ID: 1091632478

View in Genome Browser
Species Human (GRCh38)
Location 12:2172346-2172368
Sequence CTGGTGATGTGACAAGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 8, 3: 51, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091632478 Original CRISPR CTGGTGATGTGACAAGAGTC TGG (reversed) Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
901733342 1:11296266-11296288 CTGGTGAAGTGGAAAGAGTTTGG + Intergenic
902661735 1:17909063-17909085 CTGGTCATGTGACCTGGGTCTGG - Intergenic
903023224 1:20409106-20409128 CTGGAGAAGTGACAAGACACAGG - Intergenic
903887231 1:26547565-26547587 CTGTTGATGCTAGAAGAGTCTGG + Intronic
906060175 1:42943419-42943441 CTGGTGTGGTGCCAAGAGTCAGG - Intronic
906410230 1:45573152-45573174 CTGTTCATGTGACAAGAACCTGG - Intergenic
909273492 1:73654670-73654692 CTGGTGGTTTGATAAGTGTCTGG + Intergenic
909927788 1:81458897-81458919 CTGGTGGCGGGACAAGAATCCGG - Intronic
910592310 1:88939419-88939441 CTGCTGATGTAAGAAGAGTCTGG + Intronic
910631825 1:89363287-89363309 CTGCTGATCTGACAGGAGGCAGG - Intergenic
911299761 1:96157630-96157652 CTGGTCATGTGACAAGAACCTGG - Intergenic
911448493 1:98032896-98032918 CTGGTGAAGAGACAACAGTAAGG + Intergenic
911734853 1:101325871-101325893 CTGGTCGTGTGACAAGAACCTGG - Intergenic
912672825 1:111647142-111647164 CTAGTGATCTGATAAGAGGCGGG - Intronic
913239960 1:116821387-116821409 CTGCTGATCTGACAGGAGGCGGG - Intergenic
914771810 1:150693646-150693668 CTGGTTATATCACAAGACTCAGG + Intronic
917211475 1:172636316-172636338 CTGCTTGTGTGACAAGAATCCGG - Intergenic
917556522 1:176096110-176096132 CTAGTTGTGTGACAAGAGCCTGG + Intronic
918269457 1:182883020-182883042 CAGGTTATGTGAAAAGAGTGAGG + Intronic
922041627 1:221903495-221903517 CTGGTCATAAGACAAGAATCTGG - Intergenic
922597197 1:226823163-226823185 CTGGTGAGTTTACCAGAGTCTGG + Intergenic
923412619 1:233725229-233725251 CTGGTCGTGTGACAAGAACCTGG - Intergenic
923414245 1:233739249-233739271 CTGGTCGTGTGACAAGAGCCTGG + Intergenic
924699684 1:246438898-246438920 CTGCTGATCTGACAGGAGACAGG + Intronic
1063978359 10:11434728-11434750 CTGGTCGTGTGCCAAGAGCCTGG - Intergenic
1065044046 10:21729624-21729646 CTGGTGAGGTGACAAGAGCTGGG - Intronic
1065488112 10:26254394-26254416 CTGCTGATCTGACAGGAGGCGGG + Intronic
1066967354 10:42281596-42281618 CTGGTGGTATGACAAGAACCTGG + Intergenic
1068417745 10:56745874-56745896 CTGGTTCTGTGACAAGAACCCGG + Intergenic
1069244810 10:66191056-66191078 AGTGTGATGTGACAAGAGGCAGG + Intronic
1070406263 10:76100233-76100255 CTGATCATGTGACAAGAACCTGG - Intronic
1070714337 10:78708257-78708279 CTGAGGCTGTGATAAGAGTCTGG + Intergenic
1071050682 10:81444642-81444664 CTGGTCATGTGACAAGAACCTGG + Intergenic
1072448155 10:95517346-95517368 CAGGGGATGGCACAAGAGTCGGG + Intronic
1072693024 10:97584054-97584076 CTGGAGATGTGAGAAGGGGCAGG - Intergenic
1073558129 10:104473231-104473253 CTGGTCATGAGACAAGAACCTGG - Intergenic
1074009866 10:109467251-109467273 CTGGTCATGAGACAAGAGCCTGG + Intergenic
1075012386 10:118885835-118885857 ATGGTTATGTGACTAGATTCTGG - Intergenic
1075158045 10:119996804-119996826 CTGGTGATGTGACAAAAACAAGG - Intergenic
1075609024 10:123836650-123836672 CAGGGGATGTGACAGGATTCGGG - Intronic
1076241315 10:128910181-128910203 CTGGTGGTTTGATAAGTGTCTGG + Intergenic
1076675682 10:132146431-132146453 CAGGTGATGTGGCATGAGGCAGG + Intronic
1078494258 11:11800229-11800251 ATGGTGATGTGATAGGTGTCGGG + Intergenic
1078736978 11:14029431-14029453 CTGATCATGTGACAAGAGCCCGG - Intronic
1079718130 11:23774402-23774424 CTGCTGATATGACAGGAGGCAGG + Intergenic
1080161640 11:29183766-29183788 CTGGTCATGTGACACAATTCTGG + Intergenic
1081544760 11:44062881-44062903 CTGGTGGTGTGACAAGAACCCGG + Intergenic
1083793677 11:65002155-65002177 CTGGGGAGGTGACCAGAGCCCGG - Intergenic
1084579121 11:70011475-70011497 TGGGTGATGTGAAAAGATTCTGG - Intergenic
1086458902 11:86986021-86986043 CTGGTCGTGTGACAAGAACCTGG + Intergenic
1087120022 11:94564045-94564067 CTGGTCATGTGACAAGAACTCGG - Intronic
1088559339 11:111097124-111097146 CTGGTCATGTGACAAGAGCCCGG - Intergenic
1089312227 11:117566204-117566226 CTGGTCCTGTGACAGAAGTCAGG + Intronic
1089833467 11:121349419-121349441 CTGCTGATCTGACAAGAGGCGGG - Intergenic
1090508837 11:127349663-127349685 ATGTTGATGTGACAAGAGGGTGG + Intergenic
1091632478 12:2172346-2172368 CTGGTGATGTGACAAGAGTCTGG - Intronic
1091786080 12:3244205-3244227 TTGGGGAGGGGACAAGAGTCTGG - Intronic
1092585511 12:9897468-9897490 CTGGTCGTGTGACAAGAACCTGG - Intergenic
1092801886 12:12176609-12176631 GTGGTGATGTGACCAGATGCTGG - Intronic
1094443667 12:30506781-30506803 CTGGTCGTGTGACAAGAACCTGG + Intergenic
1096226983 12:49872353-49872375 CTGGTGTTGTGTGAAGAGTGGGG + Intronic
1098643892 12:72873372-72873394 CTGGTCGTATGACAAGAGACTGG + Intergenic
1098947814 12:76608055-76608077 GTGGTCATGTGACAAGAACCTGG - Intergenic
1100233516 12:92634187-92634209 CTGGTCATGTGACAAGAACCCGG - Intergenic
1100385300 12:94100430-94100452 CAGGTGAGGTAACAAGAGTCAGG - Intergenic
1105684956 13:22771436-22771458 TTGGTCATGGGACAAGAATCTGG - Intergenic
1106431198 13:29682182-29682204 CTGGTTGTGTGACAAGAACCCGG - Intergenic
1106863848 13:33941309-33941331 CTGGTCATATGACAAGAACCTGG + Intronic
1108203711 13:48067011-48067033 CTGATCGTGTGACAAGATTCTGG + Intronic
1108212958 13:48156858-48156880 TTGGTCATGTGACAAGAACCTGG + Intergenic
1108457845 13:50634484-50634506 CTGCTGATCTGACAGGAGTCAGG + Intronic
1108862203 13:54875167-54875189 CTGGAGATGTGATCAGAGTTTGG - Intergenic
1108871139 13:54987961-54987983 CTGGTCATGTGACAAAAATCTGG - Intergenic
1108940445 13:55946994-55947016 CTGGTCATGGGACAAGAACCAGG + Intergenic
1109547594 13:63848061-63848083 CTGGTCATGTGGAAAGACTCAGG + Intergenic
1110513225 13:76378296-76378318 ATGGTCATGTGACATGAGTTTGG + Intergenic
1114235155 14:20816724-20816746 CTGGAGAAGTGACAACTGTCAGG - Intergenic
1114668761 14:24398159-24398181 CTGGGGATGTGAGCAGAGCCTGG + Intergenic
1115251926 14:31357981-31358003 CTGCTGATCTGACAAGAGTTTGG - Intronic
1115898450 14:38117798-38117820 CTGGTCATGAGACAAGAACCAGG + Intergenic
1116103521 14:40470523-40470545 CTGGTCATGAGACAAGAACCTGG + Intergenic
1116256383 14:42562012-42562034 CTGGACATGTGACAAGAACCCGG - Intergenic
1117938535 14:60935876-60935898 CTGGTTGCGTGACAAGAGCCCGG - Intronic
1118616762 14:67579337-67579359 ATGGTGACGTGAGAAGACTCGGG - Intronic
1120624315 14:86805462-86805484 CTGGTAATGTGACTAGTGCCTGG + Intergenic
1120811549 14:88808723-88808745 CTGGTTATGTGACAAGAATCTGG - Intergenic
1121570367 14:94942489-94942511 CAGGCCATGTGACAAGAGTTGGG - Intergenic
1122571135 14:102702612-102702634 CTGGTTCTGTGACCAGAGGCAGG + Intronic
1202848298 14_GL000225v1_random:167-189 CAGGTGATGTAACAATTGTCTGG + Intergenic
1202850084 14_GL000225v1_random:10848-10870 CAGGTGATGTAACAATTGTCTGG - Intergenic
1202854050 14_GL000225v1_random:38822-38844 CAGGTGATTTAACAATAGTCCGG - Intergenic
1202855140 14_GL000225v1_random:45263-45285 CAGGTGATGTGACAATTGTCTGG - Intergenic
1202855400 14_GL000225v1_random:47693-47715 CAGGTGATGTAACAATTGTCAGG - Intergenic
1202856609 14_GL000225v1_random:55287-55309 CAGGTGATGTAACAATTGTCTGG - Intergenic
1202857801 14_GL000225v1_random:62455-62477 CAGGTGATGTAACAATTGTCTGG + Intergenic
1202859110 14_GL000225v1_random:70745-70767 CAGGTGATGTAACAATTGTCTGG + Intergenic
1202861785 14_GL000225v1_random:88034-88056 CAGGTGATGTAACAATTGTCTGG + Intergenic
1202864454 14_GL000225v1_random:105982-106004 CAGGTGATGTAACAATTGTCTGG - Intergenic
1202922384 14_KI270723v1_random:37132-37154 CAGGTGATGTAACAATTGTCTGG - Intergenic
1202922555 14_KI270724v1_random:482-504 CAGGTGATGTAACAATTGTCTGG + Intergenic
1123777621 15:23596628-23596650 CTGGTTATGTGACAAGAACCTGG - Intronic
1127016591 15:54695483-54695505 CTGGTCATATGACAAGAACCTGG + Intergenic
1127853552 15:62935873-62935895 CTGGTCAGGTGAAAGGAGTCGGG - Intergenic
1128920149 15:71603184-71603206 CTGGTGGTGTGACAAAAACCTGG - Intronic
1129269030 15:74409856-74409878 CCGGGGATGAGATAAGAGTCTGG - Exonic
1130087975 15:80794584-80794606 CTGTTGAAGTGACAATAGTTTGG - Intronic
1130830149 15:87591140-87591162 CTGGTGGTGGGACACTAGTCAGG - Intergenic
1132870286 16:2112732-2112754 CTGGGGCTGGGACAAGAGCCTGG + Intronic
1133926105 16:10193864-10193886 ATGGAGAAGTGACAAGATTCAGG - Intergenic
1136733419 16:32440937-32440959 CTGGTGGTATGACAAGAACCTGG + Intergenic
1138978778 16:62241247-62241269 CTGGTTATGAGACAAGAACCTGG + Intergenic
1138982188 16:62282707-62282729 CTGGCTATGTGACAAGATTCTGG - Intergenic
1140262963 16:73396650-73396672 CTGGTTGTTTGATAAGAGTCTGG - Intergenic
1203019664 16_KI270728v1_random:388665-388687 CTGGTGGTATGACAAGAACCTGG - Intergenic
1203037999 16_KI270728v1_random:661823-661845 CTGGTGGTATGACAAGAACCTGG - Intergenic
1142479754 17:211778-211800 ATGGTGATCTGAAAAGATTCTGG - Intergenic
1142794437 17:2296529-2296551 CTGCTGATCTGACAGGAGTTAGG - Intronic
1144143759 17:12377075-12377097 CTGGCCATGTGACAAGAGCCTGG - Intergenic
1144334058 17:14253305-14253327 CTGGTCATGAGACAAGAACCTGG + Intergenic
1145789024 17:27613327-27613349 CTGGTCATGAGACAAGAACCTGG - Intronic
1149438443 17:56654083-56654105 TTGCTGAAGTGACAAGAGCCTGG - Intergenic
1149762204 17:59242654-59242676 CTGGTCATGTGACAAGAACCTGG - Intronic
1150595771 17:66603045-66603067 ATGGTCATGTGACAAGAGCCCGG + Intronic
1151192024 17:72405768-72405790 CTGATGATTTTACAAGTGTCTGG - Intergenic
1152148906 17:78586729-78586751 CTGGTCGTGTGACAAAAGCCTGG + Intergenic
1153127203 18:1808688-1808710 CTGGTCATGTGACAAGAACCTGG + Intergenic
1156197826 18:34795591-34795613 CTGGCCCTGTGACAAGAGTGTGG + Intronic
1156933907 18:42679337-42679359 ATGGTGAGGTGGCAAGAGTATGG - Intergenic
1157443125 18:47725212-47725234 GTGGTGATGTGAAAGGAGTTTGG - Intergenic
1157488312 18:48105169-48105191 CTGCCAATGTGAGAAGAGTCAGG + Intronic
1157939916 18:51917370-51917392 CTGATGATGGGAAAAGAGGCTGG + Intergenic
1158269592 18:55698139-55698161 CTGGGGAGGTGGCAAGACTCAGG + Intergenic
1162182943 19:8883034-8883056 CTGGGAATGTGAGTAGAGTCAGG + Intronic
1162648984 19:12070866-12070888 TTGGTGAGGTGTCAAGAGTTGGG + Intronic
1163799220 19:19354890-19354912 CTGGGGAGGTGACAGGAGACGGG + Intronic
1164465294 19:28482559-28482581 CTGGTCATGAGACAAGAACCTGG + Intergenic
1164810821 19:31154500-31154522 CTGGTCATGTGACAGGAACCTGG - Intergenic
1165358044 19:35316082-35316104 CTGCTGATCTGACAGGAGGCAGG - Intergenic
1165388388 19:35524938-35524960 GTGGGGTTGTAACAAGAGTCTGG - Intronic
1166345075 19:42160475-42160497 CTGATGATGTGACAGGAGGAGGG - Intronic
1167573868 19:50308416-50308438 CTGCTGATGTGCCAAGTGCCAGG + Intronic
1167758556 19:51428443-51428465 CTGGTCATGAGACAAGAACCTGG + Intergenic
926239183 2:11071645-11071667 CTGGTCATGTGACAAGAACCTGG + Intergenic
926888924 2:17622668-17622690 CTGGTCATATGACAAGAGCCTGG - Intronic
927091184 2:19713979-19714001 CTGGTGTTTTGACACGTGTCAGG - Intergenic
927321850 2:21756343-21756365 CTGCTGATCTGACAGGAGGCGGG - Intergenic
928418749 2:31121056-31121078 CTGCTGATGTGACCAGGGCCTGG - Intronic
931460881 2:62449037-62449059 CTGGTGCTGGGACAAGGGTATGG - Intergenic
932046734 2:68357576-68357598 CTGGTCGTGTGACAAGAATCCGG - Intergenic
933310263 2:80652027-80652049 CTGGTCGTGTGACAAGAACCTGG - Intergenic
933577157 2:84082312-84082334 GTGGTGATGTGACAAAAGTAGGG - Intergenic
936702991 2:115036189-115036211 CTGATGATTTTACAAGGGTCTGG - Intronic
936733026 2:115406937-115406959 CTGGTCGTGTGACAAGAACCCGG - Intronic
939339037 2:140869281-140869303 TTGGTCATGGGACAAGAGCCTGG + Intronic
939419155 2:141943819-141943841 CTGGTCGTGTGACAAGAACCCGG - Intronic
940329650 2:152460675-152460697 CTGCTGATCTGACAGGAGGCAGG - Intronic
940391125 2:153133550-153133572 CTGGTTGTGTGACAAGAACCCGG + Intergenic
940542776 2:155043910-155043932 CTGTTGCTGTGACTTGAGTCTGG - Intergenic
940847642 2:158659224-158659246 GTGGGGAGGTAACAAGAGTCAGG + Intronic
941663619 2:168221057-168221079 CTGGTGATTTCAGAAGAGGCAGG + Intronic
943253863 2:185567905-185567927 CTGATCATGTGACAAGAACCTGG - Intergenic
943846502 2:192655883-192655905 CTGGTCGTGTGACAAGAACCTGG - Intergenic
944300890 2:198123730-198123752 CTGCTGATCTGACAGGAGGCGGG - Intronic
944960084 2:204862764-204862786 CTGGTCGTGTGACAAGAACCTGG - Intronic
946512385 2:220372623-220372645 ATGGTGATGTTACAAGAGGATGG + Intergenic
946652923 2:221913706-221913728 CTGGTCATGTGACAAGAACCTGG - Intergenic
946752075 2:222902599-222902621 CTGGTCATGAGACAAGAACCTGG - Intronic
946873763 2:224108122-224108144 CTGGTCATGTGACAAGAACCAGG - Intergenic
946995034 2:225381786-225381808 CTGCTGATTTGACAGGAGGCGGG + Intergenic
947582964 2:231333069-231333091 CTGGGGAGGTGCCAAGGGTCTGG - Intronic
947685706 2:232082423-232082445 CTGCTGATCTGACAGGAGGCGGG - Intronic
1168953936 20:1821124-1821146 ATGGTGTTGGGACAAGAGGCAGG - Intergenic
1169940682 20:10933965-10933987 CTGGTCATGTGACAAGAAGCTGG - Intergenic
1170220607 20:13937585-13937607 CTGGTCGTGTGACAAGAACCTGG + Intronic
1172501910 20:35433675-35433697 CTGCTGATGTGACCAGTGGCAGG - Exonic
1173395019 20:42671103-42671125 CAGGTGAGGTGACAAGAGATAGG - Intronic
1173882123 20:46423446-46423468 CAGGGGATGAGACAAGAGACAGG - Intronic
1177222796 21:18216806-18216828 CTGGTTGTGTGATAAGTGTCTGG - Intronic
1177571258 21:22890198-22890220 CTGGTTGTGTAACAAGAATCTGG - Intergenic
1177832209 21:26151734-26151756 CTGCTGATGTGACAAGAGGCAGG + Intronic
1179140514 21:38721050-38721072 CTGGTCATGTGACAAGACCCTGG - Intergenic
1179963380 21:44784823-44784845 CTGGGGAGGTGACAGCAGTCAGG + Intronic
1180413896 22:12692215-12692237 CAGGTGATGTAACAATTGTCTGG + Intergenic
1180539047 22:16424149-16424171 CTGGTGGTGTGACAAGAACCTGG - Intergenic
1183435307 22:37790686-37790708 CTGGTGCTGTGACAAGCACCAGG - Intergenic
1183759103 22:39799431-39799453 CTGGTCATGAGACAAGAACCTGG - Intronic
1184552674 22:45212813-45212835 CTGGTGATGGGACAATGGGCGGG + Intronic
1184987376 22:48144905-48144927 CTGGAGATGTGGCAAGTGGCTGG + Intergenic
949166925 3:954223-954245 CTGGTCGTGTGACAAGAACCAGG - Intergenic
950547061 3:13644555-13644577 CTGGTGCTGAGCCAAGATTCTGG - Intergenic
951845390 3:27079372-27079394 ATGGTCATGTGACAAGAACCTGG - Intergenic
953648093 3:44773813-44773835 CTGGTCATGCGACAAGAACCTGG - Intronic
953869099 3:46610679-46610701 CTGCTGATTTGATAAGATTCAGG - Intronic
955342265 3:58134175-58134197 CTGCTGATCTGACAGGAGGCAGG - Intronic
955733371 3:62010907-62010929 CTGGTCATGAGACAAGAACCTGG - Intronic
956930051 3:74033454-74033476 CTGGTTATTTAAAAAGAGTCTGG - Intergenic
957028249 3:75209458-75209480 CTGGTCATGTGACAAGAACCTGG + Intergenic
959660572 3:108863721-108863743 CTGGTCATGTGACAAGAACCCGG - Intergenic
960412284 3:117342250-117342272 TTGGTGGTGTGAGAAGAGTATGG - Intergenic
962214347 3:133507475-133507497 CTGGTGCTGTAGCAAGAGTGTGG - Intergenic
963666344 3:148192590-148192612 ATGGGAATATGACAAGAGTCAGG - Intergenic
963843855 3:150134817-150134839 CTGGTGATTTGACAACATGCAGG + Intergenic
964362037 3:155908464-155908486 CTGGTCATGTGAAAAGAACCCGG + Intronic
964727896 3:159833829-159833851 CTGGTGCTGTGAAAAGAAACAGG - Intronic
967546196 3:190731846-190731868 CTGGTTGTGTGACAAGAACCTGG - Intergenic
967761126 3:193227426-193227448 CTGGTTGTGTGACAAGAACCTGG + Intergenic
969073774 4:4561010-4561032 CTGGTCGTGTGACAAGAGCCTGG - Intergenic
969427402 4:7133354-7133376 CTGGTGATCTGCCATGAGCCTGG - Intergenic
970375951 4:15457168-15457190 TTGGTGAGATGGCAAGAGTCTGG - Intergenic
970729921 4:19090579-19090601 CTGGTCATGTGACAAGAATCTGG + Intergenic
971927909 4:33037884-33037906 CTGGTCCTGTGACAAGAACCTGG + Intergenic
975176960 4:71300113-71300135 CTGGAGAAGTGAGAGGAGTCAGG - Intronic
976751537 4:88455262-88455284 CTGGTCATGAGACAAGAACCTGG - Intergenic
977092021 4:92689507-92689529 CTGCTGATGTGACAGGAGGCTGG - Intronic
977823462 4:101502804-101502826 CTGGTCATGTGACAAGAGCCTGG + Intronic
978749335 4:112229319-112229341 CTTGTCATGTGACAAGAACCTGG + Intergenic
979609382 4:122673273-122673295 CTGGTCAAGTGACAAGAAACTGG - Intergenic
979933552 4:126663317-126663339 CTGGTCATGAGACAAGAACCAGG + Intergenic
981456008 4:144954020-144954042 CTGGTCGTGTGACAAGAACCTGG + Intergenic
981491152 4:145340705-145340727 CTGGTCATGTGACAAGAACCTGG + Intergenic
981923840 4:150116746-150116768 CTGGTTATGTGGACAGAGTCAGG + Intronic
982272796 4:153608357-153608379 TTGGTCATCTGACAAGAGTGGGG + Intronic
982477503 4:155871952-155871974 CTGGTCCTGTGACAAGAACCCGG - Intronic
983040661 4:162921535-162921557 CTTGTCATGTGACAAGAACCCGG + Intergenic
983040673 4:162921617-162921639 CTGGTCATGTGATAAGAACCTGG + Intergenic
983558789 4:169081225-169081247 TTGGTGATGTGAGAAGAGATTGG + Intergenic
985227444 4:187777917-187777939 CTTGTCATGGGACAAGAGCCTGG - Intergenic
985919925 5:2962471-2962493 CTGGTCATGAGACAAGAACCAGG - Intergenic
985991087 5:3561909-3561931 CTGGTTATTTGATAAGTGTCTGG + Intergenic
987026768 5:13934774-13934796 CTGGGGAGGTGGCAAGAGGCAGG + Intronic
987730945 5:21771882-21771904 CATGTGATGTCACTAGAGTCAGG + Intronic
991082990 5:62621254-62621276 CTGGTCGTGTGACAAGAACCTGG - Intronic
993011879 5:82492366-82492388 CTGCTGATCTGACAGGAGGCAGG - Intergenic
993179316 5:84530589-84530611 CTCATGATGGGACAAGTGTCAGG + Intergenic
993379600 5:87191405-87191427 CTGATGATCTTACAAGAGTAAGG - Intergenic
996702164 5:126461233-126461255 CCAGTGATGTGACAAGAGAAAGG + Intronic
997099866 5:130957259-130957281 CTGGTTGTTTGACAAGTGTCTGG + Intergenic
998651089 5:144122588-144122610 CTGGCTGTGTGACAAGAGCCCGG - Intergenic
998694031 5:144616998-144617020 CTGGTGCTGGGAAAAGAGTCTGG + Intergenic
999114549 5:149151206-149151228 AAGGTGATGTGAAAAGACTCAGG - Intronic
1000241842 5:159415943-159415965 CTGGTTGTGTGACAAGAACCCGG + Intergenic
1000556438 5:162732293-162732315 CTGGTTGTGTGACAGGAATCTGG - Intergenic
1000939894 5:167347886-167347908 CAGGTGATGTCACAAGACTACGG + Intronic
1002079027 5:176726876-176726898 CCGGTGAGGTGACAAGACTGCGG - Intergenic
1002792381 6:445949-445971 CTGGTGATGTGAAAATACTGGGG + Intergenic
1005055175 6:21722477-21722499 CTGGTTGTGTGACAAGAACCTGG - Intergenic
1005309750 6:24548218-24548240 CTGGTAGTGTGACAAGAGCCTGG - Intronic
1005564681 6:27079010-27079032 CTGGTTATGTGACAAGAACCCGG + Intergenic
1005981539 6:30840614-30840636 CTGGTCATGTGACAAGAACCCGG - Intergenic
1006750722 6:36375088-36375110 CTTGGGATGTGACATGAGACTGG + Intronic
1006847968 6:37076243-37076265 ATGCTGATGTGACAATAGTTTGG + Intergenic
1007203932 6:40133660-40133682 CTGGTCATGTGGCAAGAGCTCGG - Intergenic
1011241123 6:85272456-85272478 CTGATGATGTGCCCAGAGGCAGG + Intergenic
1011897978 6:92255992-92256014 CTGGTGCTGTGACAAATCTCTGG + Intergenic
1012629170 6:101442186-101442208 CTGGTCCTGTGACAAGAACCTGG - Intronic
1013311960 6:108903024-108903046 CAGGTGTGGTGACAAGCGTCTGG + Intronic
1014335786 6:120134370-120134392 CTGCAGATCTGACAAGAGTTGGG + Intergenic
1015040727 6:128715596-128715618 CTGTTGATGTGAAAAGATTTAGG + Intergenic
1016117192 6:140301841-140301863 CTGGTTGTGTGACAAAAGCCTGG + Intergenic
1016354403 6:143202532-143202554 CTGTTGATGTGAGAATTGTCAGG - Intronic
1016618318 6:146078881-146078903 CTGGTGGTGTGACAAGAACCTGG - Intronic
1016632410 6:146248457-146248479 CTGGTTATTTGATAAGTGTCTGG + Intronic
1017522291 6:155213182-155213204 CTGGTCATGGGACAAGAATTCGG - Intronic
1020596606 7:10214170-10214192 CTGGTCATGAGACAAGAACCTGG - Intergenic
1020956531 7:14745820-14745842 CTGGTCATGAGACAAGAACCTGG + Intronic
1021874485 7:25035964-25035986 CTGGTCATGAGACAAGAACCTGG - Intergenic
1022994075 7:35736390-35736412 CTGGAGATGTGGGAAGAGACAGG - Intergenic
1023735698 7:43234408-43234430 CTGGGGATGTCACAAGGGGCCGG - Intronic
1024932991 7:54684082-54684104 CTGGTGAGATGACAGCAGTCTGG - Intergenic
1025157409 7:56620793-56620815 ATGGTCATGTGACAAGATGCTGG + Intergenic
1030496620 7:110308800-110308822 CTGGTCATGAGACAAGAACCTGG - Intergenic
1031616482 7:123887884-123887906 CTGGTCATGAGTCAAGAGCCTGG + Intergenic
1033223120 7:139541955-139541977 CTTGGGATGTGACAGCAGTCAGG + Intronic
1033866223 7:145692934-145692956 CTGGTCATGTGACAAGAACCTGG + Intergenic
1033868565 7:145721590-145721612 CTGGTTATTTGAAAAGAGCCTGG - Intergenic
1037485889 8:19346320-19346342 CTGATGATCTGACAGGAGGCGGG - Intronic
1038370299 8:26982147-26982169 CTGGTCATGTGTCAAGAACCCGG + Intergenic
1038494487 8:27991966-27991988 CTTGAGCTGTGACATGAGTCAGG + Intronic
1038864979 8:31429839-31429861 ATGGTCATGTGACAAGAACCCGG + Intergenic
1039572232 8:38596448-38596470 CTGGGGGTGTGACAAGAGGTGGG + Intergenic
1039701078 8:39962551-39962573 CTGGTCATGAGACAAGATCCTGG - Intronic
1040374481 8:46810643-46810665 CTGGTTATGTTACAAGATCCTGG - Intergenic
1040662960 8:49596748-49596770 CTGGTCATGAGACAAGAACCTGG + Intergenic
1040853412 8:51925044-51925066 CTGGTTATGTAACAAGAACCAGG - Intergenic
1040919331 8:52599326-52599348 CTGGTCATGGGACAAGAAACTGG + Intergenic
1040997258 8:53414263-53414285 CTGGTCGTGTGACAAGAGCCTGG - Intergenic
1043069127 8:75616975-75616997 CTGGTCATGTGACAAGAACCTGG - Intergenic
1045225793 8:100244480-100244502 CTGGTGATGAGTCAAGAGGAGGG - Intronic
1046586657 8:116156224-116156246 CTGCTGCTGTGACAACACTCTGG + Intergenic
1047844059 8:128786869-128786891 CTGGTCATGGGACAAGATTCTGG - Intergenic
1048175584 8:132149455-132149477 CTGGTCATGTGACAAGAACCCGG + Intronic
1048742717 8:137580002-137580024 ATGGCCATGTGACAAGAGCCTGG - Intergenic
1049105155 8:140608273-140608295 CTGGGGATGTGACAGGAGACCGG - Intronic
1049296236 8:141841164-141841186 CTGGTTATTTGATAAGCGTCTGG + Intergenic
1050785276 9:9393138-9393160 CTGGCCATGTGACAAGAACCTGG + Intronic
1057174750 9:92988054-92988076 CTGGTAATGAGACAAGAACCCGG - Intronic
1057246708 9:93461968-93461990 CTTGTGATGTGATCACAGTCTGG - Intronic
1057342427 9:94214602-94214624 CTGGTCGTGTGACAAGAACCTGG + Intergenic
1057371010 9:94473129-94473151 CTGGCTATGTGACAATAGTAAGG - Intergenic
1058281890 9:103126816-103126838 CTGGTGGTGTGACAAGAACCAGG - Intergenic
1059127941 9:111711568-111711590 CTGGTCATGTGACAAGAGCCTGG + Intronic
1060211437 9:121712944-121712966 CTGGAGATGTGCCAACACTCTGG - Intronic
1060486917 9:124053630-124053652 CTGGTCATGAGACAAGACCCTGG + Intergenic
1061615755 9:131777853-131777875 CTGGTGGTTTGGCAAGAGTTAGG - Intergenic
1061709286 9:132476646-132476668 CTGGTGTTCTGACAAGAGAAAGG + Intronic
1203739870 Un_GL000216v2:170035-170057 CAGGTGATGTAACAATTGTCTGG + Intergenic
1203740938 Un_GL000216v2:176420-176442 CAGGTGATGTAACAATTGTCTGG - Intergenic
1186751725 X:12628540-12628562 CTGGGAAGGTGACAAGATTCTGG - Intronic
1187842892 X:23506953-23506975 CTGGTCATGTGACAAGAGCCCGG + Intergenic
1188069670 X:25703658-25703680 GTGGTCATGTGTCAACAGTCTGG + Intergenic
1188234448 X:27709733-27709755 CTGGTGAAGAGACAAGATTTTGG - Intronic
1188375270 X:29421165-29421187 CTGGTCATGTGACAAGAACCTGG - Intronic
1193699969 X:84748237-84748259 CTGGTCGTGTGACAAGAACCCGG + Intergenic
1194059230 X:89177250-89177272 CTGGTGATGAGACAAGATCCCGG - Intergenic
1194556664 X:95368476-95368498 CTGGTTATGTGAACAGACTCGGG - Intergenic
1197055169 X:122110276-122110298 CTGGTGAGGGCACAAGAGTTGGG - Intergenic
1197300846 X:124778435-124778457 CTGGTCATGTGACAAGAATCTGG + Intronic
1197971307 X:132118330-132118352 CTGGTCGTGTGACAAGAACCTGG - Intronic
1199043315 X:143139855-143139877 CTGGTCACGTGACAAGAGCCAGG - Intergenic
1200852118 Y:7894003-7894025 CTGATCATGTGACAAGATCCTGG + Intergenic
1201176145 Y:11309305-11309327 CAGGTGATGTAACAATTGTCTGG - Intergenic
1201725222 Y:17143185-17143207 TTGGTCATGTGACAAGAACCTGG - Intergenic
1202624458 Y:56843126-56843148 CTGGTGATGTAACATTTGTCTGG + Intergenic