ID: 1091630581

View in Genome Browser
Species Human (GRCh38)
Location 12:2157486-2157508
Sequence GACAGCACTCTGAGAGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 287}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091630581_1091630586 15 Left 1091630581 12:2157486-2157508 CCACTTGCTCTCAGAGTGCTGTC 0: 1
1: 0
2: 2
3: 19
4: 287
Right 1091630586 12:2157524-2157546 CTCTAGGCAGAAGATCTGCGTGG 0: 1
1: 1
2: 0
3: 13
4: 93
1091630581_1091630583 -1 Left 1091630581 12:2157486-2157508 CCACTTGCTCTCAGAGTGCTGTC 0: 1
1: 0
2: 2
3: 19
4: 287
Right 1091630583 12:2157508-2157530 CCCATAAGCCTGTACTCTCTAGG 0: 1
1: 0
2: 0
3: 8
4: 106
1091630581_1091630587 25 Left 1091630581 12:2157486-2157508 CCACTTGCTCTCAGAGTGCTGTC 0: 1
1: 0
2: 2
3: 19
4: 287
Right 1091630587 12:2157534-2157556 AAGATCTGCGTGGCTTTCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091630581 Original CRISPR GACAGCACTCTGAGAGCAAG TGG (reversed) Intronic
900733749 1:4281270-4281292 GACAGGACTATGAGGTCAAGTGG - Intergenic
901619115 1:10567743-10567765 GTCAGCACTTTGAGAGGATGAGG - Intronic
902355093 1:15892272-15892294 CCCAGCACTCTGAGAGGCAGAGG - Intronic
902931771 1:19736486-19736508 GGCAGGACTCTGAAGGCAAGAGG - Intronic
903454595 1:23478508-23478530 GCCAGCACTTTGAGAGGACGAGG + Intronic
903753327 1:25643755-25643777 CCCAGCACTCTGAGAGGCAGAGG - Intronic
903986321 1:27231916-27231938 GACAGCACTTTGGGAGGCAGAGG + Intergenic
904411201 1:30325962-30325984 GAAAGAACTCTGACTGCAAGGGG - Intergenic
904664947 1:32113138-32113160 GCCAGCACTTTGAGAGGATGAGG + Intronic
905182492 1:36175826-36175848 GTCAGCCCTCTGACAGCAGGAGG + Intronic
905903246 1:41596222-41596244 GACTGCCCTCTGAAAGCAGGTGG + Intronic
906657851 1:47561656-47561678 GACAGGACTGTGTGAGCAACAGG + Intergenic
907210524 1:52817634-52817656 GCCAGCACTTTGGGAGGAAGAGG - Intronic
907676717 1:56524461-56524483 GGCAGCACTCTATAAGCAAGTGG - Exonic
907769390 1:57444803-57444825 GACAGAATTCTGAAATCAAGGGG - Intronic
907835910 1:58108105-58108127 GACTTCATTCTGAGAGCAAGGGG + Intronic
908057128 1:60299773-60299795 GAGAGGAGGCTGAGAGCAAGGGG - Intergenic
911232241 1:95373611-95373633 AACAGCATTCAGTGAGCAAGAGG + Intergenic
911381599 1:97121632-97121654 AAAAGCACCCTGAAAGCAAGAGG - Intronic
911616576 1:100018728-100018750 CCCAGCACTCTGAGAGGCAGAGG - Intronic
912518486 1:110230216-110230238 CACTTCATTCTGAGAGCAAGTGG - Intronic
913410097 1:118542043-118542065 GACAGCACTCCCAGAGGGAGGGG + Intergenic
913413040 1:118573839-118573861 CACAGCAGTCTGAGATCAAACGG - Intergenic
913436521 1:118852741-118852763 CACAGCAGTCTGAGATCAAACGG + Intergenic
914992044 1:152507199-152507221 GCCAGCACTCAGTGAGCATGAGG - Intergenic
916810054 1:168297560-168297582 CCCAGCACTCTGAGAGGCAGAGG - Intronic
917032687 1:170711695-170711717 GACAGCAGTCTCAGTGCAAAGGG + Intronic
918035986 1:180872431-180872453 CACAGCAGTCTGAGATCAAACGG - Intronic
919447724 1:197730046-197730068 GACTACACTTTGAGAGCCAGAGG + Intronic
920377992 1:205519557-205519579 GACAGGAGCCTGAGAGGAAGTGG - Intronic
922374389 1:224946227-224946249 CACAGCAGTCTGAGATCAAAGGG - Intronic
922826695 1:228526421-228526443 CACAGCAGTCTGAGATCAAACGG - Intergenic
922919932 1:229293731-229293753 GACAGCACGCTGAGATAGAGGGG + Intronic
923764222 1:236878132-236878154 GACAGCACTAAGATAGCAAAAGG - Intronic
1064282910 10:13967793-13967815 GCCAGCACTCTGGGAGGATGGGG + Intronic
1065170159 10:23018995-23019017 GACAGCCCTCTGGGAGGCAGTGG - Intronic
1066228409 10:33407550-33407572 GTCAGCACTCTGAGAGAATGAGG - Intergenic
1066357916 10:34702639-34702661 GCTGGCATTCTGAGAGCAAGTGG - Intronic
1068824100 10:61413769-61413791 GACAGCAATATGGGACCAAGAGG - Intronic
1069340605 10:67403838-67403860 GACAGAGCTCTGAGAGGAAGGGG + Intronic
1070733813 10:78849983-78850005 GAGAGCATTCTGAGAGGAGGAGG - Intergenic
1071525194 10:86354304-86354326 GACAGGACCCAGAGACCAAGAGG + Intronic
1073875858 10:107920614-107920636 GACAGAACTCTCAGAGCGAGAGG + Intergenic
1073908057 10:108307243-108307265 GACAGCCCACAAAGAGCAAGAGG + Intergenic
1074675011 10:115838379-115838401 CACAGCACACTGACAGCAACAGG + Intronic
1075993370 10:126857064-126857086 GCCAGAAGTCTGAAAGCAAGAGG + Intergenic
1077101896 11:826121-826143 GACAGGACCTTGAGACCAAGGGG - Intergenic
1077872569 11:6274398-6274420 GACAGAACTCTGGGTCCAAGGGG + Intergenic
1078063966 11:8065945-8065967 GATATGACTCTGAGGGCAAGAGG - Intronic
1078193942 11:9119198-9119220 GACAACACTTTGAGAGCTAATGG - Intronic
1078793591 11:14569615-14569637 CACAGCAGTCTGAGATCAAACGG + Intronic
1078862506 11:15262853-15262875 TACAGCACTCTGAGAAACAGAGG + Intergenic
1078910561 11:15727319-15727341 AACAGCAGTCTGAGATCATGGGG - Intergenic
1079393284 11:20040591-20040613 GCCAGTCTTCTGAGAGCAAGAGG - Intronic
1080081384 11:28222287-28222309 CACAGCAGTCTGAGATCAAACGG - Intronic
1081421882 11:42880427-42880449 GACAGAAGTCAGAGAGAAAGAGG + Intergenic
1081848827 11:46260719-46260741 GTTGGCCCTCTGAGAGCAAGAGG + Intergenic
1082161067 11:48888511-48888533 GAGAGCACTTTGAAAGCTAGAGG - Intergenic
1083951288 11:65957870-65957892 GAGAGCACTCTAGCAGCAAGAGG - Intronic
1084893884 11:72251226-72251248 GTCAGCACTTTGGGACCAAGAGG - Intergenic
1085853760 11:80152396-80152418 GGCAGAACACGGAGAGCAAGGGG - Intergenic
1086801673 11:91183957-91183979 GACAGCACTCCCAGAGAGAGGGG - Intergenic
1088572081 11:111232050-111232072 GGCAGGAATCTGAGATCAAGTGG - Intergenic
1090336758 11:125973800-125973822 GAAAGCCCTCTGTAAGCAAGTGG - Intronic
1090366278 11:126209239-126209261 CACAGCACTTTGAGAGGCAGAGG - Intronic
1091478554 12:801800-801822 GACAGAACTCTGGGAGTAAGTGG + Intronic
1091605879 12:1951019-1951041 CCCAGCACTCTGAGAGCCCGAGG + Intronic
1091630581 12:2157486-2157508 GACAGCACTCTGAGAGCAAGTGG - Intronic
1092003863 12:5052509-5052531 GAAAGCACAATGAGAGGAAGGGG - Intergenic
1093252373 12:16822361-16822383 CCCAGCACTCTGGGAGCATGAGG - Intergenic
1093835961 12:23829022-23829044 GTCAGAACTCTGGGAGCAGGTGG + Intronic
1094865968 12:34530355-34530377 GACAGGGCTTTGAGAGCAACTGG - Intergenic
1096124643 12:49110396-49110418 GACGGCACTCTGAGACCAGGTGG + Intronic
1096332564 12:50726860-50726882 GCCAGCACTCTGAGAGGCTGAGG + Intronic
1096545184 12:52333709-52333731 CACAGCCCTCTCAGAGAAAGTGG + Intergenic
1099240138 12:80128774-80128796 CACAGCAGTCTGAGATCAAACGG - Intergenic
1100660918 12:96697930-96697952 GGCAGAACTCAGGGAGCAAGGGG - Intronic
1101629278 12:106477478-106477500 CACAGCAGTCTGAGATCAAACGG - Intronic
1102566866 12:113802793-113802815 GAAAGCACCCTGAGAGCTCGGGG - Intergenic
1103604266 12:122075576-122075598 GCCAGCACTCTGGGAGAAAGCGG - Intergenic
1103733286 12:123042682-123042704 GGAAGCTCTCTTAGAGCAAGAGG - Intronic
1104427849 12:128692903-128692925 GACAGCAATCTGCCAGAAAGGGG + Intronic
1105284757 13:18994902-18994924 GACAGAACACTGAAAGGAAGAGG + Intergenic
1107043897 13:35975557-35975579 GCCAGAACTCTGGTAGCAAGTGG - Intronic
1107950406 13:45456316-45456338 AACAGCACTCTGTCAGCAAATGG + Intergenic
1108128259 13:47268733-47268755 GTCAGAACTCTGAAGGCAAGAGG - Intergenic
1110278955 13:73670478-73670500 GACAACACTTTGAGAGCAAGAGG - Intergenic
1110541719 13:76713650-76713672 GACAGCACTCTGATGGAGAGTGG + Intergenic
1110721945 13:78772016-78772038 GGCAGCAGTGTGAGAGCAAAAGG + Intergenic
1111616206 13:90664374-90664396 CACAGCAGTCTGAGATCAAAGGG + Intergenic
1112304441 13:98261046-98261068 GACAGCTCTATGGGAGGAAGGGG + Intronic
1115241121 14:31251901-31251923 GACAGGACTATGACAGCAACAGG + Intergenic
1115304986 14:31924322-31924344 GACAGCACCCTGAGTGAAAAAGG - Intergenic
1115975243 14:38990063-38990085 GACATCCCTCTGAGAGCACAGGG - Intergenic
1116843290 14:49841322-49841344 CACAGCACTCTGAGAGGCCGAGG + Intronic
1118444567 14:65839716-65839738 CACAGCCCTCTCAGAGAAAGGGG - Intergenic
1120805953 14:88750858-88750880 CACAGTATTCTGATAGCAAGAGG - Intronic
1122748924 14:103918694-103918716 GACAGCCCTCTGGGGGCAGGTGG - Intronic
1125786358 15:42321923-42321945 TAGAGCACACTGAGGGCAAGAGG + Exonic
1127228135 15:56957051-56957073 GACAACAGACAGAGAGCAAGAGG - Intronic
1128068562 15:64779287-64779309 GAAGGCACTCTGAGAGCACAGGG - Intergenic
1131253443 15:90845780-90845802 CACAGAACCCTGTGAGCAAGGGG + Intergenic
1131338096 15:91570005-91570027 GAGAGCACTCTGGGAGCACGTGG - Intergenic
1133693128 16:8235491-8235513 TTCAGCACTGTGAGAGCAAGAGG + Intergenic
1135164084 16:20123582-20123604 CCCAGCACTCTGAGAGGCAGAGG + Intergenic
1135473373 16:22751914-22751936 GAAAGAACTCTGGGAACAAGTGG + Intergenic
1137326029 16:47438089-47438111 CACAGCAGTCTGAGATCAAACGG + Intronic
1137458179 16:48634200-48634222 GACAGCACTTTGAGAGGCTGAGG + Intergenic
1138250181 16:55496230-55496252 GACTGCACTTTGAGAACCAGTGG + Intronic
1139165283 16:64558415-64558437 CACAGCACTTTGAGAGGCAGAGG + Intergenic
1142960114 17:3547368-3547390 CCCAGCACTTTGAGAGCTAGAGG + Intronic
1143138458 17:4725940-4725962 GACAGCAATCTGAGCACAGGTGG - Intergenic
1143602928 17:7960937-7960959 GACAGAAGACTGAGAGAAAGGGG - Intergenic
1144431860 17:15199330-15199352 GACAGAGCTCTGAGAGGAAGGGG + Intergenic
1145060524 17:19730341-19730363 CACAGCACTCTGAGAGGCTGAGG + Intergenic
1146700762 17:34957478-34957500 AACAGCACTGTGAGTGGAAGAGG + Intronic
1146798174 17:35797621-35797643 GGAAGCTCTCTAAGAGCAAGGGG + Intronic
1147017014 17:37500015-37500037 GACTGCACTGTGAGGGCAACTGG - Intronic
1148244782 17:46023587-46023609 GGCAGCACTCTGAGAGGCTGAGG + Intronic
1150110612 17:62495914-62495936 CACAGCACTTTGAGAGGCAGAGG - Intronic
1150592631 17:66577118-66577140 CCCAGCACTCTGAGAGGCAGAGG - Intronic
1151437012 17:74104057-74104079 GACTGCACTCTGAGAACCAGTGG - Intergenic
1152761263 17:82108168-82108190 TGGAGCACTCGGAGAGCAAGTGG + Intronic
1152778814 17:82217508-82217530 GACAGCAGCCTGTGAGCAGGAGG + Intergenic
1153553029 18:6282522-6282544 GCCAGCACTGTGGGAGCAGGAGG + Intronic
1159348587 18:67239995-67240017 GACAGCACTTTGAGAGGCTGAGG - Intergenic
1162497539 19:11031772-11031794 ACAAGCACTCTGAGAGAAAGAGG - Intronic
1163307218 19:16488197-16488219 CCCAGCACTCTGGGAGCCAGAGG - Intronic
1165301621 19:34973390-34973412 GACAGCATTTTGACAGAAAGGGG - Intergenic
1166893041 19:46006311-46006333 GACAGCACTCAGAGAGTCACAGG + Intronic
1167380551 19:49135743-49135765 GAAAGCAGTCAGAGACCAAGGGG - Intronic
1167568890 19:50274676-50274698 TCCAGCACTCTGAGAGTAGGAGG + Intronic
1167660737 19:50794616-50794638 GACAGAACTCTCAAAGCAAGGGG + Intronic
925327021 2:3030939-3030961 CACAGCAGTCTGAGATCAAACGG + Intergenic
925665474 2:6250751-6250773 GACAGCACTTTGAGAGACCGAGG + Intergenic
928405381 2:31010670-31010692 GACAGCATTCTGAGTGCAGTGGG - Intronic
929266775 2:39927252-39927274 GAAATCACTCTGAGTGAAAGAGG - Intergenic
930845662 2:55900829-55900851 GATAGCACTCTGAGGAAAAGAGG - Intronic
931071868 2:58660539-58660561 TACAGCACTTTGAGAGGCAGAGG + Intergenic
931969288 2:67567819-67567841 GTGAGCAGCCTGAGAGCAAGAGG - Intergenic
935270808 2:101432801-101432823 CACAGGCCTCGGAGAGCAAGTGG - Intronic
936751285 2:115645039-115645061 GACAGCACTGTAAGACCAAAGGG - Intronic
936938798 2:117861897-117861919 GAGAGAGCTCTGAGAGGAAGAGG + Intergenic
937105813 2:119311627-119311649 GACAGCACTCTGAAAGCAGCTGG - Exonic
937212885 2:120288433-120288455 GCCAGCACTCTGGGAGCCTGAGG - Intronic
937744039 2:125389534-125389556 TACAGCACTCTGGGAGGCAGAGG + Intergenic
938614948 2:132988112-132988134 CCCAGCATTCTAAGAGCAAGAGG + Intronic
938993292 2:136651687-136651709 CCCAGCACTCTGAGAACAATTGG - Intergenic
939332080 2:140777275-140777297 GTCAGCCCTCTGTGAGCTAGGGG - Intronic
940132680 2:150401445-150401467 CTCAGCACTCTGGGAGCCAGAGG + Intergenic
940573668 2:155472231-155472253 CACAGCAGTCTGAGATCAAAAGG - Intergenic
941413073 2:165184817-165184839 GACAACACACTGAGAGCAAGAGG - Intronic
941714496 2:168749461-168749483 GACAGCTCTCAGTGAGCATGTGG - Intronic
941992777 2:171573157-171573179 GCCAGAACTCTGAAATCAAGAGG - Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
943611997 2:190045087-190045109 GACAGCACTCTTAGAGGGAGGGG - Intronic
944519066 2:200545340-200545362 GACACCATTCAGAGAGCAAAGGG - Intronic
945209812 2:207370755-207370777 GACAGCACTTTGAGAGAAGGAGG - Intergenic
945920200 2:215748075-215748097 CACAGCACTCTGGGAGGATGAGG - Intergenic
945990987 2:216395151-216395173 GCCAGAAATCTGAGATCAAGGGG - Intergenic
946449949 2:219771346-219771368 CCCAGCACTTTGAGAGCAAGAGG - Intergenic
947758800 2:232588379-232588401 GACATCACTCGGAGATAAAGTGG - Intergenic
947798581 2:232910635-232910657 TGCACCACTCTGAGAGCTAGTGG - Intronic
948727599 2:239944446-239944468 GACAGCACTGTGAGGGGAGGTGG - Intronic
1169067462 20:2702036-2702058 GACTGCAGCCTGAGGGCAAGGGG + Intronic
1169144254 20:3242080-3242102 GGCAGCACCCGGAGGGCAAGGGG - Intergenic
1170516368 20:17134423-17134445 CAGGGCACTCTGAGAGAAAGTGG - Intergenic
1171364423 20:24613957-24613979 GAGAGCACTCTGATCGCCAGCGG + Intronic
1171763368 20:29233480-29233502 CACAGCAGTCTGAGATCAAACGG - Intergenic
1172137572 20:32697556-32697578 GGCAGCACTGTGAGCCCAAGGGG + Intergenic
1172267442 20:33628717-33628739 CACAGCACTCTGAGAGGCTGAGG - Intronic
1173399548 20:42712121-42712143 GAGGGCATTCTGACAGCAAGAGG + Intronic
1174046558 20:47737992-47738014 GACAGCACTTTGGGAGGCAGAGG - Intronic
1175819953 20:61903839-61903861 GACAGCATTTTGGGAGCAGGAGG - Intronic
1175924787 20:62466344-62466366 GTCCGCACTCTCAGACCAAGAGG - Intronic
1176031438 20:63014928-63014950 GGCAGGACTCTGAGAGGGAGAGG - Intergenic
1176155269 20:63616802-63616824 TACAGGACCCTGAGAGCTAGGGG + Intronic
1176278115 20:64286037-64286059 GCCACCACACTGTGAGCAAGAGG + Intronic
1177883539 21:26721926-26721948 GACAGCACCATGGAAGCAAGAGG + Intergenic
1178827054 21:36025765-36025787 CCCAGCACTCTGAGAGGCAGAGG - Intergenic
1178881493 21:36453726-36453748 GACAACCCTCTGAGTGGAAGCGG - Intergenic
1178997664 21:37419772-37419794 GAAACCACTTGGAGAGCAAGAGG + Intronic
1179109476 21:38434012-38434034 GAGAGCACTCTGGTAGCAGGAGG - Intronic
1179278605 21:39914328-39914350 CCCAGCACTTTGGGAGCAAGTGG + Intronic
1179559641 21:42206705-42206727 GACAGCACTTTGAGAGGCTGAGG - Intronic
1180130266 21:45822571-45822593 GACAGGATTAGGAGAGCAAGGGG + Intronic
1180218767 21:46344601-46344623 GGAAGTACTCTGTGAGCAAGTGG + Intronic
1181438537 22:22924051-22924073 AACTGCTCTCTGAGAGGAAGGGG + Intergenic
1182594907 22:31411765-31411787 GACAGCACTCTGGGAGACTGAGG - Intronic
1183664142 22:39237694-39237716 GACAGAACTCTCAGGGGAAGCGG - Intronic
1184437161 22:44486201-44486223 GACAGCTCTCGGAGAGCCACAGG + Intergenic
1184749297 22:46475339-46475361 GACATCACACTGAGTGAAAGAGG + Intronic
1184819403 22:46898192-46898214 GTCCACACTCTGAGACCAAGAGG - Intronic
949356126 3:3182396-3182418 GAAAGCACTGTGAGAGCTAAGGG - Intergenic
952115412 3:30174192-30174214 CACAGCACTCTGAGTCCCAGTGG - Intergenic
952266794 3:31794704-31794726 GTCAGGACTCTGAGGGCAGGGGG + Intronic
954627938 3:52032920-52032942 GACAGGGCTCTGAGCCCAAGTGG + Intergenic
954983147 3:54764343-54764365 GACAGCACTGTGAGTCCACGGGG + Exonic
955002342 3:54938998-54939020 GACAGCAAACTGGGACCAAGAGG + Intronic
955215725 3:56983685-56983707 GCCAGCACTTTGGGAGCCAGAGG + Intronic
956527817 3:70184359-70184381 AAAAGCACTCTAAGATCAAGTGG - Intergenic
957203096 3:77163084-77163106 CCCAGCACTCTGGGAGGAAGAGG - Intronic
960260168 3:115558505-115558527 GATAGCAGTCTGAGAGGAAGGGG + Intergenic
960611981 3:119562965-119562987 GACAGCATTTTAAGAGGAAGAGG - Intergenic
960918718 3:122724553-122724575 CCCAGCACTCTGAGAGACAGAGG - Intronic
963658057 3:148084834-148084856 AACACCCCTCTGAGACCAAGGGG - Intergenic
965256014 3:166412154-166412176 CACAGCACTTTGAGAGCCTGAGG - Intergenic
965938452 3:174145262-174145284 CACAGCACTTTGAGAGGCAGAGG + Intronic
966062173 3:175771498-175771520 GCCAGAAGTCTGAGATCAAGAGG + Intronic
966935760 3:184707815-184707837 GCCAGCACTCTGAGAACACTGGG + Intergenic
967206628 3:187128952-187128974 TACAGCTCTCTGCAAGCAAGAGG - Intronic
967278351 3:187798514-187798536 GACTTCCCTCTGAGAGCAAAAGG - Intergenic
967310366 3:188100356-188100378 CTCAGCACTCTGGGAGGAAGAGG + Intergenic
968023129 3:195413496-195413518 GACAGCACTTTGAGAGGCTGAGG + Intronic
968495255 4:911676-911698 TACAGAGCTCTGTGAGCAAGAGG + Exonic
971316703 4:25573670-25573692 GACAGAACTTCAAGAGCAAGAGG + Intergenic
971935153 4:33138307-33138329 GGCCCCACTCTGAGAGAAAGGGG - Intergenic
973679161 4:53298352-53298374 CACAGCAGTCTGAGATCAAACGG + Intronic
973782935 4:54306542-54306564 GACAGCACTTTGGGAGCCCGAGG - Intergenic
974427576 4:61760392-61760414 AACAGCAGTCTGAGATCAAACGG - Intronic
978023886 4:103848431-103848453 GACAGGGCTTTGAGAGCAACCGG + Intergenic
980457048 4:133058247-133058269 GACTGCACTCTGAGGTCATGAGG + Intergenic
980553216 4:134367582-134367604 AACAGCACTCTGAAAGCCAATGG + Intergenic
982624647 4:157751096-157751118 CCCAGCACTCTGAGAGGCAGAGG + Intergenic
982916332 4:161214260-161214282 GACAGCAGTCTAACACCAAGGGG - Intergenic
984226339 4:177039857-177039879 AAGAGCACTCTAAAAGCAAGAGG + Intergenic
987394972 5:17414274-17414296 CACAGGACACTGAGAGCGAGAGG - Intergenic
990884436 5:60575699-60575721 CACAGCAGTCTGAGATCAAACGG - Intergenic
992021139 5:72625317-72625339 GACAGCCATCTGGGAGGAAGGGG - Intergenic
996964423 5:129290959-129290981 CACAGCAGTCTGAGATCAAACGG - Intergenic
997395354 5:133555539-133555561 GAAAGCTCTTTGAGAGCAAAAGG + Intronic
997625273 5:135327016-135327038 GACGGCGCTCTCACAGCAAGGGG - Intronic
998903971 5:146883811-146883833 TACAACACTTTGAGGGCAAGAGG - Intronic
999592886 5:153168103-153168125 TACAGCACTTTGAGAACCAGTGG + Intergenic
1000587902 5:163122564-163122586 CACAGCAGTCTGAGATCAAACGG - Intergenic
1000858790 5:166431863-166431885 GACAGCCCTCTTAAAGAAAGGGG - Intergenic
1002056369 5:176599943-176599965 CACAGCACTCAGTGAGGAAGGGG - Intronic
1002560118 5:180075658-180075680 GCCAGCAATCAGAGACCAAGCGG + Intergenic
1002754789 6:148566-148588 GCCACCACACTGTGAGCAAGAGG - Intergenic
1004350880 6:14889304-14889326 CACAGCACTCTGAGAGGCTGAGG - Intergenic
1004361893 6:14978568-14978590 GTCAGCACTTTGAGAGGACGAGG - Intergenic
1007326955 6:41069676-41069698 AATAGCACACTGATAGCAAGGGG - Intronic
1007835215 6:44668655-44668677 GCCAGGACTCTGAGAGCAGTGGG - Intergenic
1008074547 6:47132155-47132177 GACAGCACTCACAGAGAAGGTGG - Intergenic
1008470104 6:51875140-51875162 CACAGCAGTCTGAGATCAAACGG + Intronic
1009938307 6:70259689-70259711 GACATGAATCTGAGAGCCAGTGG - Intronic
1010102977 6:72131704-72131726 GACAGGGCTTTGAGAGCAACTGG + Intronic
1010589027 6:77691447-77691469 GACAGAACTTTGAGGGCCAGAGG - Intronic
1010983593 6:82397015-82397037 GAGAGCACAGTGAGAGCATGAGG - Intergenic
1011296811 6:85835104-85835126 CACAGCAGTCTGAGATCAAATGG - Intergenic
1011704039 6:89983416-89983438 TACAGCACTCTGGGAGGCAGAGG + Intronic
1014238768 6:118991576-118991598 GAAAGCAAGCTGGGAGCAAGTGG + Intronic
1015197131 6:130536534-130536556 GACAGCACTCCCAGAGGGAGGGG + Intergenic
1018556492 6:165056488-165056510 GTCAGCACTTTGAGAGGATGAGG + Intergenic
1018902708 6:168059314-168059336 GTCACCGCACTGAGAGCAAGGGG - Intronic
1021582109 7:22167017-22167039 GACATCTGTCTGAGAGGAAGTGG + Intronic
1022149498 7:27586690-27586712 GACAGCACTCTTAGAAAAGGAGG + Intronic
1022370416 7:29765749-29765771 GACAGCACTCTGTGAGCTGGAGG + Intergenic
1024022278 7:45383115-45383137 CACAGCAGTCTGAGATCAAACGG - Intergenic
1024092184 7:45953014-45953036 CACAGCAGTCTGAGATCAAATGG - Intergenic
1024305943 7:47929661-47929683 GACCCCACTCTGAGAACCAGTGG - Intronic
1024375813 7:48636787-48636809 GACAGCACCCTGGCAGCCAGGGG - Intronic
1025874728 7:65470222-65470244 CACAGCAGTCTGAGATCAAACGG - Intergenic
1026651342 7:72218196-72218218 GCCAGCACTTTGAGAGGACGAGG + Intronic
1032039803 7:128549814-128549836 CACAGCACTTTGAGAGGCAGAGG - Intergenic
1032553460 7:132807063-132807085 GTCAGTGCTCTGATAGCAAGAGG + Intronic
1032854599 7:135823967-135823989 TACAGCACCCTGAGAGAAGGAGG + Intergenic
1034265368 7:149778048-149778070 GAGAGCACTGGGAGAGCAAGAGG + Intergenic
1036096676 8:5732642-5732664 AGCAGCACTCTTAGAGCATGTGG + Intergenic
1037217878 8:16479949-16479971 CCCAGCACTTTGAGAGGAAGAGG - Intronic
1038103662 8:24409275-24409297 GCCAGCACTTTGAGAGGCAGAGG + Intergenic
1038703088 8:29869289-29869311 GTCAGCAAACTGAGAGCAGGAGG + Intergenic
1039704582 8:39993757-39993779 CCCAGCACACTGAGAGGAAGAGG + Intronic
1039869826 8:41536500-41536522 GTCAGCACACTGAGAGCTTGTGG + Intronic
1039903657 8:41770589-41770611 CACAGCACTCTGAGTGTAATGGG + Intronic
1040584638 8:48727455-48727477 GACAGGGCTCTGTGAGGAAGTGG + Intronic
1041245790 8:55887202-55887224 CCCAGCACTCTGGGAGCATGAGG + Intronic
1044202953 8:89457927-89457949 CACAGCAGTCTGAGATCAAACGG + Intergenic
1044419915 8:91982408-91982430 GACAACATTCTGAGAGAAAAAGG + Intronic
1045442941 8:102232984-102233006 GATGGCACTCTAAGAGCAAATGG + Intronic
1047460539 8:125060234-125060256 CCCAGCACTCTGAGAGCCCGAGG + Intronic
1047819847 8:128506863-128506885 GACAGAACACTGAAAACAAGAGG + Intergenic
1051666151 9:19468492-19468514 GTCAGCACACTTAGAGCCAGAGG - Intergenic
1052151108 9:25116673-25116695 GACAGCACTTTGGGAGAAGGAGG - Intergenic
1052371640 9:27672017-27672039 CAATGCACTCAGAGAGCAAGTGG + Intergenic
1052702878 9:31959677-31959699 GACAGCACCCTCAGAGGGAGGGG + Intergenic
1052775598 9:32729408-32729430 CACAGCAGTCTGAGATCAAACGG + Intergenic
1053454933 9:38226770-38226792 GACAGCCCCCTGAGAGCTATTGG + Intergenic
1055058770 9:72047646-72047668 CCCAGCACTCTGAGAGGCAGAGG - Intergenic
1056127974 9:83555253-83555275 GACAGCACTCCCAGAGAGAGGGG - Intergenic
1057081944 9:92179839-92179861 GAGAGCACACTGAGAGGGAGGGG + Intergenic
1057324716 9:94050947-94050969 CACAGCAGTCTGAGATCAAACGG - Intronic
1058837235 9:108869028-108869050 GCCAGCCCTCAAAGAGCAAGGGG + Exonic
1059030957 9:110695516-110695538 GACAGCCCTCTCAGGGTAAGTGG + Exonic
1060781621 9:126417178-126417200 GACAGCAGTCAGAGAGCAGCAGG - Intronic
1060969908 9:127732018-127732040 GACACCACTCAGAGAGTCAGAGG + Exonic
1061521297 9:131119836-131119858 GACACCACTCTCAGAGCAGTGGG + Intronic
1185575675 X:1170333-1170355 CCCAGCACTTTGAGAGGAAGGGG - Intergenic
1185758778 X:2673436-2673458 AGCAGCAGTCTGAGATCAAGGGG - Intergenic
1190240124 X:48651605-48651627 CCCAGCACTCTGAGAGGCAGAGG + Intergenic
1190616310 X:52236600-52236622 GACAGCGTTTTGAGAGCAACTGG - Intergenic
1191976871 X:66882309-66882331 GGCAGCAATCTGATAGCATGCGG + Intergenic
1196596913 X:117556071-117556093 CACAGCAGTCTGAGATCAAATGG + Intergenic
1196615511 X:117762916-117762938 CACAGCAGTCTGAGATCAAACGG - Intergenic
1199849867 X:151717833-151717855 CTCAGCACTCTGAGAGGAGGAGG + Intronic
1200414291 Y:2891716-2891738 CCCAGCACTTTGAGAGGAAGGGG + Intronic
1201013447 Y:9573540-9573562 CACAGCAGTCTGAGATCAAACGG - Intergenic
1201393596 Y:13524406-13524428 CACAGCAGTCTGAGATCAAACGG + Intergenic
1201684296 Y:16683597-16683619 GACAGCAGTCTGAGATCGAACGG + Intergenic