ID: 1091631998

View in Genome Browser
Species Human (GRCh38)
Location 12:2169046-2169068
Sequence TGTGTCATGCTGAAGGCGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091631998_1091632000 10 Left 1091631998 12:2169046-2169068 CCGCTCGCCTTCAGCATGACACA 0: 1
1: 0
2: 1
3: 8
4: 105
Right 1091632000 12:2169079-2169101 CTTTGCCTCGTTAAGAGCTCAGG 0: 1
1: 0
2: 1
3: 5
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091631998 Original CRISPR TGTGTCATGCTGAAGGCGAG CGG (reversed) Intronic
901154022 1:7123574-7123596 TGTGCCTGGGTGAAGGCGAGCGG - Intronic
901163015 1:7194663-7194685 TGTGGCAAGCTGAAAGGGAGAGG + Intronic
903028900 1:20448808-20448830 GGTGTCATCCTGGGGGCGAGAGG + Intergenic
904163118 1:28535891-28535913 TGTGTGATGCTGAAATCCAGGGG + Exonic
918155914 1:181846456-181846478 TGTGTCACGATGAAGGCAAGTGG + Intergenic
920146136 1:203862555-203862577 TGTTTCATCCTAAAGGGGAGAGG - Intronic
921926007 1:220710583-220710605 TGTGCCTTGCTGAAGCAGAGAGG + Intergenic
923652108 1:235883677-235883699 TGTGTCACCAGGAAGGCGAGTGG + Intergenic
1063826494 10:9904373-9904395 TGTGTGATTCTGAAGGGGAGAGG - Intergenic
1065470623 10:26077525-26077547 AGTGTTATGTTGAAGACGAGTGG + Intronic
1065654924 10:27938637-27938659 TGTCTCAGGCTGAAGTCCAGTGG + Intronic
1072281005 10:93865417-93865439 TGTGTCATGCCAAAGAAGAGAGG + Intergenic
1073517612 10:104091299-104091321 AGTGTCATTCTGAGGGTGAGGGG + Intergenic
1082726471 11:56743061-56743083 TGTGTCTTCCTGAAGCTGAGTGG + Exonic
1086420448 11:86632755-86632777 TGAGTGATACTGAAGGCCAGTGG + Intronic
1086829130 11:91537531-91537553 ATTCTCATGCTGAAGGGGAGGGG + Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1090387923 11:126367246-126367268 GGTGGCATGCAGAAGGGGAGGGG - Intronic
1090390562 11:126384692-126384714 GGTGGCATGCAGAAGGGGAGGGG - Intronic
1090937954 11:131361959-131361981 TGTGTCATGCTGAAGAATAATGG - Intergenic
1091631998 12:2169046-2169068 TGTGTCATGCTGAAGGCGAGCGG - Intronic
1092897946 12:13031856-13031878 TGTGTGATGCAGGAGGGGAGGGG - Intergenic
1092964640 12:13629831-13629853 TGTGTCATTCAGAAGACCAGGGG - Intronic
1094725489 12:33110377-33110399 TGTGTAATGCTGAGGGAAAGAGG + Intergenic
1096563281 12:52452109-52452131 TGTGAGAGGCTGGAGGCGAGAGG + Exonic
1096770887 12:53935221-53935243 TGTGTCTTTTTGAAGTCGAGGGG - Intergenic
1097351568 12:58554813-58554835 TGTGTCCAGGTGAAGGCAAGGGG - Intronic
1102192496 12:110999192-110999214 TGTCTCACCCTGCAGGCGAGGGG - Intergenic
1104261886 12:127191929-127191951 TGTATGATGCTGAATGAGAGAGG - Intergenic
1106217412 13:27715522-27715544 AGTGACCTGCTGAAGGGGAGAGG + Intergenic
1116569712 14:46499857-46499879 TCTGTCATGCTGAGGGGGAGGGG + Intergenic
1120911427 14:89670269-89670291 TGTGTCAGGCTGGAGCCCAGTGG - Intergenic
1122111363 14:99505319-99505341 TGTGCCATGCCGAAGGCTACTGG + Exonic
1126429341 15:48564213-48564235 TGTGTGATGATGAAGGTGATGGG - Intronic
1127488240 15:59438418-59438440 TGTGACATGCCGCGGGCGAGAGG + Intronic
1128150834 15:65362619-65362641 TCAGTCATTCTGAAGGGGAGAGG - Intronic
1130952586 15:88604584-88604606 GACGTCATCCTGAAGGCGAGCGG - Intergenic
1136087525 16:27896148-27896170 TGGGGCATGCTGGAGGCGTGCGG + Intronic
1138358785 16:56408428-56408450 TGAGTCCTGTTGAAGGTGAGAGG - Intronic
1138891541 16:61149779-61149801 TGTGGCATGCTGGAGGTGTGAGG + Intergenic
1141727581 16:85799841-85799863 TGCTTCCTGCTGAAGCCGAGCGG - Exonic
1145289834 17:21534390-21534412 TGTGTCATGCAGAAAGGGAAAGG - Exonic
1146444879 17:32925818-32925840 TGTGGCATCCTGATGGCCAGGGG - Intergenic
1146497305 17:33334561-33334583 TGTGTCATCCTCAAGTTGAGAGG + Intronic
1147725078 17:42562027-42562049 TGTGTCCTGCTGATGGGGTGGGG - Intronic
1148856084 17:50580029-50580051 TGTGTGATGGTGATGGGGAGGGG - Intronic
1149396772 17:56253389-56253411 TGAGCCATTCTGAAGGCCAGTGG + Intronic
1150144027 17:62752978-62753000 AATGTCATGCTGGAGGCGACGGG - Intronic
1155178430 18:23321955-23321977 TATGGCAGGCTGGAGGCGAGAGG + Intronic
1155359131 18:24982591-24982613 TGTGTCTTTCTGAAGGCCACTGG + Intergenic
1158374719 18:56849965-56849987 TGTGTCATGGTGAATGTGAAGGG - Intronic
1159077396 18:63696839-63696861 AGTGTCATGCTGAGTGAGAGAGG - Intronic
1161473349 19:4472336-4472358 TGTGGCATGCTGACGGCGAGAGG - Exonic
1161692090 19:5741769-5741791 TTTGGGATGCTGAAGGCGGGGGG + Intronic
1166891846 19:45998909-45998931 TGTGCCATGCTTAAGGTGTGAGG + Intronic
1168313178 19:55471927-55471949 TGTGATATGGTGAAGGCAAGGGG - Intergenic
925674705 2:6349875-6349897 AGTGTAATGCTGGAGGAGAGAGG + Intergenic
925928479 2:8687180-8687202 GGTGTCAAGCTGAAGGGGATTGG - Intergenic
926349861 2:11984763-11984785 TGTCTCAGGCAGAAGGGGAGGGG + Intergenic
928000908 2:27522415-27522437 AGTGTCAGGCTAAAGGCCAGAGG - Intronic
936613769 2:114027611-114027633 TGTGTCATGCTGGAAGAGTGGGG - Intergenic
937311734 2:120906978-120907000 TGTGTGATGCTGCAGACAAGGGG - Intronic
937581802 2:123496957-123496979 TGTGTCATGATAAAGGAGAAAGG + Intergenic
941669696 2:168279384-168279406 TGTTTCATGATAAAGGCAAGTGG + Intergenic
948246520 2:236490365-236490387 TGTGCCATGTTGAAGGGTAGTGG - Intronic
1170029617 20:11931384-11931406 TGGATCATGCTGGAGGCCAGAGG + Intergenic
1171151488 20:22830235-22830257 AGTGTGATGCTGAAGAGGAGTGG - Intergenic
1181690055 22:24554424-24554446 CCTGTCCTGCTGAAGGCGCGGGG - Intronic
1181734423 22:24870535-24870557 TGTGGCTTGATGAAGGCCAGTGG + Intronic
1182873429 22:33668974-33668996 TGTTTCATGCAGAAGGACAGAGG - Intronic
1183510701 22:38233014-38233036 TGTGTCCTGAGGAAGGCGAGAGG - Intronic
1183664329 22:39238719-39238741 TGTGTGATGCTGAGGGCCAGTGG - Intronic
955081601 3:55662898-55662920 TGAGACATGCTGAATGAGAGAGG + Intronic
960914244 3:122680757-122680779 TGTGTTAGGCTGAAGGCAAAAGG + Exonic
966185415 3:177222645-177222667 TCTGGCATGCAGAAGGCAAGAGG + Intergenic
968805506 4:2769080-2769102 GGTTTCATGCTGAAGGTGGGAGG + Intergenic
974242000 4:59261216-59261238 TATCTCATGCTGGAGGCTAGAGG - Intergenic
980320515 4:131266966-131266988 TGTCTCATACTGATGGCCAGTGG - Intergenic
980463648 4:133148735-133148757 TGTGTCAATCTAAAGGTGAGGGG - Intergenic
986171570 5:5318698-5318720 TGTGGCTTGAGGAAGGCGAGTGG + Intronic
986550312 5:8946645-8946667 TGAGACATGCTAAATGCGAGTGG - Intergenic
990211090 5:53481954-53481976 AGTGCCATGCAGACGGCGAGGGG - Intronic
994681080 5:102888387-102888409 TTAGTCATGCTGAATGAGAGGGG - Intronic
995298091 5:110542802-110542824 TCTGCCATGCAGAAAGCGAGGGG - Intronic
996108931 5:119541914-119541936 AGTGGCAGGCTGAAGGCCAGAGG + Exonic
996873726 5:128218259-128218281 TGTGGCATGCTAGAGGAGAGTGG - Intergenic
998920758 5:147065351-147065373 TGTGTAGTGCTGGAGGTGAGGGG + Intronic
999706025 5:154273011-154273033 TGGGGAATGCTGAGGGCGAGGGG + Intronic
1000517933 5:162262618-162262640 TGGGTCTTGCTGAAGGCCCGTGG - Intergenic
1001977950 5:176015778-176015800 TCTGGGATGCTGAAGGCGGGAGG - Intronic
1002239469 5:177827984-177828006 TCTGGGATGCTGAAGGCGGGAGG + Intergenic
1003470405 6:6424645-6424667 TGTGTCATGGAGAAAGCCAGTGG - Intergenic
1004580139 6:16942683-16942705 TCTGTCATGCTCAAGGCCTGAGG + Intergenic
1004913108 6:20306112-20306134 TGTGTGATGCTGAGAGTGAGGGG - Intergenic
1005218931 6:23563872-23563894 TGTGGCATGCTGAAGGAAACAGG + Intergenic
1005814319 6:29538598-29538620 TGAGTCATACGGGAGGCGAGTGG - Intergenic
1006517252 6:34551868-34551890 TGAGTCATGCTGACGGGGCGGGG + Intronic
1013084663 6:106846291-106846313 TGGGTCATGGTGGAGGCAAGGGG - Intergenic
1016136791 6:140554386-140554408 TGGGTCATGCTCAAGGCCTGTGG + Intergenic
1017875974 6:158524561-158524583 TGTGTCATACAGGAGACGAGAGG + Intergenic
1021855667 7:24852887-24852909 TGTGGGATGCTGATGGCGGGGGG + Intronic
1028193204 7:87876046-87876068 TCTGGGAAGCTGAAGGCGAGGGG - Intronic
1028989886 7:97037288-97037310 TGTGCAATGGTGAAGGGGAGTGG + Intergenic
1036642787 8:10594465-10594487 TGGGTCATGCTGAGGGACAGAGG + Intergenic
1044822696 8:96166187-96166209 TGTTTCATGGTGTAGGCCAGAGG - Intergenic
1049871031 8:144976635-144976657 TCTGTGATGCTGAATGAGAGAGG + Intergenic
1050644212 9:7701981-7702003 TGGGTCTTGCTGAAGGCCCGAGG + Intergenic
1051938607 9:22475314-22475336 TATGTTATGCTGAAGGTGAGAGG - Intergenic
1056194919 9:84219782-84219804 TGTGTCATGGTGCAGACCAGGGG + Intergenic
1061487890 9:130929522-130929544 GGGGTCTTGCTGGAGGCGAGGGG - Intronic
1185863853 X:3604995-3605017 TGTGTCTTGGTGAAGGTGAGGGG - Exonic
1188282520 X:28287681-28287703 TGTGTCATGCTTTAGGCCAATGG + Intergenic
1192298746 X:69878698-69878720 TGTGTCTTGGTGAAGGTGAGGGG - Intronic
1195004467 X:100672310-100672332 TGAGTAAAGCTGAAGGAGAGAGG - Intergenic
1196788737 X:119445128-119445150 TGTGTGATGCTGAAGCCCACAGG + Intronic