ID: 1091628125

View in Genome Browser
Species Human (GRCh38)
Location 12:2138347-2138369
Sequence CTGTGCTTGCAGATGGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091628118_1091628125 18 Left 1091628118 12:2138306-2138328 CCAGCCTTCACAGGGCTGGGGAG 0: 1
1: 0
2: 4
3: 42
4: 343
Right 1091628125 12:2138347-2138369 CTGTGCTTGCAGATGGATCCTGG 0: 1
1: 0
2: 0
3: 10
4: 166
1091628111_1091628125 30 Left 1091628111 12:2138294-2138316 CCTGTGGCCAGGCCAGCCTTCAC 0: 1
1: 1
2: 5
3: 20
4: 255
Right 1091628125 12:2138347-2138369 CTGTGCTTGCAGATGGATCCTGG 0: 1
1: 0
2: 0
3: 10
4: 166
1091628119_1091628125 14 Left 1091628119 12:2138310-2138332 CCTTCACAGGGCTGGGGAGCACA 0: 1
1: 0
2: 4
3: 19
4: 246
Right 1091628125 12:2138347-2138369 CTGTGCTTGCAGATGGATCCTGG 0: 1
1: 0
2: 0
3: 10
4: 166
1091628114_1091628125 23 Left 1091628114 12:2138301-2138323 CCAGGCCAGCCTTCACAGGGCTG 0: 1
1: 0
2: 3
3: 43
4: 368
Right 1091628125 12:2138347-2138369 CTGTGCTTGCAGATGGATCCTGG 0: 1
1: 0
2: 0
3: 10
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091628125 Original CRISPR CTGTGCTTGCAGATGGATCC TGG Intronic
900922534 1:5682586-5682608 CTGTACTTGCAGACGCAACCTGG - Intergenic
900965349 1:5953558-5953580 GTGTGTTTGCAGATGGTTCAAGG - Intronic
900998071 1:6133640-6133662 CTGTGCTGGCACATGGGTGCAGG - Intronic
905999838 1:42414872-42414894 TTGTGCTTGCTGAGGAATCCCGG - Exonic
906810104 1:48817867-48817889 GTGTGCTTGCAGATGCACCTGGG + Intronic
912569788 1:110613090-110613112 GTGAGCTTCCAGATGGCTCCAGG + Intronic
914339116 1:146743245-146743267 CTCTGCTTGCTGATGGCCCCTGG + Intergenic
915164201 1:153939551-153939573 CTCTGCTTGGAGATGTATCATGG - Intronic
916186552 1:162138967-162138989 CTATACTTGCAGATGCTTCCTGG + Intronic
916896093 1:169163542-169163564 CTTTGCTAGCAAAAGGATCCAGG - Intronic
917717326 1:177751690-177751712 CTGGGCTTTCAGATGGTTGCAGG - Intergenic
918321144 1:183365881-183365903 CTGTGCCTGCAGAGTGATGCTGG - Intronic
922888277 1:229037390-229037412 GTGTCCTTGCAGATGGTCCCAGG + Intergenic
923832819 1:237577189-237577211 GTGTGCTTTCAGTTGTATCCTGG - Intronic
1062988787 10:1795694-1795716 GTGGCCTTGCAGAGGGATCCTGG + Intergenic
1063094637 10:2898830-2898852 CTGTTCTTGGAGGTGGAGCCAGG - Intergenic
1068209940 10:53908393-53908415 ATGTGCATGCAGATGGATTGAGG - Intronic
1069059105 10:63875043-63875065 CAGTGGTTGCAGTGGGATCCTGG - Intergenic
1070459397 10:76649554-76649576 GAGTCCTTGCAGATGGATGCAGG + Intergenic
1071061120 10:81571312-81571334 CTGGGCTTGCATATGGAGCATGG - Intergenic
1071295566 10:84216946-84216968 TTGGGCTTGCAAGTGGATCCGGG + Exonic
1072613511 10:97034780-97034802 CTCTGCTTGCAGAGGGATGGGGG - Intronic
1074052009 10:109888534-109888556 GTGTGCTTCCTGAAGGATCCAGG - Exonic
1074132170 10:110589515-110589537 CAGTGGTTGCAGATGGATGGGGG - Intronic
1074413889 10:113250310-113250332 CTGCGTTTGAAGCTGGATCCAGG - Intergenic
1077421251 11:2451055-2451077 TGGTGCTTCCAGAAGGATCCAGG + Intronic
1077936666 11:6795254-6795276 CTGTGTGTGCAGATGGCTGCTGG - Exonic
1079250875 11:18786663-18786685 CTGTGGCTGCAGATGGAATCTGG + Intronic
1079819961 11:25113768-25113790 CTGTGCTTGCTCATTGATACCGG + Intergenic
1080880525 11:36315975-36315997 CTGTTCATGGAGATGGAGCCTGG + Intronic
1080908989 11:36576020-36576042 CTGTACTGGCAGAGGGATTCTGG - Exonic
1082789100 11:57335286-57335308 CTGTGCTCACGGATGGAGCCAGG + Intronic
1084205037 11:67586250-67586272 CTCTGCTTCCAGATGGACACAGG + Intronic
1084603679 11:70160792-70160814 CTGTGCTTGGGGATGGTGCCTGG + Intronic
1085528816 11:77179723-77179745 CTGTCCTTGCAGATGCGTCTGGG + Exonic
1086938320 11:92768072-92768094 ATGTTCTTGATGATGGATCCTGG - Intronic
1091628125 12:2138347-2138369 CTGTGCTTGCAGATGGATCCTGG + Intronic
1091822823 12:3489408-3489430 CTCTGCTTGCTGATGGACCATGG + Intronic
1092263443 12:6964105-6964127 CTGTACTGGAAGATGGACCCAGG - Intergenic
1096185566 12:49578302-49578324 CTGTGTTTGCAGTAGGCTCCTGG + Intronic
1102005719 12:109588113-109588135 CTCTGGTTCCACATGGATCCGGG - Intronic
1104576124 12:129967346-129967368 CTGTGCCTGGAAAGGGATCCTGG - Intergenic
1104743501 12:131195540-131195562 CTGTGTTTACAGCTGGATCACGG - Intergenic
1104780379 12:131416097-131416119 CTGTGATTCAAGATGGCTCCAGG - Intergenic
1104790832 12:131481144-131481166 CTGTGTTTACAGCTGGATCACGG + Intergenic
1106907617 13:34425097-34425119 TGGTTCTTGCAGCTGGATCCTGG + Intergenic
1108912896 13:55578108-55578130 CTGTGCTTGCATATGCCACCTGG + Intergenic
1111330311 13:86757503-86757525 CTGAGCTGGCAGACGGTTCCAGG - Intergenic
1112443231 13:99440301-99440323 CTGTGCATTCAGATTGTTCCTGG - Intergenic
1113246433 13:108401879-108401901 CTGTACTTGCAGATGCAGTCAGG - Intergenic
1114530228 14:23390764-23390786 CTGTGGTTGAAGGGGGATCCTGG + Intronic
1115993763 14:39175030-39175052 CTGCGCTAGCAGCGGGATCCAGG + Intergenic
1118114439 14:62759451-62759473 CTGTGCTTACAGAAGGATATTGG + Intronic
1118322341 14:64760472-64760494 CTTTGCTTGTAAATGCATCCGGG - Intronic
1119559261 14:75577776-75577798 CTGTCCTTGGCGAGGGATCCTGG - Intergenic
1121052984 14:90831406-90831428 CTGTGCTGGCAGATGCCTGCTGG - Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122810543 14:104285550-104285572 CTGTCATTGCAGATGAAGCCTGG - Intergenic
1123936052 15:25194589-25194611 GCGTGCTTGGAGAAGGATCCTGG + Intergenic
1131175556 15:90207234-90207256 ATGGGCTTCCAGATGGATCCAGG - Intronic
1134067861 16:11240823-11240845 CTGGGCTTCCAGATGCAGCCTGG - Intergenic
1135208005 16:20499217-20499239 CAGTGCTTGCACATGGAACATGG + Intergenic
1135210894 16:20524483-20524505 CAGTGCTTGCACATGGAACATGG - Intergenic
1135634241 16:24060526-24060548 CTGTGCTGAGAGAGGGATCCTGG - Intronic
1136265871 16:29117834-29117856 CGGTCCCTGCAGATGGACCCAGG + Intergenic
1139199088 16:64954512-64954534 CTGTGCTTCCAGAAGGCTCAGGG + Intronic
1139709349 16:68763915-68763937 TTGTCCTTGCAGTGGGATCCAGG - Intronic
1139995162 16:70974107-70974129 CTCTGCTTGCTGATGGCCCCTGG - Intronic
1140520464 16:75576576-75576598 CAGAGCTTGCATAGGGATCCAGG + Intronic
1140912078 16:79463204-79463226 AAGTGGTTGCAGATGGGTCCGGG + Intergenic
1141908619 16:87043526-87043548 CTGTGGGTGCAGCTGAATCCTGG - Intergenic
1142998437 17:3775293-3775315 GTATGTTTCCAGATGGATCCAGG + Intronic
1143565326 17:7717309-7717331 CCGTGGGTGCAGCTGGATCCGGG - Intergenic
1144361490 17:14498785-14498807 CTTTGCTTGCAGATAAATTCTGG + Intergenic
1144607201 17:16677401-16677423 CTGTGAGTGCAGATGGCTCAGGG + Intergenic
1144667738 17:17113107-17113129 CTGCCCTTGCAGACGGCTCCTGG + Intronic
1146822393 17:35994104-35994126 CTGTGCTTGTAGCTTTATCCTGG - Intronic
1147442652 17:40456865-40456887 GTGTGTTTCCAGATCGATCCTGG + Exonic
1147700853 17:42393882-42393904 CTGTGCTTGAATTTGAATCCTGG - Intergenic
1148216794 17:45837719-45837741 CTGGGCAGGCAGATGGAGCCTGG + Intergenic
1151321477 17:73355074-73355096 CTGTCCTTGCAGAAGGCTCCGGG + Intronic
1152116893 17:78393535-78393557 CTGTGTTTGGAGATGATTCCCGG - Intronic
1153245791 18:3071879-3071901 CTATGCTTGCAGATCGTGCCCGG - Exonic
1153633418 18:7093531-7093553 CTGTGCTTGCAGGTGGATTTTGG - Intronic
1153777847 18:8469412-8469434 CAGTTCTTGCAGATAGAACCCGG - Intergenic
1154094745 18:11402199-11402221 CTTGGCTTGCTGTTGGATCCTGG + Intergenic
1158803801 18:60945593-60945615 CTGTGGTTGCAGATGAAACATGG + Intergenic
1158806706 18:60982541-60982563 CTGTTCTTTCAGATGCTTCCTGG + Intergenic
1160014564 18:75130662-75130684 CTCTGATGGCAGAGGGATCCCGG + Intergenic
1160511114 18:79454077-79454099 CTGCTCTTGCAGATGGAACCAGG + Intronic
1161079852 19:2305340-2305362 CTGTCCTTAGATATGGATCCTGG + Intronic
1162793949 19:13077149-13077171 CTGTGTCTGCAGCTGGCTCCTGG + Intronic
1164540555 19:29118678-29118700 CTGTGTTTGCAGGAGAATCCAGG + Intergenic
1165136449 19:33672929-33672951 CTGTGGTTGAGGATGGACCCAGG + Intronic
1166831679 19:45643255-45643277 CTGTCCTTGCAGCTGGCTCTAGG - Intronic
1167676033 19:50886556-50886578 CTGTGATTGGAGATGGAGACAGG - Intergenic
1202647029 1_KI270706v1_random:152533-152555 CTGTGGCTGCAGATGGCCCCTGG - Intergenic
925953711 2:8939725-8939747 ATGTGCTTGAAGATTGCTCCAGG - Intronic
926476513 2:13329228-13329250 CTGTGCTCTCAGAAGGGTCCAGG + Intergenic
927832099 2:26360649-26360671 CTGTGCTTTAAGATGGATGGTGG + Intronic
930022026 2:47007466-47007488 ATGAGCTTGCAGATTGTTCCAGG + Intronic
934118946 2:88822155-88822177 CAGTGCCTGCAGAGGGGTCCCGG + Intergenic
935524102 2:104144493-104144515 CTGTGCTTGAAGAAGTATCAAGG - Intergenic
935698159 2:105787521-105787543 CTCTGCTGGCACTTGGATCCTGG + Intronic
938307093 2:130263780-130263802 GTGTGCTTGCAGCTGCAGCCCGG - Intergenic
940834196 2:158502231-158502253 CTGTTCTTGATGATGGTTCCTGG + Intronic
945053267 2:205846107-205846129 CTTTTCTTGTAGATGGCTCCAGG - Intergenic
945485076 2:210385724-210385746 CTGAGCCTCCAGATGGATGCAGG - Intergenic
946816369 2:223582500-223582522 CTGTGCTTGTTAGTGGATCCTGG + Intergenic
948004246 2:234594174-234594196 CTGTTCTTCCTAATGGATCCTGG + Intergenic
948290082 2:236818170-236818192 CTGTCCTGGCAGATGGGACCGGG + Intergenic
948542201 2:238699034-238699056 CTGTGCTTCCAGAAGGGCCCTGG - Intergenic
948784289 2:240343393-240343415 CTGGGCTTTCAGATGGCTCCTGG + Intergenic
1170762710 20:19264875-19264897 CTGAGCTTCCAGAGGGATCCTGG + Intronic
1172782607 20:37446177-37446199 CTGTGCATGCAGAGGGATGGGGG - Intergenic
1174146013 20:48453173-48453195 ATGTCCTTGCAGTTGGAACCTGG - Intergenic
1175728166 20:61333604-61333626 CTGTCCTTGCAGGTGGCTCTGGG - Intronic
1181096612 22:20509303-20509325 CTGTCCCTGGAGATGGATGCAGG + Intronic
1181857350 22:25791530-25791552 TTGTGATTTCAGATGTATCCTGG - Intronic
1182576302 22:31275375-31275397 CTGTGCTTGCAGAGGGCTCAGGG - Intronic
1184610377 22:45599448-45599470 CTCTGCTTGCAGGAGGATCCAGG + Intronic
1185119698 22:48958595-48958617 CTGGGCAGGCTGATGGATCCAGG + Intergenic
1185168318 22:49275996-49276018 CTCAGCTTGCAGATGGCTCATGG - Intergenic
950768144 3:15289412-15289434 TTGTGGTTGAAGATGGCTCCAGG - Intronic
950924300 3:16724966-16724988 CTTTACTTGGAGATGGTTCCTGG - Intergenic
952748947 3:36808537-36808559 CTGTGGTTGAAGGTGGATACAGG + Intergenic
954975728 3:54692429-54692451 CTGTGCCTGCAGAGGGAGCAGGG + Intronic
963913198 3:150832621-150832643 CTGTCGTAGCAGAGGGATCCGGG + Intergenic
965733014 3:171792422-171792444 CTGGGAATGCAGATGGATCAGGG + Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
968519947 4:1030711-1030733 CTGTGCTGGCAGCTGCATGCTGG + Intergenic
969259294 4:6023439-6023461 GTCTGCTTAGAGATGGATCCTGG + Intergenic
971042231 4:22766567-22766589 TTGTGTTAGCAGATGGAGCCTGG - Intergenic
982635818 4:157895463-157895485 CTCTGCTTGCAGGTTGTTCCAGG - Intergenic
983400217 4:167254224-167254246 CTTTGCTTGCAGGTGGATGTGGG - Intergenic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
990871140 5:60431800-60431822 CTGGGATTGCAGATGGAGTCTGG - Intronic
993598410 5:89888654-89888676 CTCTGCTTGCAGCTTGATCTTGG + Intergenic
994758066 5:103818862-103818884 CTTGGCTTGCAGATGGCTGCTGG - Intergenic
999684426 5:154089484-154089506 CAGGGCTAGCAGAGGGATCCAGG - Intronic
1001198852 5:169697880-169697902 CTGTGATTCCAGAGGTATCCTGG - Intronic
1001409485 5:171500359-171500381 CTGTTCAAGCAGATAGATCCAGG - Intergenic
1001592995 5:172879125-172879147 CTGTTCTTGCAGACGAATCTCGG - Intronic
1005758138 6:28943876-28943898 CTCAGCTCCCAGATGGATCCTGG + Exonic
1010521400 6:76842630-76842652 CTGTGCCTGGAATTGGATCCAGG + Intergenic
1014158215 6:118136689-118136711 GAGTGCTTGCAGATGTATTCTGG + Intronic
1015549569 6:134398029-134398051 CTGATATTACAGATGGATCCAGG + Intergenic
1018786978 6:167116151-167116173 CTCTTCTTGCAGTTGGACCCTGG - Intergenic
1018868767 6:167765605-167765627 CTGGGCTCGAAGATGGATTCAGG + Intergenic
1019134486 6:169899673-169899695 CTCAACTTGCAGATGGACCCTGG + Intergenic
1019648582 7:2144075-2144097 ATGTGTTTGCAGGTGGCTCCTGG - Intronic
1019866270 7:3713128-3713150 GTGTGCTGGCAGAGGGTTCCTGG - Intronic
1023162712 7:37312734-37312756 CTGTGCTAGTAGATGGCCCCTGG - Intronic
1026807301 7:73436309-73436331 CTGTGCTTCCAAATGGAGACAGG + Intergenic
1027144316 7:75683498-75683520 CTGTGTGTGCAGATGCACCCTGG + Intronic
1029133501 7:98351435-98351457 CTTTGCTAGCAGCTGGGTCCTGG + Intronic
1030096510 7:105905394-105905416 CTGTGTGTGCACATGGAGCCTGG - Intronic
1033158741 7:138979050-138979072 CTGTGTTTCCAGCTGGATCCTGG + Intronic
1033521421 7:142164851-142164873 CTTTGCTTGTAGATGGTTCTGGG - Intronic
1034401093 7:150862035-150862057 CTGTGTTTACAGGTGGATCTTGG - Intergenic
1043115532 8:76249075-76249097 ATGTACTTGCAGATGGCTACAGG + Intergenic
1047457361 8:125028245-125028267 CTGTGCTTGCTGTGGGAACCAGG + Intronic
1048505185 8:135014593-135014615 CTGGTCTTGCAGGGGGATCCTGG - Intergenic
1049456975 8:142697994-142698016 TTGGGCTTGCAGATGGTTCTTGG - Intergenic
1051616638 9:19013096-19013118 CTGGCCTTCCAGATAGATCCTGG + Intronic
1058114218 9:101066650-101066672 GAGTGCTTTCAGTTGGATCCTGG + Intronic
1060279037 9:122203736-122203758 CTCTACTTAGAGATGGATCCAGG + Exonic
1060334694 9:122711057-122711079 CTGGGATTGCAGATGGAGTCTGG + Intergenic
1062481923 9:136756484-136756506 CTGTGATGGCAGGTGGAACCCGG - Intronic
1062730437 9:138105422-138105444 CTGTGCTTTCAGAGGGATCAAGG + Intronic
1186944175 X:14546629-14546651 CTGGGTTTGCAAATGGCTCCTGG + Intronic
1190062818 X:47221973-47221995 CTGTGAGTCCAGATGGTTCCTGG + Intronic
1190692595 X:52923968-52923990 CTGGGCTTGCAGCAGCATCCAGG + Intergenic
1192202553 X:69076046-69076068 CTGTGCATCAAGATGGTTCCAGG + Intergenic
1197868922 X:131047284-131047306 TTCTGCATGCAGATGGACCCTGG - Intergenic
1198483386 X:137061865-137061887 CAGTGCCTGCAGGTGGAACCTGG - Intergenic
1202054374 Y:20814543-20814565 CTGTGCTTCCAGGTGTTTCCAGG - Intergenic