
1161154854 19:2727288-2727310 TGTCAGGTGCTGAGGCCAGACGG - Intronic
1161384917 19:3985845-3985867 TGGGAGAAGCCGAGGGAAAAAGG + Intergenic
1161407870 19:4100571-4100593 TTTGGGAGGCTGAGGAAAGAAGG + Intronic
1162040598 19:7968730-7968752 TGTGAGATGCTGAGCAAGGCGGG + Intronic
1162831801 19:13289387-13289409 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1164057631 19:21635173-21635195 TGGCCGAGGCTGAGGGAAGATGG - Intergenic
1164506319 19:28864132-28864154 TGTGAGCTGCCCAGGGACGAGGG - Intergenic
1164537991 19:29100658-29100680 AGGGAGAAGCTGAGAGAAGATGG - Intergenic
1164552304 19:29221891-29221913 AGTGAGACCCTGAGGGGAGAAGG + Intergenic
1164795133 19:31020396-31020418 CGTGAGGTGTTGGGGGAAGATGG - Intergenic
1165127355 19:33608533-33608555 TTTGGGAAGCTGAGGTAAGAGGG + Intergenic
1165133437 19:33647888-33647910 AGATAGCTGCTGAGGGAAGAGGG + Intronic
1165766198 19:38352657-38352679 TGTGAGCAGCTGTGAGAAGAGGG + Intronic
1167600426 19:50451530-50451552 ACTGAGGTCCTGAGGGAAGAGGG + Intronic
1168000494 19:53441957-53441979 AGTGAGAAGCTGAGGGAAAAAGG + Intronic
1168369927 19:55823420-55823442 TTTGAGGAGCTGAGAGAAGAAGG + Intronic
1168380209 19:55913897-55913919 TGATAGCTGGTGAGGGAAGAGGG - Intronic
925770520 2:7278193-7278215 TTTGAGAAGCTGAGGTAGGAGGG + Intergenic
925915729 2:8604149-8604171 TGCCAGAGGCTGGGGGAAGAGGG + Intergenic
925981202 2:9178882-9178904 TTTGGGGTGCTGAGGGGAGAAGG + Intergenic
927235908 2:20874828-20874850 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
927293620 2:21428274-21428296 TCTGAGTTGTTGATGGAAGAAGG - Intergenic
927724011 2:25406770-25406792 GGTGAGCTGCTGTGGAAAGAAGG + Intronic
928207763 2:29298888-29298910 TCTGAGATGCTGGGGAAAGGAGG - Intronic
929948645 2:46389444-46389466 TCTGAGATGGTGTGGGATGATGG + Intergenic
930604710 2:53481964-53481986 TGTGAGATGGTGGGGGGAGGGGG - Intergenic
930615414 2:53588043-53588065 TTTGACAGGCTGAGAGAAGAAGG + Intronic
931205604 2:60142211-60142233 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
931481937 2:62650700-62650722 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
931651439 2:64472368-64472390 TGTGAGAAGCTGAGGTGAGATGG + Intergenic
931850139 2:66244512-66244534 TGTGGGATAGTGAGGGAAGCTGG - Intergenic
932134039 2:69213047-69213069 TCTGAGAAGCTGAGGCAGGAGGG - Intronic
932195663 2:69780903-69780925 TGTGTGATGATGATGAAAGAGGG + Intronic
932937032 2:76115497-76115519 TGTAGGTTTCTGAGGGAAGAGGG + Intergenic
932980023 2:76652980-76653002 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
932991793 2:76796805-76796827 TTTGACAAGCTGAGTGAAGAAGG + Intronic
933062456 2:77754764-77754786 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
933537180 2:83590772-83590794 TTTGAAAGGCAGAGGGAAGAGGG + Intergenic
933783689 2:85820562-85820584 TGTGAAGTGGTGAGGGAGGAAGG + Intergenic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
935276524 2:101480397-101480419 TTTGAGAGGCTGAGGCAAGTGGG - Intergenic
935361285 2:102248630-102248652 TGTGGGCTGCTGTGGGAAGAAGG + Intergenic
935728098 2:106041400-106041422 TATGAGATACTGAGAGAAGATGG + Intergenic
936292070 2:111233915-111233937 TATGAGAAGCTGAGGGAAGCAGG - Intergenic
936730967 2:115381537-115381559 TTTGACAAGCTGAGAGAAGAAGG - Intronic
937362419 2:121238277-121238299 TGTCAGGTGGTGAGGGGAGAGGG + Intronic
937416993 2:121723320-121723342 TTTGGGATGAGGAGGGAAGACGG + Intergenic
937430354 2:121832743-121832765 AGAGAGATGCTGTGGGAAAATGG + Intergenic
937870363 2:126781951-126781973 TGTGGGATGGTGAGGCAAGAAGG - Intergenic
938273984 2:129999645-129999667 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
938442229 2:131346483-131346505 TTTGACAAGCTGAGAGAAGAAGG - Intronic
938674192 2:133614306-133614328 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
938704595 2:133911501-133911523 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
938753700 2:134360702-134360724 TTTGAGAAGCTGAGGGCATAGGG - Intronic
938788437 2:134655532-134655554 TTTGACAAGCTGAGAGAAGAAGG - Intronic
938808252 2:134826466-134826488 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
939429374 2:142083227-142083249 AGTGAGATGAAGAGAGAAGATGG - Intronic
939448304 2:142337888-142337910 TGGGAGATGAAGAGGGAAGCAGG - Intergenic
939991776 2:148882593-148882615 TGTGAGCAGCTGAGGGAAAAGGG - Intronic
940085278 2:149851466-149851488 TGTGACTAGCTGAGAGAAGAAGG + Intergenic
940347025 2:152638578-152638600 TAAGCCATGCTGAGGGAAGATGG - Intronic
940383850 2:153047450-153047472 TGTGAGATTTGGAGGGAGGAAGG + Intergenic
940465742 2:154024677-154024699 TTTGACAAGCTGAGAGAAGAAGG - Intronic
941133493 2:161684044-161684066 TGTCAGGGCCTGAGGGAAGAAGG - Intronic
941399734 2:165015783-165015805 TCTAAAATGCTGAGGTAAGAAGG - Intergenic
941404528 2:165071891-165071913 TGTGAGAGGCTGAAGCAGGAGGG - Intergenic
941534617 2:166707715-166707737 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
941611523 2:167667932-167667954 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
941857045 2:170241921-170241943 TGTGAGATGCAGAGGCAGCAGGG + Intronic
942259630 2:174146037-174146059 TGTGAGGATCTGAGGGAAGAGGG + Intronic
942992064 2:182213424-182213446 TTTGACAAGCTGAGAGAAGAAGG + Intronic
943457392 2:188124527-188124549 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
943663164 2:190580473-190580495 TGTGAGATCAGCAGGGAAGACGG - Intergenic
943775673 2:191762869-191762891 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
944182147 2:196906608-196906630 TTTGACAAGCTGAGAGAAGAAGG + Intronic
944218371 2:197278062-197278084 TGGGAGATGCTGCGTTAAGATGG - Intronic
944397402 2:199283865-199283887 TGTAGCATACTGAGGGAAGATGG + Intronic
944446592 2:199798057-199798079 TGTGTGAGGCTGGGGAAAGAGGG - Intronic
945218887 2:207464415-207464437 TGTGAGGGGGTGAGGGAAGCAGG + Intergenic
946281348 2:218667973-218667995 TGTAAGATCCTGGAGGAAGAGGG + Exonic
947694431 2:232172300-232172322 TGTGAGAAGCTGGGGGGAGAGGG - Intronic
947718960 2:232356258-232356280 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
947887164 2:233582824-233582846 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
948035035 2:234851616-234851638 TGTCACATGATGAGAGAAGAAGG - Intergenic
948318762 2:237052309-237052331 TTTGACAGGCTGAAGGAAGAAGG + Intergenic
948913970 2:241020872-241020894 TGTGGCATGCAGAGGTAAGAGGG - Intronic
1169060415 20:2656688-2656710 TGAGTGAAGCTGAGGGTAGAGGG + Intronic
1169422048 20:5468670-5468692 TGTTAGGGACTGAGGGAAGAAGG + Intergenic
1169456458 20:5756774-5756796 TTTGGGAAGCTGATGGAAGACGG - Intronic
1169689609 20:8315818-8315840 AGTCAGATGCTGAGGGCAAAGGG + Intronic
1169787390 20:9374526-9374548 GGTGAGGTGAAGAGGGAAGACGG + Intronic
1170055345 20:12196814-12196836 TGTGAAGTGGTGAGGGAAGCTGG + Intergenic
1170485152 20:16807980-16808002 TCTGAGAGGAAGAGGGAAGAAGG + Intergenic
1170585795 20:17732947-17732969 GGTGAAGTGCTCAGGGAAGAAGG + Intronic
1170596857 20:17812026-17812048 TGTCAGATGCTAGGGGAAGCAGG - Intergenic
1171352408 20:24513282-24513304 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1171399043 20:24859831-24859853 TGTGAGATGCTCAGGCAGAAAGG - Intergenic
1172266206 20:33616811-33616833 GGTAAGATGCTGAGGGAATCTGG - Intronic
1172296066 20:33811865-33811887 GGAGAGAGGCTGAGGGGAGAGGG - Intronic
1172430264 20:34884814-34884836 TTTGGGAGGCTGAGGCAAGAGGG + Intronic
1173075024 20:39810129-39810151 TGTGGGATGCAGAGAGAAGGTGG + Intergenic
1173185541 20:40837165-40837187 TGCCAGATGATGAGGAAAGAGGG - Intergenic
1173949502 20:46979099-46979121 TGTCAGATGCAGAGGACAGATGG - Intronic
1173998411 20:47357257-47357279 TCTGAGAAGCTGGGGGAAGCAGG + Intergenic
1174017699 20:47502064-47502086 AGTGCGAGGCGGAGGGAAGAGGG + Intronic
1174385830 20:50188141-50188163 TTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1174999434 20:55610814-55610836 TTTCAGATTCTGAGGGAAAATGG - Intergenic
1175961427 20:62638695-62638717 TGGGAGATGCAGAGGGAGGGCGG + Intergenic
1176837074 21:13803050-13803072 AGTGAGAAGGTTAGGGAAGAAGG - Intergenic
1176878950 21:14167872-14167894 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1177489472 21:21803885-21803907 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1177861481 21:26459709-26459731 TTTGGGAAGCTGAGGCAAGAGGG - Intergenic
1178073374 21:28993194-28993216 TGGTAGAGGCTGTGGGAAGATGG + Intergenic
1178105791 21:29317807-29317829 TATGAGATGATGTGGGAAAAGGG - Intronic
1178123548 21:29493785-29493807 TGTCAGATACTGAGGGCATATGG - Intronic
1178614713 21:34122088-34122110 TGTGATGGGCTGAGGGAAGCTGG - Intronic
1179292085 21:40027861-40027883 TATGACAAGCTGAGAGAAGAAGG - Intronic
1179292953 21:40034171-40034193 TATGACAAGCTGAGAGAAGAAGG + Intronic
1179587882 21:42385219-42385241 TGTGAGAACCTGAGGGAGTATGG - Intronic
1180630954 22:17229597-17229619 AGTGAGCAGCTGAGGGATGATGG - Intergenic
1181465730 22:23109672-23109694 TCTGAGATGCTGAGGGAGACAGG - Intronic
1181737267 22:24891958-24891980 TGTGAGTTGCTGAGACATGAAGG + Intronic
1181892942 22:26080301-26080323 TGGGAAATTCTGAGGGAAAAAGG - Intergenic
1183200535 22:36382976-36382998 TCTGAGAGGCTGAGGCAGGAGGG + Intronic
1183296445 22:37032546-37032568 CATGAGAAGCTCAGGGAAGATGG + Intergenic
1183396102 22:37571751-37571773 TGTGAAGTGCTCAGGCAAGAGGG - Intronic
1183466810 22:37984203-37984225 TGGGGCAGGCTGAGGGAAGAAGG - Intronic
1183686191 22:39362630-39362652 GGGGAAAGGCTGAGGGAAGAAGG - Intronic
1183922790 22:41182640-41182662 TGTGGGAGACTGAGGGAGGAAGG + Intergenic
1184126722 22:42492433-42492455 TGCGAGATGCTCAGGGGAGGTGG - Intergenic
1184530518 22:45052366-45052388 TGTGAGTTGCTGCTTGAAGAGGG - Intergenic
1184636978 22:45840555-45840577 TGTCAGAGGCTGAGAGATGAGGG + Intronic
1185191123 22:49437053-49437075 TGTAAGATGCTGAGCAAAGATGG + Intronic
1185410025 22:50676960-50676982 TGTGAGAAGCTGGGTGGAGAGGG + Intergenic
949205969 3:1439570-1439592 TGATAGATGCTGAGGGGACAGGG + Intergenic
949432108 3:3988523-3988545 TTTGAGATACTGAAGGAAAAAGG - Intronic
949678870 3:6489891-6489913 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
950154440 3:10711063-10711085 TGAGAGATGGTGAGGGCAGCAGG + Intergenic
951214298 3:20009217-20009239 TTTGGGAGGCTGAGGTAAGAGGG + Intronic
951499633 3:23370626-23370648 TGTGAAATGGTGAGAAAAGAAGG + Intronic
951554854 3:23910901-23910923 AGTGATATCCTGAGAGAAGATGG - Exonic
951592415 3:24280594-24280616 TTTGACAAGCTGAGAGAAGAAGG + Intronic
952769966 3:36990669-36990691 TGGGTGATGGGGAGGGAAGAGGG + Exonic
954664887 3:52246355-52246377 GGTGAGATGGTGGGGGTAGAGGG - Intronic
954842363 3:53523154-53523176 TGCAAGATGCTGAGTGAAGTGGG + Intronic
955024782 3:55157007-55157029 TGTGGGATTCTGAAGGAAGCTGG - Intergenic
956154802 3:66284102-66284124 TTTGGGAGGCTGAGGCAAGAGGG + Intronic
956302463 3:67787355-67787377 TGTGTGTTGCTGGGGGCAGAGGG + Intergenic
956858626 3:73300745-73300767 TTTGAGAGGCTGAGGGAGGGGGG - Intergenic
957038910 3:75321094-75321116 TGTGAGTTGCTGAGCTCAGATGG + Intergenic
958076662 3:88690112-88690134 TGTGAGATGCTGTGTGAATGGGG - Intergenic
958171339 3:89944074-89944096 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
958205605 3:90387413-90387435 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
958407601 3:93767959-93767981 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
958886964 3:99738209-99738231 TTTGAGGAGCTGAGAGAAGAAGG - Intronic
958950601 3:100411669-100411691 TGTGAGAAACAGAGGGAAGGTGG - Intronic
958958680 3:100488630-100488652 TGTGATATACAGAGGAAAGAGGG - Intergenic
959145621 3:102541116-102541138 TGTGAGATTGTGAGGTAAGAAGG - Intergenic
960609844 3:119545508-119545530 TGCCAGAGGCTGAGGGGAGAGGG - Intronic
961303522 3:125937658-125937680 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
961312043 3:126008640-126008662 AGTGAGAGGCTGAGGGAGGCGGG - Intronic
962432849 3:135336061-135336083 TGTGGGGTCCTGAGGGGAGAGGG - Intergenic
962949308 3:140203421-140203443 TGTTGGCTGATGAGGGAAGAGGG + Intronic
963042400 3:141079322-141079344 TGTGGGATGCTGTGGGAAATGGG - Intronic
963357867 3:144232818-144232840 TGTAAGATGAGGTGGGAAGAGGG + Intergenic
963373947 3:144438545-144438567 TGTGAGATACTGAATAAAGATGG - Intergenic
963929784 3:150991802-150991824 TCTCAGAAGCTGAGGGGAGATGG - Intergenic
963932687 3:151020555-151020577 TGGGAAATACTGAGGGGAGAGGG - Intergenic
964126633 3:153240745-153240767 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
964149552 3:153507424-153507446 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
964842165 3:161006336-161006358 TGCCAGAGGCTGAGGGAAGGGGG + Intronic
965228812 3:166026085-166026107 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
965317052 3:167205246-167205268 TGGGAGATGCAGAGGGAGAAGGG + Intergenic
965611933 3:170553597-170553619 TGTGAGATGTTCAAGGATGATGG + Intronic
965646115 3:170883545-170883567 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
966079794 3:175987384-175987406 TGTGAGATGCTAATAAAAGATGG - Intergenic
966335304 3:178860969-178860991 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
966828263 3:183983798-183983820 TGTGAGATGCTCTTTGAAGATGG - Intronic
967228403 3:187314625-187314647 TGGGAGGTGCAGTGGGAAGATGG + Intergenic
967258571 3:187619171-187619193 TGGGAGATGCTGTGAGATGATGG - Intergenic
967313498 3:188128897-188128919 CGTGGGTTGCTGATGGAAGAAGG + Intergenic
967763888 3:193256294-193256316 TGAGAAGTGCTGAGGGCAGAAGG + Intronic
968135674 3:196217895-196217917 TGTGGGAGGCTGAGAGAAGCAGG - Exonic
968837837 4:2978700-2978722 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
969837765 4:9857474-9857496 CCTGAGATGGTGAGGGAAGATGG - Intronic
970474318 4:16407377-16407399 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
971298016 4:25417230-25417252 TATGAGAGGCTGAGGCAGGAGGG - Intronic
971384678 4:26132327-26132349 TGTCTGATGCTGGGGGAAGAGGG - Intergenic
971415854 4:26428483-26428505 TTTTAGATGTTCAGGGAAGAGGG + Intronic
971447547 4:26767060-26767082 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
971713464 4:30146705-30146727 TTTGAGAAGCTGAGGCAGGAGGG + Intergenic
973026958 4:45284553-45284575 TGGGAGCTGCTGAGGGCAGCTGG - Intergenic
973630730 4:52817477-52817499 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
974372247 4:61032595-61032617 TCTGCAGTGCTGAGGGAAGAAGG - Intergenic
974493998 4:62603297-62603319 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
974896737 4:67949342-67949364 TGTGAGCATCTGAGGGAAAATGG + Intronic
976026029 4:80688700-80688722 TTTGAGAAGCTGAGAGAAGAAGG + Intronic
976364838 4:84221830-84221852 TGTGAAATGCAGAGGGAAGTGGG + Intergenic
976371991 4:84299799-84299821 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
976674293 4:87687247-87687269 TGGGAGTTGCTGAGTGGAGAAGG - Intergenic
978035137 4:103983901-103983923 TTGGAGATGGAGAGGGAAGAGGG + Intergenic
978096785 4:104788006-104788028 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
978209742 4:106120973-106120995 TTTGACAAGCTGAGAGAAGAAGG + Intronic
978260728 4:106754604-106754626 TATCAGAGGCTGAGGGTAGAAGG - Intergenic
978368049 4:108003254-108003276 TGTGTCTTGCTGGGGGAAGAAGG + Intronic
978599149 4:110410406-110410428 TTTGACAAGCTGAGAGAAGAAGG - Intronic
978626593 4:110692647-110692669 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
979645619 4:123064300-123064322 AGTGAGACGTTGAGGGAGGAAGG + Intronic
980702731 4:136454278-136454300 TGTGAGGAGGTGAGAGAAGAAGG + Intergenic
981591863 4:146373228-146373250 TTTGAGAGGCTGAGGTGAGAGGG + Intronic
981629403 4:146801068-146801090 TGTGGTATGCTGAGGGCAGGGGG + Intronic
981839376 4:149093580-149093602 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
982083050 4:151808727-151808749 TGTGAGATGCTAAGAGGAGGAGG - Intergenic
982767204 4:159362709-159362731 TATGGGAGGCTGAGGCAAGAGGG + Intergenic
983341346 4:166464336-166464358 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
983936747 4:173507856-173507878 TGTGAAATACTGTGGGAAAACGG + Intergenic
983952278 4:173656033-173656055 TGTGAAAGGCTAAGGTAAGAAGG + Intergenic
984307705 4:178016054-178016076 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
984836566 4:184027955-184027977 TGTGAGGTTCAGAGGGAGGAGGG + Intergenic
984937052 4:184898549-184898571 TGGGAGAAGCTGAGGGCAGCAGG + Intergenic
985068224 4:186144155-186144177 TTTCACATGCTAAGGGAAGAAGG - Intronic
985198662 4:187461349-187461371 TGTGAAATGCTATGGGAAAATGG - Intergenic
985976680 5:3424443-3424465 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
986392176 5:7297431-7297453 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
986425730 5:7629492-7629514 TATAAGATTTTGAGGGAAGAAGG + Intronic
986454270 5:7899783-7899805 TGTGAGATGTTCTGAGAAGACGG + Intronic
986693273 5:10331364-10331386 TTGGAGATGGTGAGGGAAGGAGG - Intergenic
987265881 5:16254664-16254686 TGAGAGATGATGATGAAAGATGG - Intergenic
987312392 5:16693308-16693330 TATGTGAGGCTGAGAGAAGATGG + Intronic
987482187 5:18472836-18472858 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
988043194 5:25913306-25913328 AGTGAAATGCTGAGGAAAAAAGG + Intergenic
988533432 5:32044546-32044568 TGAGAGATGCTTAGGGATAATGG + Intronic
989493057 5:42079302-42079324 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
989652025 5:43701165-43701187 TGTGGGATGCTGAGGGTTGGAGG + Intronic
989740954 5:44771281-44771303 TCTAAAATACTGAGGGAAGAAGG + Intergenic
990037184 5:51335768-51335790 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
990551676 5:56887003-56887025 TGTGGGAGGCTGAGGCAAGCGGG - Intronic
990750562 5:59011297-59011319 TTTGACAAGCTGAGAGAAGAAGG + Intronic
990755535 5:59065315-59065337 TGCCAGAGGCTGGGGGAAGATGG + Intronic
991017689 5:61949182-61949204 TGTGGGATGCTGAAGAGAGAGGG - Intergenic
991276526 5:64853973-64853995 TGTCAGAGGCTGAGGGCACAGGG - Intronic
991354271 5:65751344-65751366 CTTGTGATGATGAGGGAAGATGG + Intronic
991689945 5:69216235-69216257 TGTCAGAGGCTGAGGGAAGGAGG + Intergenic
992348044 5:75901069-75901091 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
992514359 5:77475828-77475850 TTTGACAAGCTGAGAGAAGAAGG + Intronic
992750472 5:79856592-79856614 TGTGATATGCTGAGGGGTGTGGG + Intergenic
992758601 5:79932222-79932244 TGGCAGAGGCTGAGGGAAGAGGG + Intergenic
993047832 5:82888641-82888663 AATGGGATGCTGAGGGAAGCAGG - Intergenic
993051745 5:82933460-82933482 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
993095369 5:83473356-83473378 TGGGAGATGCTGCGGGAAGGGGG + Intronic
993270530 5:85790671-85790693 TGTCGGAGGCTGAGGGCAGAAGG - Intergenic
993449234 5:88053351-88053373 TATGACAAGCTGAGAGAAGAAGG + Intergenic
994143427 5:96366812-96366834 TTTGACATGTTGAGAGAAGAAGG - Intergenic
994270541 5:97771588-97771610 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
994300002 5:98135993-98136015 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
994547155 5:101181145-101181167 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
994651022 5:102528680-102528702 TATAATATACTGAGGGAAGAAGG + Intergenic
994815992 5:104589369-104589391 TCTGAGATGCTCTGGGCAGACGG - Intergenic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
995499285 5:112786195-112786217 TGTGGGAGGCTGAGGAAGGAGGG - Intronic
996012956 5:118501754-118501776 TTTGACATGTTGAGAGAAGAAGG - Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996751633 5:126895294-126895316 TTTGAGGAGCTGAGAGAAGAAGG - Intronic
996753031 5:126908805-126908827 TTTGAGGAGCTGAGAGAAGAAGG - Intronic
996830830 5:127738913-127738935 TTTGACGAGCTGAGGGAAGAAGG - Intergenic
996832117 5:127752099-127752121 TTTGATGAGCTGAGGGAAGAAGG - Intergenic
997383195 5:133452015-133452037 TGTGGGCTCCTGGGGGAAGAGGG - Intronic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
998572198 5:143271928-143271950 TGTCAGGGGCTGGGGGAAGAAGG - Intergenic
998756225 5:145382792-145382814 TGTGTGATGCTGAGGTTTGAAGG - Intergenic
998763396 5:145457103-145457125 AGTGGGGTGCTGAGGGAAGGTGG + Intergenic
999249311 5:150172650-150172672 TGTAAGAGGCTGGGGGAGGAGGG + Intronic
999297985 5:150472562-150472584 TGGGAGAAGCTGAGGGAAGCAGG - Intergenic
999555930 5:152741957-152741979 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
999666406 5:153917382-153917404 TGTGAGGTGCTGGTGGAAGTGGG + Intergenic
1000100058 5:158007734-158007756 AAGGAGATGCTGTGGGAAGAAGG - Intergenic
1001421322 5:171589428-171589450 TGTGAGAAGCAGAGGTAGGAGGG + Intergenic
1001546906 5:172575900-172575922 TGTGAGAACGTGTGGGAAGATGG + Intergenic
1001713476 5:173795854-173795876 TCTGAGATGGTGAGGTAGGAGGG + Intergenic
1001737821 5:174021195-174021217 AGTGAGAGGGAGAGGGAAGACGG + Intergenic
1002020648 5:176362013-176362035 CGTGACAAGCTAAGGGAAGACGG + Intergenic
1002450602 5:179316374-179316396 TGGGAGATGCTGAGAGCAGCAGG + Intronic
1202773368 5_GL000208v1_random:34874-34896 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1202775074 5_GL000208v1_random:62433-62455 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1003087223 6:3069418-3069440 TGTCAAATGCTTAGGGAAGGAGG - Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003557182 6:7150643-7150665 TGTTAGATGCTCAGGGCAGATGG + Intronic
1003649679 6:7948163-7948185 TTTGACAAGTTGAGGGAAGAAGG - Intronic
1003751928 6:9068640-9068662 TGTGAGATGCAGGGGGATGATGG - Intergenic
1004005403 6:11633240-11633262 CATGAGAAGCTGAGGTAAGAGGG + Intergenic
1004152759 6:13135774-13135796 TTTGGGAGGCTGAGGGAAGGGGG + Intronic
1004502505 6:16221677-16221699 TTTGGGAAGCTGAGGCAAGAGGG - Intergenic
1004515101 6:16315922-16315944 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1004965171 6:20841075-20841097 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1005003734 6:21267866-21267888 TGCCAGAAGCTGAGGGGAGAGGG + Intergenic
1005083344 6:21979736-21979758 TTTGAGAGGCTGAGGTGAGAGGG - Intergenic
1006399839 6:33810930-33810952 TGTGAGAGGCTGGTGGAGGAGGG + Intergenic
1006400046 6:33812542-33812564 TGGGAGATGCTGAGGGCAGAGGG - Intergenic
1006485269 6:34334696-34334718 TTTGGGAAGCTGAGGGAGGAGGG + Intronic
1006887579 6:37395416-37395438 TGGGAGAGGCCCAGGGAAGACGG - Intergenic
1008254278 6:49276919-49276941 TTTGACATGTTGAGAGAAGAAGG + Intergenic
1008361192 6:50620999-50621021 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1008464701 6:51817465-51817487 TATGATATACTGAGGGGAGAGGG + Intronic
1008517968 6:52335994-52336016 TGGTAGGTGCTGTGGGAAGATGG - Intergenic
1008599782 6:53081012-53081034 TGTGAGTTGCTGCTGGAAGTAGG - Exonic
1009879220 6:69544405-69544427 TTTGGGAGGCTGAGGCAAGAAGG + Intergenic
1010078663 6:71831694-71831716 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1010652223 6:78468347-78468369 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1010679705 6:78784150-78784172 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1010991030 6:82480084-82480106 TGGAAGATGCTGAGGGATCAAGG + Intergenic
1011252197 6:85383591-85383613 TGTGAAAGAATGAGGGAAGAGGG - Intergenic
1011315442 6:86026473-86026495 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
1012605868 6:101157234-101157256 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1012680272 6:102170685-102170707 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1012854927 6:104490413-104490435 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1013499777 6:110737207-110737229 TGTGTTATGGTAAGGGAAGATGG - Intronic
1013504738 6:110788268-110788290 TTTGAGAAGCTGAGGCAGGAGGG - Intronic
1013606276 6:111751859-111751881 TTTGAGAGGCCGAGGCAAGAGGG - Intronic
1013762289 6:113532138-113532160 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1014605902 6:123473101-123473123 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1015328609 6:131951483-131951505 TGTGAGTTGATGAGGCAGGAAGG - Intergenic
1015494860 6:133869962-133869984 TTTGGGATGCTGAGGCAGGAGGG + Intergenic
1015927555 6:138325387-138325409 TGTGAGAAACTGAAGGTAGAAGG - Intronic
1016045378 6:139475513-139475535 TGTCAGTTGTTGAAGGAAGAAGG - Intergenic
1016193650 6:141303536-141303558 TTTGAGAGGCTGAGGTAGGAAGG - Intergenic
1016416328 6:143838146-143838168 TGAGTGATGTTGACGGAAGAGGG + Intronic
1017530330 6:155284011-155284033 TCTGAGATGCTGAAGGGAGGTGG + Intronic
1017627438 6:156362265-156362287 TTTGACGTGCTGAGAGAAGAAGG + Intergenic
1018668820 6:166163167-166163189 TGAGAGATGCTGAGAGAGGTGGG + Intronic
1018750450 6:166799890-166799912 TGGGAGAGGGTGAGGGATGAAGG - Intronic
1019398035 7:834027-834049 TGGGAAATGCAGAGGGAAGGTGG + Intronic
1019775365 7:2909381-2909403 AGTGAGAGGCTGAGGGGTGAGGG - Intronic
1019775423 7:2909557-2909579 AGTGAGAGGCTGAGGGGTGAGGG - Intronic
1020073570 7:5243160-5243182 TGGCAGAGGCTGAGGGAACAGGG + Intergenic
1020403774 7:7807193-7807215 TGTGAGATTTCGATGGAAGAAGG + Intronic
1020845199 7:13273673-13273695 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1020865112 7:13550362-13550384 TGTGAGGTGGGTAGGGAAGAAGG + Intergenic
1020922287 7:14280017-14280039 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1021088226 7:16449528-16449550 AGTGAGAAGCAGAGGAAAGAAGG - Intergenic
1021618741 7:22529317-22529339 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1022090264 7:27103512-27103534 GGCGAGAGGCTGAGGGGAGAAGG - Intergenic
1022184971 7:27958508-27958530 TGTGTGCTGCAGAGGGAACATGG + Intronic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022439205 7:30419465-30419487 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1022694065 7:32687675-32687697 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
1022811459 7:33872882-33872904 TGTGAGAGGTGGAGGGAAGCTGG - Intergenic
1024022178 7:45382485-45382507 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1024474849 7:49799194-49799216 TCTGAGATGGTGAGGCAAGAAGG + Intronic
1024559308 7:50629918-50629940 TGTGAGTTGCTGCGGGACAAGGG - Intronic
1024592440 7:50899863-50899885 TTTGACGTGCTGAGAGAAGAAGG + Intergenic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025213784 7:57037552-57037574 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1025609113 7:63061244-63061266 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1025650976 7:63468664-63468686 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1025658169 7:63539265-63539287 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1025724638 7:64045577-64045599 TGGGAGATCCATAGGGAAGAAGG + Intronic
1026109201 7:67445424-67445446 TTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1026232863 7:68500400-68500422 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1026417606 7:70198348-70198370 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1027151458 7:75737027-75737049 TTTGAGAGGCTGAGGCATGAGGG - Intronic
1027241936 7:76336347-76336369 TGGGGGCTGCTGAGGGAAGAAGG + Intronic
1027292536 7:76729503-76729525 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1027589700 7:80102164-80102186 TTTGGGAGGCTGAGGCAAGAAGG + Intergenic
1028010699 7:85639643-85639665 TGTGAGCTGTTGAGTGAACATGG - Intergenic
1028355510 7:89901875-89901897 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1029545968 7:101210745-101210767 TGGGATACCCTGAGGGAAGAAGG - Intronic
1029633601 7:101768904-101768926 TTTGGGAGGCTGAGGGACGAGGG + Intergenic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1029733274 7:102451629-102451651 TGGGGGATGCTGTGGGCAGAGGG + Exonic
1029948921 7:104562666-104562688 TTTGAGGAGCTGAGAGAAGAAGG - Intronic
1030301057 7:107975487-107975509 TGTGAGATTTAGAGGGAGGAAGG - Intronic
1030725138 7:112917605-112917627 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1030751782 7:113238642-113238664 TGAGAGATAGTGAGGGAAGTTGG + Intergenic
1030859741 7:114610740-114610762 TTTGGGAGGCTGAGGTAAGAGGG - Intronic
1031192403 7:118570735-118570757 TGCCAGGGGCTGAGGGAAGAAGG + Intergenic
1031291097 7:119936195-119936217 TGTAAAATGCAGAGGGTAGAAGG + Intergenic
1031435135 7:121724320-121724342 TTTGAGGAGTTGAGGGAAGAAGG - Intergenic
1031610642 7:123822714-123822736 TTTGAGAAGCTGAGGGATGAAGG + Intergenic
1031751748 7:125583417-125583439 TGCCAGAGGCTGGGGGAAGAGGG - Intergenic
1032327976 7:130950203-130950225 TGGGAGAGGCTGAGGAAGGATGG + Intergenic
1032616935 7:133482943-133482965 TGTGACAGGCTGAGAGAGGAGGG - Intronic
1032881782 7:136098654-136098676 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1032890172 7:136185935-136185957 TGCCAGATGCTGAGGGAAGAGGG - Intergenic
1032944351 7:136832209-136832231 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1033445144 7:141414680-141414702 AGAGAGATGCTCAGAGAAGATGG - Intronic
1033707667 7:143904668-143904690 TGTCAGCTTCTGAGGGGAGAAGG - Intergenic
1033911827 7:146273049-146273071 TGTGGGATGGTGAGGGTGGAAGG + Intronic
1033933626 7:146555249-146555271 GGTGAGATGGTGTGGGAAGGTGG - Intronic
1034024982 7:147691764-147691786 TGTGTGAAGATGAGGGAATATGG - Intronic
1034034994 7:147809864-147809886 TGTGAGGTGCTGAGGAAGGCTGG + Intronic
1034409371 7:150931685-150931707 TGCCAGGAGCTGAGGGAAGAGGG + Intergenic
1034488537 7:151381016-151381038 TGTGAGAGGCAGAGGGCAGGAGG + Intronic
1035241197 7:157530534-157530556 TGCCAAATCCTGAGGGAAGATGG - Intergenic
1035545730 8:480930-480952 TGAGAGATGCTTAAGGAATAAGG + Intergenic
1035580125 8:734573-734595 AGTGAGATGCAGTGGCAAGAGGG - Intronic
1035708685 8:1696256-1696278 TTTGGGAAGCTGAGGCAAGAGGG + Intronic
1035884319 8:3275913-3275935 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1036170710 8:6481555-6481577 TGGGAGAGGAGGAGGGAAGACGG - Intronic
1036434594 8:8722180-8722202 TGGGAGAATCTGTGGGAAGAGGG - Intergenic
1036689698 8:10937385-10937407 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1037579554 8:20236475-20236497 TCTGGGCTGGTGAGGGAAGAGGG - Intergenic
1038045914 8:23765481-23765503 TGTGAGCTGCCGAGGAAAGAAGG + Intergenic
1038163229 8:25060482-25060504 TTTGAGAGGCTGAGGCAGGACGG - Intergenic
1038288239 8:26225637-26225659 GGTGATGTGGTGAGGGAAGAAGG - Intergenic
1039300423 8:36203014-36203036 GGTGAGATGCTCAGGGATGGGGG + Intergenic
1039637677 8:39183548-39183570 TGAGTGATGATGAGGAAAGATGG - Intronic
1039821779 8:41141398-41141420 TTTGAGAGGCTGAGGCAGGAGGG - Intergenic
1040083362 8:43312267-43312289 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1040865580 8:52046320-52046342 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1041282702 8:56227492-56227514 TATGAAAAGCTGAGGAAAGAGGG + Intergenic
1041655994 8:60351173-60351195 TGAGTGATGATGTGGGAAGAGGG - Intergenic
1042014525 8:64293336-64293358 TCTGAGAGGCAGTGGGAAGAAGG - Intergenic
1043241628 8:77941525-77941547 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1043447950 8:80337836-80337858 TGTGGTATTCTGAGGGAGGAAGG - Intergenic
1043808678 8:84706222-84706244 TGAAAGATGTTGAGGGCAGAGGG + Intronic
1044143775 8:88686726-88686748 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1044980036 8:97707508-97707530 TTTGAGAGGCTGAGGCAGGAGGG - Intronic
1045088309 8:98711292-98711314 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1045297311 8:100883142-100883164 TGTGAGATTTGGAGGGTAGAAGG - Intergenic
1045564711 8:103301647-103301669 TTTGGGATGCTGAGGCAGGACGG - Intronic
1045787918 8:105944470-105944492 TGTGAGATGCTGAGAAAAATGGG + Intergenic
1046228001 8:111311303-111311325 TGTAAGATGCAGTGGGAAGAGGG + Intergenic
1046433988 8:114163750-114163772 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1046439527 8:114239997-114240019 TTTGAGAAGCTGAGGCAGGAAGG + Intergenic
1046544887 8:115637369-115637391 TGTGACATGTAGACGGAAGAAGG + Intronic
1047528132 8:125651097-125651119 TTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1047840439 8:128745629-128745651 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1048065721 8:130966428-130966450 GGTTAGGTGCAGAGGGAAGAAGG + Intronic
1048262012 8:132953188-132953210 TGTGAGTTGCAGAGGGGAGCTGG + Intronic
1048425401 8:134318893-134318915 TGTGAGCTGCTCAGGCAAGAGGG + Intergenic
1048558792 8:135510203-135510225 TTTGAGAGGCTAAGGAAAGAGGG - Intronic
1048907749 8:139104708-139104730 TCTGAGATGCTGAGGCAGGGAGG + Intergenic
1050143259 9:2538646-2538668 TGTTAGATGCTGTGGGGAGGTGG - Intergenic
1050178888 9:2899033-2899055 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1050497175 9:6255820-6255842 AGTGAGTTGTGGAGGGAAGAGGG - Intronic
1050555211 9:6783914-6783936 TGTGAGAGGCTGGGGAGAGAAGG + Intronic
1050677162 9:8069318-8069340 TTTGAGAGGCTGAGGCAGGAGGG - Intergenic
1050688966 9:8203959-8203981 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1051288397 9:15520044-15520066 TGGGATATGCTGAGTGAAGTGGG - Intergenic
1051441663 9:17090150-17090172 TTTGAGAGGCTGAGGCAAGAGGG + Intergenic
1051572698 9:18578366-18578388 TCTGAGATGCAGGGTGAAGAGGG - Intronic
1051702046 9:19834232-19834254 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1052334657 9:27307241-27307263 TGTGAGAGACTTAGGGGAGAAGG - Intergenic
1052445226 9:28553155-28553177 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1053213784 9:36254282-36254304 TTTGGGAGGCTGAGGCAAGAAGG + Intronic
1053282943 9:36832829-36832851 CTTGAGAGGCTGAGGCAAGAGGG + Intergenic
1054345896 9:63914400-63914422 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1054459930 9:65457169-65457191 TGTGAGAAGCTCAGGGAGGCAGG - Intergenic
1056216050 9:84407061-84407083 TTTGAGAGGCTGAGGCAACATGG - Intergenic
1056346835 9:85705432-85705454 TTTGGGAAGCTGAGGCAAGAGGG + Intronic
1057221431 9:93259744-93259766 TGTGTGAGGCTGAGGGAGGCGGG + Intronic
1057294435 9:93827148-93827170 GGTGAGGTGCTGAGGGAGGCGGG + Intergenic
1057901872 9:98955407-98955429 TGTCAGATGCTGGGGAAACATGG - Intronic
1058118049 9:101107133-101107155 TTTGAGGAGCTGAGAGAAGAAGG - Intronic
1058842937 9:108927896-108927918 AGTGAGGGGCTGAGGGAAGTTGG + Intronic
1059555351 9:115275584-115275606 TGTGTGAAGCTGGGGGAAGGGGG + Intronic
1059592372 9:115675659-115675681 GGTGAGGTGGTGGGGGAAGAGGG - Intergenic
1059974401 9:119700202-119700224 TGGGAGAAGATGAGGGAAGGTGG - Intergenic
1060465886 9:123904375-123904397 TTTGACAAGCTGAGAGAAGAAGG + Intronic
1060690456 9:125653521-125653543 TGTGACCTGCTTAGGGGAGAAGG + Intronic
1061443181 9:130620977-130620999 TGTCAGATGCTGGGGGAAGGAGG + Intronic
1061488542 9:130932992-130933014 TGGGAGTTGCAGAGGGGAGACGG - Intronic
1061595005 9:131623219-131623241 TTTGGGAGGCTGAGGGAGGAGGG + Intronic
1061674834 9:132209802-132209824 TGTGAGCTGCTGGGGGAATGGGG + Intronic
1061804623 9:133131143-133131165 TGTGAGATGCTCAGAGGAGCAGG - Intronic
1061877095 9:133549625-133549647 TATGAGAGGCTGAGGCAGGAGGG - Intronic
1185552846 X:997838-997860 TGTGAGAAGCTCAGAGAAGCAGG + Intergenic
1185706211 X:2267981-2268003 TGTGGGATACTCAGTGAAGAGGG - Intronic
1186357562 X:8803160-8803182 TTTAAAATGTTGAGGGAAGAAGG - Intergenic
1186617931 X:11208981-11209003 TTTAAAATGTTGAGGGAAGAAGG + Intronic
1186735840 X:12463070-12463092 TGTGGTAAGCTGAGGGAGGATGG + Intronic
1187343321 X:18440989-18441011 TGTTAGAGGAAGAGGGAAGAGGG + Intronic
1187391929 X:18891732-18891754 TGTGGGATGGGGAGGGAACAGGG + Intergenic
1187424960 X:19168985-19169007 TTTGAGAGTCAGAGGGAAGAGGG - Intergenic
1188461331 X:30430357-30430379 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1188618866 X:32194582-32194604 TGTGAGGTAGTGAGGGAAGGAGG + Intronic
1188782029 X:34297190-34297212 AGTGGGATGCGGAGTGAAGAGGG - Intergenic
1189052660 X:37663046-37663068 TGAGAGATGTAGAAGGAAGAAGG - Intronic
1189273449 X:39767944-39767966 TCTGTGATGCTGATGGAAAATGG - Intergenic
1189561746 X:42198172-42198194 TATCAGAGGCTGGGGGAAGACGG - Intergenic
1190011607 X:46789973-46789995 CTCGAGATGCTGAGGGTAGAAGG + Intergenic
1190828517 X:54040564-54040586 TGTGAGTTGCAAAGGGGAGAGGG + Intronic
1190975655 X:55397682-55397704 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1191145629 X:57162845-57162867 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1191935969 X:66427274-66427296 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1192197349 X:69037367-69037389 TGTGAGAGACAGAGGGGAGAGGG - Intergenic
1192618739 X:72655163-72655185 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
1192666984 X:73098919-73098941 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1192974509 X:76268426-76268448 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1192984140 X:76378537-76378559 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1193064577 X:77245289-77245311 TTTGACAAGCTGAGAGAAGAAGG + Intergenic
1193182168 X:78471213-78471235 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1193831477 X:86294408-86294430 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1194005106 X:88481926-88481948 TGTCAGGGGCTGAGGGAAGTGGG - Intergenic
1194619291 X:96149072-96149094 TTTGGGAGGCTGAGGCAAGAAGG + Intergenic
1194736078 X:97514494-97514516 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1195553461 X:106194525-106194547 TTTGACAAGCTGAGAGAAGAAGG - Intronic
1196008113 X:110856809-110856831 TGGGAGATGTAAAGGGAAGAAGG - Intergenic
1197159294 X:123305913-123305935 TGGGAGGTGGTGGGGGAAGATGG + Intronic
1197678143 X:129352959-129352981 TTTGACATGTTGAGAGAAGAAGG + Intergenic
1199427353 X:147718269-147718291 GAAGAGATGCTGAGGGAAAAGGG + Intergenic
1199622353 X:149712551-149712573 TGTGACCTGCTGAGGGCAGCGGG + Intronic
1199817453 X:151411413-151411435 TGTGAGAAGATCTGGGAAGAGGG - Intergenic
1199938863 X:152604541-152604563 AGAGAGATGGTGAGGGAGGAAGG + Intergenic
1200414885 Y:2899354-2899376 TTTGAGAGGCTGAGGTAGGAGGG + Intronic
1200676884 Y:6158995-6159017 TTTCAGATGCTGTGGTAAGAAGG + Intergenic
1200874505 Y:8139305-8139327 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1201080672 Y:10241952-10241974 TTTGACAAGCTGAGAGAAGAAGG - Intergenic
1201563764 Y:15345294-15345316 TTTGTGATCCTGAGGGCAGAAGG - Intergenic
1202333288 Y:23777990-23778012 TCTGACAAGCTGAGAGAAGAAGG - Intergenic
1202537481 Y:25892073-25892095 TCTGACAAGCTGAGAGAAGAAGG + Intergenic