ID: 1091626523

View in Genome Browser
Species Human (GRCh38)
Location 12:2125007-2125029
Sequence CTCCCACTCCACCCTGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 282}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091626523_1091626526 5 Left 1091626523 12:2125007-2125029 CCTGCATCAGGGTGGAGTGGGAG 0: 1
1: 0
2: 3
3: 37
4: 282
Right 1091626526 12:2125035-2125057 CAGTGACCACAGCCAGACCCTGG 0: 1
1: 0
2: 1
3: 40
4: 326
1091626523_1091626531 27 Left 1091626523 12:2125007-2125029 CCTGCATCAGGGTGGAGTGGGAG 0: 1
1: 0
2: 3
3: 37
4: 282
Right 1091626531 12:2125057-2125079 GAGAACAGTGACGTTTGCAGAGG 0: 1
1: 0
2: 1
3: 19
4: 189
1091626523_1091626532 28 Left 1091626523 12:2125007-2125029 CCTGCATCAGGGTGGAGTGGGAG 0: 1
1: 0
2: 3
3: 37
4: 282
Right 1091626532 12:2125058-2125080 AGAACAGTGACGTTTGCAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091626523 Original CRISPR CTCCCACTCCACCCTGATGC AGG (reversed) Intronic
900914842 1:5629596-5629618 CTCCCACTCAGTCCTGCTGCAGG + Intergenic
901203399 1:7479532-7479554 CTCTCACTCCACCTGGCTGCTGG + Intronic
902741190 1:18439500-18439522 CCCCCACCCCACCCTGAGGAGGG - Intergenic
903133998 1:21297310-21297332 CTCTCACTCCTACCTGATACAGG + Intronic
904049599 1:27631320-27631342 CTCCCACTCACCCCTACTGCTGG + Intronic
904999626 1:34658059-34658081 CTCCCACTGCAGCCTTATGTAGG - Intergenic
906449648 1:45934068-45934090 CCCACCCTCCACCCTGATGTAGG + Intronic
907319033 1:53591266-53591288 CTCCCTCTCCTCCATGATGCTGG - Intronic
907480796 1:54744457-54744479 CTCCCACTGCCTCCTGATGGAGG - Intergenic
907975079 1:59423711-59423733 CTCCCACTCCACCCAGCTTCTGG + Intronic
908929921 1:69306104-69306126 TTCCCACTCCATCCTGCTTCTGG - Intergenic
912466376 1:109877586-109877608 CCCCCAGTGCTCCCTGATGCCGG - Intergenic
912530698 1:110319205-110319227 CTCCCACCCCACCTTGAATCTGG + Intergenic
912543357 1:110433504-110433526 CTCCCTCTCCACCCTAATGGAGG + Intergenic
912833958 1:112979117-112979139 CTCCCACTTCAACCTTCTGCGGG + Intergenic
913509254 1:119547496-119547518 GGGCCATTCCACCCTGATGCTGG - Intergenic
915194367 1:154178427-154178449 CTACCACTCCACCCTGGAGGGGG - Intronic
915290881 1:154882437-154882459 CTCCCCCTCAACACTGGTGCTGG + Intergenic
915319927 1:155051116-155051138 CTCCCACTCCGCACAGTTGCGGG + Intronic
915561394 1:156690178-156690200 CTCCCACTCAACTCAGCTGCTGG - Intergenic
916459685 1:165010611-165010633 CCCCCGCCCCACCCCGATGCTGG + Intergenic
917523456 1:175767084-175767106 CTCTCACTCCACCCTCTTGATGG + Intergenic
917739205 1:177946584-177946606 CTCCCATCCCACCCAGATGATGG - Intronic
919640107 1:200038804-200038826 CTCCCACCCCACCCTGGCCCGGG - Intronic
919822832 1:201483730-201483752 CTTCCACTCCACCCTTCTCCAGG - Exonic
920210390 1:204323884-204323906 CTGCCACTCCATCCTCAAGCAGG - Intronic
920934231 1:210416224-210416246 GTCCCACAGCACCCTGATGATGG + Intronic
921188508 1:212690085-212690107 CACACACTCCACCCTGCAGCAGG + Intronic
923459740 1:234197816-234197838 CTCACATTACAACCTGATGCTGG - Intronic
924778723 1:247128874-247128896 CTCCCACCCCATCCTGCTGGGGG - Intronic
924778740 1:247128936-247128958 CTCCCACCCCATCCTGCTGGGGG - Intronic
924778773 1:247129059-247129081 CTCCCACCCCATCCTGCTGGGGG - Intronic
924778790 1:247129121-247129143 CTCCCACCCCATCCTGCTGGGGG - Intronic
924778808 1:247129183-247129205 CTCCCACCCCATCCTGCTGGGGG - Intronic
924778825 1:247129245-247129267 CTCCCACCCCATCCTGCTGGGGG - Intronic
924778842 1:247129307-247129329 CTCCCACCCCATCCTGCTGGGGG - Intronic
924778860 1:247129369-247129391 CTCCCACCCCATCCTGCTGGGGG - Intronic
924778877 1:247129431-247129453 CTCCCACCCCATCCTGCTGGGGG - Intronic
924778895 1:247129493-247129515 CTCCCACCCCATCCTGCTGGGGG - Intronic
924778944 1:247129679-247129701 CTCCCACCCCATCCTGCTGGGGG - Intronic
924778977 1:247129803-247129825 CTCCCACCCCATCCTGCTGGGGG - Intronic
924779010 1:247129927-247129949 CTCCCACCCCATCCTGCTGGGGG - Intronic
1063814258 10:9755109-9755131 GACCCACTTCACCCTGAAGCAGG - Intergenic
1065081924 10:22137717-22137739 CTCCTACTCCAGCCTTCTGCTGG + Intergenic
1065108926 10:22420938-22420960 CTCTCAGTCCAACCTGCTGCTGG - Intronic
1065920979 10:30392607-30392629 CTGCCTCCCCACCCTGATCCTGG - Intergenic
1066696617 10:38084697-38084719 CTCCCACCCCACCCTCATGTAGG - Intergenic
1066995932 10:42563036-42563058 CTCCTACTCCACCCTCATGTAGG + Intergenic
1067455835 10:46418734-46418756 CTCCCTCTCCTCCCTGAGGCCGG + Intergenic
1067460708 10:46456246-46456268 CTCTCTGTCCACCCTGATACTGG - Intergenic
1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG + Intergenic
1067631365 10:47965905-47965927 CTCCCTCTCCTCCCTGAGGCCGG - Intergenic
1067726918 10:48777315-48777337 TTCCCACTCTACCCTCCTGCCGG - Intronic
1071023121 10:81082477-81082499 CTCACACTCCAGCATGCTGCAGG - Intergenic
1071522410 10:86339465-86339487 TTCCCACTGCACCCTGTGGCTGG + Intronic
1071545210 10:86523621-86523643 CTTCCACTTCAGCCTCATGCAGG - Intergenic
1072450738 10:95537684-95537706 CTCTCATTCCACCCTGATGCTGG + Intronic
1072890719 10:99321862-99321884 CTGACACCCCACCCTGATTCAGG + Intergenic
1073890579 10:108096543-108096565 CTCCCACTCTCCACTGGTGCTGG - Intergenic
1074575968 10:114669730-114669752 CACCCACTTCATCCTGAGGCAGG - Intronic
1074979372 10:118607595-118607617 CTCCCTGTCCACCCTCATGTAGG + Intergenic
1075119162 10:119651687-119651709 CACCCACTCGCCCATGATGCAGG + Exonic
1075342470 10:121658432-121658454 CTCACCCTCCACCCTCAAGCAGG - Intergenic
1075554431 10:123420105-123420127 GTCCCACGCCACACTGATTCTGG - Intergenic
1075816229 10:125266700-125266722 GTCAGACTCCACCCTGAGGCGGG - Intergenic
1076024536 10:127100827-127100849 CTCCCACTGCAGCCTGACTCCGG - Intronic
1076168287 10:128299725-128299747 CTCCCTCTCCTCCTTGCTGCAGG + Intergenic
1076670332 10:132117534-132117556 CTCGCACTCCTTCTTGATGCGGG - Exonic
1076704583 10:132294166-132294188 CTCCCGCTCCACCCACACGCTGG - Intronic
1077254230 11:1573270-1573292 CTCCCTCTCCACCCGGCAGCGGG - Intergenic
1077360118 11:2137130-2137152 ATCCCACTCCAGCCTGAGGCAGG - Intronic
1078095770 11:8295932-8295954 CACCCAATCCACCCTACTGCAGG - Intergenic
1080383134 11:31794759-31794781 CTCCCCCTCCTTCCTGTTGCTGG + Exonic
1080628230 11:34050934-34050956 CACCCACTCCACCCCAAGGCTGG + Intergenic
1081910172 11:46695326-46695348 CTACCCCTCCACCCTAATGTTGG - Intronic
1084573601 11:69975046-69975068 GTCCCACCCCACGCTGCTGCAGG + Intergenic
1085125839 11:74001889-74001911 TTCTAACTCCACCCTGCTGCTGG + Intronic
1085638887 11:78178900-78178922 CTCCCACTCCACCATGTCTCAGG + Intronic
1088268405 11:108009222-108009244 CGCCCACCACACCCTGGTGCGGG + Exonic
1089681500 11:120121446-120121468 CCCCAACTCCACCCTGAGCCTGG + Intronic
1089695848 11:120215926-120215948 CTCCCTATCCTCCCTGATGCTGG - Intronic
1089728437 11:120503719-120503741 CTCCCCCTCCACCCTTCTGAGGG - Intergenic
1089851531 11:121501374-121501396 TTCCTTCTCCTCCCTGATGCTGG + Intronic
1090007726 11:123017631-123017653 CTCCTTCTCCACCATGGTGCCGG - Intergenic
1090552960 11:127842671-127842693 ACCCCACCCCACCCTGATGCAGG + Intergenic
1091626523 12:2125007-2125029 CTCCCACTCCACCCTGATGCAGG - Intronic
1093134310 12:15432151-15432173 CTCACCCACCACCCTGATGTAGG + Intronic
1097203470 12:57299878-57299900 GTCCCCCTCCTCCCTGGTGCAGG + Intronic
1097861497 12:64522895-64522917 CTCCCACTCCTCCGGGCTGCTGG + Intergenic
1098494018 12:71113769-71113791 CTCCCAATCCATCCTGAGGAAGG - Intronic
1099211325 12:79792694-79792716 CTTCCACTCCAGCCTGGTGGGGG + Intronic
1099753377 12:86807274-86807296 CCCCCACTCCACCCTCAGACAGG + Intronic
1100367717 12:93936844-93936866 CTCCCACTCCAGCCAGTTCCAGG - Intergenic
1102444324 12:112990035-112990057 GTCTCACTCCACCCTGCAGCTGG + Intronic
1102784855 12:115596085-115596107 CTCCTATTCCACCCTGGAGCAGG - Intergenic
1103119712 12:118371550-118371572 CTCACACTCCACCCTCAGGGAGG + Intronic
1104050026 12:125188627-125188649 CTCCCACTGAAACCTGCTGCTGG + Intronic
1104329756 12:127833748-127833770 CTCCCAGCCCAGCCTGAGGCAGG + Intergenic
1105378748 13:19866862-19866884 CTCACTCTGCACCCAGATGCTGG - Intergenic
1105545558 13:21348212-21348234 CTCCCACTTCACACTGAGGGGGG + Intergenic
1107549254 13:41459050-41459072 CTCCCCCTCCAGCCTGGTGGAGG - Intronic
1108689875 13:52850684-52850706 CTCCCACCCCAACCTGGGGCTGG + Intergenic
1108929452 13:55798306-55798328 CTCCTTCTCCACCCTCAAGCAGG + Intergenic
1109047924 13:57437558-57437580 TTCCCTCTCCACCCTGGTGGTGG - Intergenic
1113012419 13:105784907-105784929 CTCCCATGGCACCCAGATGCTGG + Intergenic
1113449681 13:110398795-110398817 CTCCAACTCCACCCTGCCTCTGG - Intronic
1113597231 13:111541876-111541898 CTCCCACGTGACACTGATGCTGG + Intergenic
1118811716 14:69279873-69279895 CTGCAACTTCACCCTGAAGCTGG + Intronic
1118908038 14:70037216-70037238 CTCCCTAGCCACCCTGATGCTGG + Intergenic
1119253365 14:73177051-73177073 CTCCCACTTGACACTGATTCTGG + Intronic
1121029986 14:90649941-90649963 CTCCCACTGCACGATGATGATGG - Intronic
1121404741 14:93712831-93712853 CTCCCTCTCCACCCACCTGCGGG - Intergenic
1121738890 14:96237694-96237716 CAACCTCTCCACCCTGCTGCAGG + Intronic
1122631573 14:103109694-103109716 CTCCCTCTCCACCCTGTCCCTGG + Intronic
1122903574 14:104792005-104792027 CTCCCATCCCACCCAGCTGCTGG + Intronic
1124405716 15:29389905-29389927 CCCCCACCCCTCCCTGATACCGG + Intronic
1124407232 15:29403959-29403981 CTCTCCCTCCTCCCTGCTGCAGG + Intronic
1127268068 15:57376817-57376839 CTCCCACCCCGCCCCGAAGCGGG - Intronic
1128126432 15:65196778-65196800 CCACCACTCCACCCTGGCGCTGG + Exonic
1131156673 15:90080092-90080114 CTCCCACTCCCCACGGAAGCAGG - Exonic
1131288140 15:91080397-91080419 CTCCCGCTCCACCCTGCTTTAGG + Intergenic
1132584200 16:699243-699265 CTCCCACTCCACCCTGTGCGTGG - Intronic
1132682009 16:1146274-1146296 TTCCCACTCCACAGTGATCCGGG + Intergenic
1132731002 16:1362034-1362056 CTCCCACTCGTGCCAGATGCTGG - Exonic
1132999188 16:2840666-2840688 CTCCCACCCCACCCTGAAGCTGG - Intergenic
1136061931 16:27732596-27732618 CTCCCCCTCCTCCCTGACTCTGG - Intronic
1136636919 16:31529863-31529885 TTCCCTTTCCACCCTGATCCAGG - Intergenic
1137558761 16:49489824-49489846 CTCCCACACCTCCATCATGCTGG - Exonic
1141140377 16:81493237-81493259 CTCAGACTGCACTCTGATGCTGG - Intronic
1142317795 16:89359667-89359689 CTGCCTCTCCACACTGAAGCAGG + Intronic
1142886010 17:2912417-2912439 CTGTCACTCCACCCTGATGAGGG - Intronic
1142927684 17:3255375-3255397 CCCCCACCCCACCCTGCGGCAGG - Intergenic
1144482743 17:15640918-15640940 TTCCCACAACACCCTCATGCTGG - Intronic
1144520335 17:15948515-15948537 CTCTCACTTCACCCTCAGGCAGG + Intronic
1144734365 17:17546673-17546695 CTCCCTGTCCACCCTGGGGCTGG + Intronic
1144873221 17:18382983-18383005 CTCTCTCCCCACCCTGCTGCTGG + Intronic
1144915945 17:18724114-18724136 TTCCCACAACACCCTCATGCTGG + Intronic
1146064472 17:29623530-29623552 CTCCCTCCCCTCCCAGATGCAGG + Intergenic
1147114696 17:38290193-38290215 CTTCCACTCACCCCTGCTGCTGG - Intergenic
1148063211 17:44850691-44850713 CTCCCACTCCATGCTGCTTCTGG - Exonic
1148233747 17:45953466-45953488 CTCAGCCTCCACCCTGATCCTGG - Intronic
1148414919 17:47499012-47499034 CTTCCACTCACCCCTGCTGCTGG + Intergenic
1148784554 17:50139702-50139724 CTCCCACTTCAGCCTGAGGCTGG + Intronic
1149559345 17:57597029-57597051 TGCCCACTCCAGCCTGATGATGG - Intronic
1150248180 17:63691399-63691421 CTCCCACTGCAACCTGAGGCAGG - Intronic
1151757182 17:76081697-76081719 CCTCCACTCCTCCCTGGTGCAGG + Exonic
1152206274 17:78976301-78976323 CTTCCACTCCTCCCTCATGGAGG - Intronic
1152277871 17:79368680-79368702 CTCGCACACCAGCCCGATGCTGG + Intronic
1152574495 17:81134105-81134127 CTCCCACTCCAGCCTGGGGTTGG - Intronic
1152610892 17:81314566-81314588 CTCCCAGGCCACCCCGGTGCTGG - Intronic
1153637656 18:7127144-7127166 CTCCAACTCCACCATGGTGCAGG + Intergenic
1153839304 18:8991615-8991637 CTTCCACCCCACCCTGCTTCAGG + Intergenic
1154331293 18:13430883-13430905 CTGCCACTCCATGCTGATGGAGG + Intronic
1155613244 18:27692929-27692951 CTCACCCTCCACCCTGAAGTAGG + Intergenic
1156354942 18:36332724-36332746 CACCCACTCCAACCTGAGCCAGG - Intronic
1156397240 18:36709332-36709354 CTCCCTCTCCAACGTGCTGCTGG - Exonic
1156486708 18:37471093-37471115 CTCCCTCTCTGCCCTGAAGCTGG - Intronic
1158146773 18:54323120-54323142 TTCCCACTACACCCTGATGCAGG + Intergenic
1158881610 18:61784297-61784319 CTCACACTCCTCACTGATACTGG + Intergenic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1162069607 19:8145920-8145942 CTCACACTGCACCCTGACCCTGG + Exonic
1164821598 19:31255322-31255344 CTCCCACTCCAGCCAGCAGCTGG - Intergenic
1164906820 19:31974619-31974641 CTCCATCTCCAGCCTGCTGCTGG + Intergenic
1165048450 19:33125223-33125245 GTCCCACCCCACACTGATCCTGG - Intronic
1165324687 19:35107650-35107672 CTCCCACTCCACCCCCTTCCAGG + Intergenic
1166232466 19:41433208-41433230 CTCCCACCTAACCCAGATGCAGG - Intronic
1166985690 19:46659193-46659215 CACCGCCTCCTCCCTGATGCTGG + Intronic
1167464739 19:49644861-49644883 CTCCCACTCCACCCTGTGCTTGG - Intronic
1168305583 19:55433404-55433426 CTCGCACTCCAACCTGCTGCTGG - Exonic
925033749 2:671381-671403 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033764 2:671434-671456 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033779 2:671487-671509 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033794 2:671540-671562 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033809 2:671593-671615 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033824 2:671646-671668 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033839 2:671699-671721 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033854 2:671752-671774 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033869 2:671805-671827 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033884 2:671858-671880 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925709572 2:6725853-6725875 TTCCTTCTCCACCCTGATGGAGG - Intergenic
926297895 2:11581822-11581844 CTCCCACTCCACTGTGCTGGTGG + Intronic
926644333 2:15273133-15273155 TTTCCACTCCACCCTCAGGCTGG - Intronic
928784570 2:34867046-34867068 CTCTCTCTCCACTCTGATGTTGG - Intergenic
928947955 2:36789156-36789178 TTTCCACTCCACCCTGCTGCTGG - Intronic
928951901 2:36820680-36820702 CTCTCACTCCACCCTCCTCCAGG + Intergenic
929161493 2:38836960-38836982 CTCCCACTCCAACCCCTTGCTGG + Intronic
929769394 2:44879182-44879204 CTCCTACTCCACTCTCATGTTGG - Intergenic
931224537 2:60318627-60318649 CTCCCTCCCCGCCCTGCTGCAGG + Intergenic
931720169 2:65061747-65061769 CACCCACGCCACCCTGAAGCAGG + Intronic
932695475 2:73952690-73952712 CTCTCACTCCTCCCCAATGCTGG - Intronic
934559468 2:95305174-95305196 CTCCCACTCCTGCTCGATGCCGG - Intronic
935270633 2:101431654-101431676 CTCTCCCTCCACCCTGACTCTGG + Intronic
935297110 2:101659463-101659485 TTCCCACTCCAACCTCATGCTGG - Intergenic
935652384 2:105393243-105393265 CTCCCTATCAACCCTGCTGCAGG + Intronic
936098712 2:109555460-109555482 CCCCCACTCTCCCCTGTTGCAGG + Intronic
938108590 2:128549773-128549795 CACCCACCCCACCCTGGGGCTGG + Intergenic
941740779 2:169033010-169033032 CTTCCTCTGCACCCTCATGCTGG + Intergenic
941874671 2:170420516-170420538 CACCCACTCCAGGCTGGTGCTGG - Intronic
944143558 2:196482422-196482444 CTCCCACTCATTCCTGATTCAGG - Intronic
944351731 2:198735839-198735861 CACCCACCCAACCCTGATGCAGG + Intergenic
944673634 2:202016739-202016761 CTCCTCCTCCACCCTGTTGGTGG - Intergenic
947563992 2:231182057-231182079 CTCTCACTTCCCCCTGCTGCTGG - Intergenic
948432650 2:237929879-237929901 CTCCCACTCCTCCAGGCTGCTGG + Intergenic
948552284 2:238781620-238781642 CTCACCCTCCACCCTCAAGCAGG - Intergenic
1169947593 20:11006019-11006041 CTCACCCTCCACCCTCAAGCAGG + Intergenic
1170524832 20:17227114-17227136 CTTCCCCTCCAGCCAGATGCTGG + Exonic
1172187749 20:33041857-33041879 CCCCAACGCCTCCCTGATGCAGG - Intronic
1172530849 20:35630410-35630432 TTCCCCATCCACCCTGAGGCAGG - Intronic
1172784000 20:37454070-37454092 CTCCCACTGCAGCCTGAGGCAGG - Intergenic
1173146396 20:40528369-40528391 CCCACACTCCACCCTCAGGCAGG + Intergenic
1173864751 20:46306981-46307003 CTCCCTCTCCACCCAGGTTCAGG - Intronic
1174257549 20:49269346-49269368 CTCCCACTCTATCCTGAAGTAGG - Intronic
1175336050 20:58197082-58197104 CTCCCACTCCACCCCGTCACCGG + Intergenic
1175389877 20:58620297-58620319 CTCCCACCCCAGCCTCATCCTGG - Intergenic
1177765025 21:25448322-25448344 CTGCCACTTCACTGTGATGCAGG - Intergenic
1177801852 21:25835751-25835773 CTCCCACTCTGCTCTGAAGCAGG + Intergenic
1178714341 21:34949712-34949734 CTCCCACTCCACGCTGTGACAGG - Intronic
1179479140 21:41666719-41666741 CTCCCAAGCCAACCTGATGTGGG + Intergenic
1179879589 21:44287797-44287819 CCCCCACTGCACCCTGGTTCTGG + Intronic
1180006035 21:45021159-45021181 CTCCCAGTCCCCCGTGATCCTGG + Intergenic
1180693836 22:17739548-17739570 CTCCCACACCACCCTGCCCCGGG + Intronic
1183272154 22:36868883-36868905 CTACCACTCCGCCCTGACCCAGG + Intronic
1183411901 22:37659623-37659645 CTCCAACCCCACCCCGATGGTGG - Intronic
949866367 3:8550730-8550752 TTCCCGCCCCACCCTGATCCTGG + Intronic
950285132 3:11738861-11738883 CTCCCGCTTGACCCTGATGCAGG + Intergenic
950613570 3:14141356-14141378 CACCCACTCTACCCTGATCCAGG - Intronic
950615037 3:14151497-14151519 CGCCCACTCCAGCCTGCTGCTGG + Intronic
950680789 3:14583729-14583751 GTACCACTCCACCCGGATCCCGG - Intergenic
950728433 3:14935086-14935108 TTCCCACTGGACCCAGATGCTGG + Intergenic
952925449 3:38316450-38316472 TTCCCTCTCCTCCCTGCTGCCGG + Exonic
953357343 3:42266204-42266226 CGCCCACTCCACCCTCACACTGG - Exonic
953492337 3:43362666-43362688 CTCCCTGCCCACCCTGGTGCAGG + Intronic
955733246 3:62009724-62009746 CACCCTCTCCACACTGATGCAGG + Intronic
960119031 3:113927690-113927712 CTCCCACCCATCCCTGCTGCTGG - Intronic
960778402 3:121288962-121288984 CTCACACTCCACCCTCAAGTAGG - Intronic
961005770 3:123404461-123404483 CTCCCACTCCACCATGGTCAGGG + Intronic
961558537 3:127713163-127713185 CTGTCACTACTCCCTGATGCTGG + Intronic
962700928 3:137999225-137999247 CTCCTATTCCACCCTGGTGCAGG - Intronic
965237623 3:166146339-166146361 CTCACCCTCCACCCTAAAGCAGG - Intergenic
965559411 3:170047077-170047099 CTCCCACTGCCCCCTGCTGAAGG - Intronic
966873276 3:184306328-184306350 CTCCCTCACCACCCTGACGCAGG + Exonic
969050403 4:4369002-4369024 GTCCCACTCCACCATGGGGCTGG - Intronic
969183307 4:5458066-5458088 CTCCCACATGACACTGATGCTGG - Intronic
970604279 4:17664964-17664986 TTTCCACTCCTCCCTGATGGTGG - Intronic
971989664 4:33875904-33875926 CTCACCCTCCACCCTCAAGCAGG + Intergenic
974401249 4:61410698-61410720 TTCTCACTCAACCCTGATCCAGG - Intronic
977292908 4:95182447-95182469 CTTCCACTCCACCCAGCAGCAGG + Intronic
978073944 4:104505986-104506008 CTCCTATTCCATCCTGTTGCTGG - Intergenic
978655801 4:111064114-111064136 CTCCAACTCCACCCTGTTTCTGG - Intergenic
980878045 4:138681860-138681882 CTCCCAAGTTACCCTGATGCAGG - Intergenic
983093162 4:163529885-163529907 CCCCCACACCACCCTAATGTGGG - Intronic
984224008 4:177013523-177013545 CTCCCACTCAACCGTAATTCTGG - Intergenic
985260074 4:188106715-188106737 CTCCCACTTCGCCCTGGTCCAGG - Intronic
986151378 5:5133192-5133214 CTACAACTCCATCCTGCTGCTGG - Intergenic
986532374 5:8751878-8751900 CTCACCCTCCACCCTGAGGCAGG - Intergenic
989173106 5:38493086-38493108 TTACCACTTAACCCTGATGCAGG - Intronic
993873504 5:93279025-93279047 CACACACTCCACACTTATGCAGG - Intergenic
993923521 5:93837129-93837151 CTCCCACTCCACCCTCAAGTAGG + Intronic
994545440 5:101161321-101161343 CTCAAACTCCACCCTCAAGCAGG + Intergenic
995744696 5:115391555-115391577 CTCCTCCTCCACCCTGGTGATGG + Intergenic
995886319 5:116898323-116898345 CTCCCATTCCTGCCTGCTGCTGG + Intergenic
996285488 5:121786223-121786245 GTCCCAGTCTAACCTGATGCAGG - Intergenic
998391588 5:141790317-141790339 CCCCAACTCCACCCTGTTCCTGG - Intergenic
999952887 5:156669143-156669165 CTCCCACTCCACCCACAAGCTGG - Intronic
1000040170 5:157479464-157479486 CTCCCACTCCACAAAGGTGCTGG - Exonic
1001034184 5:168285435-168285457 CACCATCTCCACCCTGATCCAGG - Intergenic
1002907282 6:1459882-1459904 CTCACCCTCCACCCTCAAGCAGG + Intergenic
1003860261 6:10316504-10316526 CTCTCACTCCAGCCTTCTGCTGG + Intergenic
1004609615 6:17227267-17227289 CTCCCACTTGACACTGATGGAGG - Intergenic
1006696354 6:35933640-35933662 CTCTCACTCCACAATTATGCTGG - Intergenic
1006793891 6:36720344-36720366 CTCACCCTCCACCCTGCAGCTGG + Exonic
1006945911 6:37784443-37784465 CTCTCCCTCCACCCTCTTGCGGG - Intergenic
1013226716 6:108124245-108124267 CTTTCACTCCAACCTGATGTAGG + Intronic
1013233639 6:108177431-108177453 CCCCCACTCCAGGCTGATGAGGG + Intronic
1013497085 6:110708297-110708319 CTCCCACTTCAGCCTGATATTGG + Intronic
1013824064 6:114190180-114190202 CTCCCACTCCTCCATGTAGCTGG - Intronic
1017332549 6:153216817-153216839 CTCCCACTCTTCTCTGCTGCAGG - Intergenic
1018204185 6:161421491-161421513 CTCTCTATCCACCCTCATGCTGG - Intronic
1019594690 7:1853033-1853055 CTCCCACTCCACACTGGGACAGG - Intronic
1019940067 7:4282734-4282756 CCCCCACACCACCCTGCAGCAGG - Intergenic
1020335373 7:7058492-7058514 CACACACCCCACCGTGATGCGGG + Intergenic
1020571116 7:9863002-9863024 CTCACACTCCACCCTCAAGCAGG - Intergenic
1021895507 7:25231403-25231425 CTCCCACTGAAACCTGATGGGGG + Intergenic
1022395933 7:29988667-29988689 CACCCACCCCACCCGGCTGCCGG + Intronic
1023771221 7:43558400-43558422 CTCCAACTCCACCCTGGGTCTGG - Intronic
1024406295 7:48985238-48985260 CTCCCCCTCCACCCTCAAGTCGG + Intergenic
1024824674 7:53377932-53377954 CTCCTGCTGCATCCTGATGCAGG - Intergenic
1024947219 7:54820875-54820897 CTCACCCTCCACCCTTAAGCAGG + Intergenic
1026313923 7:69211675-69211697 CTTCCACTCCACCCTCCTTCTGG + Intergenic
1031986604 7:128167876-128167898 CTCCCACCCCACCTTTATCCAGG + Intergenic
1032281735 7:130508681-130508703 CTTGCACTCCCCACTGATGCAGG - Intronic
1033556250 7:142490669-142490691 CTCTCACTCCACCCAGAGGCAGG + Intergenic
1034493091 7:151404817-151404839 CTCCCCCACCACCCCAATGCAGG + Intronic
1034990966 7:155548065-155548087 CTCCCAGGCCACCCTGGTCCTGG - Intergenic
1035031135 7:155861396-155861418 CTGCCATGCCACCCTGGTGCTGG - Intergenic
1035953697 8:4052480-4052502 CTCCCACTGCACTCTGACCCTGG - Intronic
1038075354 8:24066978-24067000 CTCCCACTATTCCCTGATGGAGG + Intergenic
1038583783 8:28771775-28771797 CTCCCACCCCAGCCTTGTGCAGG - Intronic
1038741458 8:30220561-30220583 CTCCCACACCACCCTCGTGAGGG - Intergenic
1040311790 8:46240604-46240626 CACCCACGCCACCCTGTGGCCGG - Intergenic
1042142629 8:65694793-65694815 CTCCCACTCAGCCCTCATGATGG - Intronic
1042159220 8:65875114-65875136 TTCCCACTCCATCCTGCTTCTGG - Intergenic
1042708900 8:71693124-71693146 CTCCAACTCCACCCTCAAGATGG - Intergenic
1046766326 8:118074072-118074094 CTCCCACCCCACCCCCATTCCGG - Intronic
1048162596 8:132034805-132034827 CTCCCACTCCTTCCTGATCGTGG + Exonic
1049798641 8:144507702-144507724 CTCCCACTCCACCCAGCCGAAGG - Intergenic
1051231923 9:14963853-14963875 CTCCCTCTCCACCCCGATAAGGG + Intergenic
1053177197 9:35936149-35936171 ATCCCACCCCACCCTGCTGCTGG + Intergenic
1054820870 9:69519193-69519215 TCCCCACCCCACCCTGCTGCTGG - Intronic
1055359362 9:75472993-75473015 CTGCCATTCCACCCTGAGGCAGG - Intergenic
1055776858 9:79775685-79775707 CACCAACTCCAACCTGATGCTGG - Intergenic
1057269724 9:93644014-93644036 CCCCCACTCTGCCCTGCTGCAGG + Intronic
1057575993 9:96243244-96243266 CTCCCACTCCCAGCTGAAGCTGG - Intronic
1060122013 9:121000829-121000851 CTCACCCTCCACCCTCAAGCAGG + Intronic
1060660618 9:125403144-125403166 TTTCCACTGCACCCTGTTGCAGG + Intergenic
1060865211 9:126989819-126989841 CTCGAGCTCCAGCCTGATGCAGG - Intronic
1061192818 9:129091967-129091989 TTCCCACTCCACACTGCAGCCGG - Intergenic
1061782732 9:133005266-133005288 CCCCCATTCCAGCCAGATGCTGG - Intergenic
1186589097 X:10909858-10909880 CTCTCTCTCCACCCTGGGGCTGG + Intergenic
1187469197 X:19553128-19553150 CTCCCACCCCACTGTTATGCTGG - Intronic
1190728208 X:53205982-53206004 CTCACCCTGCACCCTGATGCTGG + Intronic
1198262252 X:134975115-134975137 CCCCCACTCCACCCCCATGGTGG - Intergenic
1199914169 X:152320905-152320927 CTCCAACTCCAACCTGATAAAGG + Intronic