ID: 1091628665

View in Genome Browser
Species Human (GRCh38)
Location 12:2141656-2141678
Sequence GCTGCGAGGTTCCAGAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091628654_1091628665 30 Left 1091628654 12:2141603-2141625 CCCATAAGGGATGCAAGCTCCGT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1091628665 12:2141656-2141678 GCTGCGAGGTTCCAGAAGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1091628655_1091628665 29 Left 1091628655 12:2141604-2141626 CCATAAGGGATGCAAGCTCCGTA 0: 1
1: 0
2: 1
3: 1
4: 37
Right 1091628665 12:2141656-2141678 GCTGCGAGGTTCCAGAAGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1091628662_1091628665 -9 Left 1091628662 12:2141642-2141664 CCTCGCTGATGGGGGCTGCGAGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1091628665 12:2141656-2141678 GCTGCGAGGTTCCAGAAGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1091628657_1091628665 11 Left 1091628657 12:2141622-2141644 CCGTAACGAGCACTCAGGCTCCT 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1091628665 12:2141656-2141678 GCTGCGAGGTTCCAGAAGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091628665 Original CRISPR GCTGCGAGGTTCCAGAAGGT TGG Intronic
900977966 1:6028886-6028908 GCTCAAAGGTTCCAGAAGGCTGG - Intronic
901236482 1:7670060-7670082 CCTGGGAGGTTCCTGAGGGTGGG + Intronic
912525985 1:110283001-110283023 GCTGGGAGGTTCAAGAAGCATGG + Intronic
913169921 1:116222501-116222523 GCTGTGGGCTTCCAGAGGGTAGG - Intergenic
915545270 1:156593555-156593577 GGTGCTGGGATCCAGAAGGTGGG + Exonic
915553268 1:156647184-156647206 GCAGGGAGGTTCCAGAGGGAGGG + Intronic
921955091 1:220974007-220974029 GCTGGGAGGATGCAGAAGGCTGG + Intergenic
922032484 1:221815052-221815074 GCTGAGAGAGTCCTGAAGGTAGG + Intergenic
923114557 1:230922817-230922839 GCTGTGAGCTTTCAGCAGGTGGG + Intronic
924824633 1:247526488-247526510 GCTCCCAGTTTCCAGAAGGATGG - Intronic
1068529874 10:58173707-58173729 GCTGGGAGTTACCAGAAGCTAGG + Intergenic
1070757488 10:79002443-79002465 GCTAAGAGGTTCCTGAAGGGTGG - Intergenic
1075106233 10:119542091-119542113 GCCGCGAGGAGCCAAAAGGTGGG - Intronic
1076676626 10:132150284-132150306 GCTGAGAGATCCCAGAAGCTGGG - Intronic
1078098495 11:8314849-8314871 GCAGAGAGGCTCCAGGAGGTTGG - Intergenic
1079240701 11:18720534-18720556 GCTGTGAGCTCCCAGAAGGCAGG + Intronic
1081808111 11:45900947-45900969 GCTGCGAATTCCCAGAAGGCAGG + Intronic
1085553460 11:77397318-77397340 ACTGTGAGGTTTCAAAAGGTAGG + Intronic
1086116521 11:83257226-83257248 GATGCAAGGGTCCAGAGGGTGGG + Intronic
1091628665 12:2141656-2141678 GCTGCGAGGTTCCAGAAGGTTGG + Intronic
1093789825 12:23235711-23235733 GCTCAGAGGTTCCAATAGGTAGG - Intergenic
1096226943 12:49872151-49872173 GCTGCGAGCTTCCCCAAGGCAGG - Intronic
1098868126 12:75785207-75785229 GATGCCAGGTGCAAGAAGGTGGG - Intergenic
1099755521 12:86842980-86843002 GCTGCAATGTTCAATAAGGTAGG - Intergenic
1109460415 13:62649276-62649298 GATTAGAGGTGCCAGAAGGTCGG + Intergenic
1110878022 13:80534892-80534914 GCTGCAGGGTTCAAGATGGTGGG - Intergenic
1111007945 13:82274635-82274657 GCTGGGAAGTTCAAGAAGGGTGG + Intergenic
1111341670 13:86894742-86894764 GCTGGAAGCTTCCAGAAGCTAGG - Intergenic
1118620313 14:67609060-67609082 GGTGGGAAGTTCCAGAAGCTCGG - Intergenic
1121224154 14:92308938-92308960 GCGGGGAGGATCCAGAAGGCAGG + Intergenic
1121731813 14:96192682-96192704 GCTGAGACGTTCTAGAAGGTGGG + Intergenic
1127271962 15:57409569-57409591 GCTGAGAGGTTTCAGGAGGCAGG + Intronic
1127453004 15:59134739-59134761 GATGGCAAGTTCCAGAAGGTGGG + Exonic
1128110624 15:65073969-65073991 GCTGCGAGGCTCCAGATCCTGGG - Intronic
1129454767 15:75670741-75670763 GCAGCCAGATTACAGAAGGTGGG + Intergenic
1132356298 15:101173815-101173837 GCAGCTTGCTTCCAGAAGGTGGG - Intergenic
1133207527 16:4242249-4242271 GCTGCCAGGCCCCAGAAGGCAGG + Intergenic
1137474351 16:48794093-48794115 GCTGGCAGGTGCCAGAAGATAGG - Intergenic
1137785612 16:51135002-51135024 GGTCCGGCGTTCCAGAAGGTGGG - Intergenic
1139663982 16:68443213-68443235 GCTGCAAGACTCCAGAAGGTGGG - Intronic
1145962756 17:28897197-28897219 GCCGCGGGGTTCCAGGAGGGAGG - Intronic
1146273305 17:31498421-31498443 GATGGGAGGTACCAGAAGATGGG + Intronic
1146942653 17:36854732-36854754 GCTGCCTGTTTCCAGGAGGTTGG + Intergenic
1151062587 17:71113305-71113327 CCTGCTAGGATCCAGAAGGAAGG - Intergenic
1166975857 19:46604638-46604660 ACGGAGAGGTTCCAGAAGCTAGG - Intronic
1167292891 19:48634464-48634486 GCTCTAAGGTTCCAGAAGATTGG + Intronic
1167613260 19:50517453-50517475 CCTGCGTGGTCCCAGAAGGTGGG + Exonic
925005505 2:440209-440231 GTTGCGCGGTTCAAGAATGTTGG + Intergenic
925183204 2:1830344-1830366 GCTGTGAGGATTAAGAAGGTTGG + Intronic
935816670 2:106852490-106852512 CCTGTAAGGTTCCCGAAGGTGGG + Intronic
942547589 2:177080811-177080833 GCTGAGAGGTTGGGGAAGGTGGG - Intergenic
945872507 2:215243289-215243311 ACAGTGAGGTTGCAGAAGGTAGG - Intergenic
946326371 2:218986521-218986543 ACTGCAAGGCTGCAGAAGGTGGG - Intergenic
1169303307 20:4465624-4465646 GCTTCAAGGATCCAGAAAGTGGG + Intergenic
1169697971 20:8412369-8412391 ACTGTGGGGTTCCAGAGGGTGGG + Intronic
1169717500 20:8636948-8636970 GCTGCCAGGCATCAGAAGGTAGG - Intronic
1170574145 20:17649857-17649879 ACTGCCAGGCTCCAGAATGTGGG + Intronic
1172542793 20:35734181-35734203 GTTTCAAGATTCCAGAAGGTGGG - Intronic
1176195341 20:63834290-63834312 TCTGGGAGGGTCCAGAGGGTGGG + Intergenic
1182252367 22:29011289-29011311 GCTGCGGGGGTCCAGCAGGCTGG + Intronic
1183622318 22:38981823-38981845 CCTCCCAGCTTCCAGAAGGTGGG - Intronic
1183627484 22:39013722-39013744 CCTCCCAGCTTCCAGAAGGTGGG - Intergenic
951284408 3:20791257-20791279 GCTGCCAGGTACCAAGAGGTAGG - Intergenic
952140065 3:30468338-30468360 GCTGGGAGTTACCAGAAAGTAGG - Intergenic
952870493 3:37896149-37896171 GCTGCAAGTTTCCAGAAGGCAGG - Intronic
953831072 3:46297913-46297935 GCTGTGAGATTCTAGAAGGTGGG - Intergenic
959554330 3:107699282-107699304 GCAGCCAGGTTCCAGGAGGTGGG + Intronic
962840375 3:139227226-139227248 GCTACCAGGATCCAGATGGTGGG + Intronic
966620235 3:181955313-181955335 GCTTCGAGCTTCTAGAATGTGGG + Intergenic
976621759 4:87135485-87135507 AATTCAAGGTTCCAGAAGGTAGG - Intronic
978361565 4:107936022-107936044 GCTGAAAAGTTCCAGAATGTAGG + Intronic
985775497 5:1839516-1839538 ACTGCGTGGTTCTAGAAGGCCGG - Intergenic
990702773 5:58492910-58492932 GCTCTGAGGTTCTCGAAGGTTGG - Intronic
991660867 5:68949587-68949609 GCTGCAAGCTTCCTGAAGGACGG + Intergenic
992195843 5:74338124-74338146 GCTGCTATTTTCCTGAAGGTTGG + Intergenic
992726483 5:79612536-79612558 GCTGCAAGGATATAGAAGGTTGG - Exonic
999180613 5:149667572-149667594 ACTGTGAGGTTCCTGAAGGAAGG + Intergenic
1001293578 5:170483555-170483577 GCCGCAAGGTTCCAGATGGTTGG + Intronic
1002908888 6:1473186-1473208 GCTGAGTGGGTCCAGAAGGCAGG - Intergenic
1003974837 6:11332670-11332692 CCTGTGAGATTCCAGAAGCTGGG + Intronic
1006435781 6:34025559-34025581 GCTCACAGGTTCCAGAAGCTGGG + Intronic
1006953838 6:37849152-37849174 GCTGCAGGGGGCCAGAAGGTTGG + Intronic
1010560450 6:77342103-77342125 GCTGGGAGGTTGCAGCAGGATGG - Intergenic
1016801758 6:148175928-148175950 GCTGTAAGCTTCCAGAAGGCAGG - Intergenic
1018724822 6:166603734-166603756 ATTGCGAGGTTGCAGAAGGGAGG + Intronic
1019670626 7:2276236-2276258 GCTGCCAGGCCCCAGAAGGAAGG + Intronic
1022487479 7:30790941-30790963 GCTCTGAGGTTCCAGCAGGCGGG + Intronic
1029445111 7:100607584-100607606 GATGGGAGGTTCCAGATGGCAGG - Intronic
1032651369 7:133882474-133882496 TCTGTGAGATTCCAGAAGGGAGG - Intronic
1036793579 8:11739923-11739945 GCTGCGAGGGTCCAGGAGCAAGG - Intronic
1039611412 8:38922256-38922278 GCTGGGAGGTCCTAGAAGGTAGG + Intronic
1040816416 8:51512729-51512751 CCAGCGAGGGTCAAGAAGGTTGG - Intronic
1045325624 8:101115695-101115717 GCAGAGAGGCTCCAGAAGGAAGG + Intergenic
1049436044 8:142586742-142586764 TCTGTGAGGTTCCAGTTGGTGGG - Intergenic
1051690840 9:19710495-19710517 GCTGAGAAGTTCCAGACAGTGGG + Intronic
1056690847 9:88807572-88807594 CCTGCCTGGTTCCAGAAGGCTGG - Intergenic
1061963849 9:134002396-134002418 ATTGCGAGGTGCCAGGAGGTGGG + Intergenic
1190434278 X:50408167-50408189 TCTCCTGGGTTCCAGAAGGTGGG + Intronic
1193635407 X:83944054-83944076 GATACAAGGATCCAGAAGGTAGG + Intergenic