ID: 1091632741

View in Genome Browser
Species Human (GRCh38)
Location 12:2174161-2174183
Sequence GTGGTATCCCAGATAAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091632741 Original CRISPR GTGGTATCCCAGATAAATGG TGG Intronic
901734166 1:11301760-11301782 GTGATCTCCCTGATAAATGATGG + Intergenic
910074490 1:83261335-83261357 GTGGTGTCCCAGATGATTTGGGG + Intergenic
911255696 1:95630585-95630607 GACGTATTCCACATAAATGGTGG - Intergenic
912852674 1:113140739-113140761 ATGGTATCTCTGAGAAATGGTGG - Intergenic
917556985 1:176100749-176100771 GTGACACCCCAGATAACTGGTGG - Intronic
918918642 1:190675386-190675408 GTGCCCTCCCAGATTAATGGTGG + Intergenic
921617166 1:217283073-217283095 TTGGTATACCAGATAAACTGAGG + Intergenic
924522846 1:244820313-244820335 TTGGGATCCCAGATAACTTGGGG - Intergenic
1065656060 10:27951476-27951498 GTGGTATCCCAGATTATTGGAGG + Intronic
1065911055 10:30305842-30305864 GTGGAATCCCAGAGGAATGAAGG + Intergenic
1074245690 10:111689430-111689452 GTGCTATCACAAATCAATGGGGG + Intergenic
1076633800 10:131869579-131869601 CTGGTCTCCCAGGAAAATGGAGG + Intergenic
1080317143 11:30963048-30963070 TTGGTATCTCAGATATTTGGTGG + Intronic
1081714643 11:45240700-45240722 GTGGAATCACAGATTAATGAGGG + Exonic
1082047498 11:47741843-47741865 GAGGTATCATAGATAAATTGTGG - Intronic
1082964288 11:58949479-58949501 GTGGTATGCTAGATAACTGTAGG + Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1085795564 11:79536574-79536596 GGGGAAACCCAGATGAATGGAGG + Intergenic
1091632741 12:2174161-2174183 GTGGTATCCCAGATAAATGGTGG + Intronic
1092098569 12:5864116-5864138 GTGGGATCCAAGAAACATGGTGG - Intronic
1093490420 12:19698855-19698877 ATGATTGCCCAGATAAATGGTGG + Intronic
1097790156 12:63806962-63806984 GTGGAAGCCCAGATTATTGGAGG - Intronic
1098613714 12:72495459-72495481 GTGTTTACTCAGATAAATGGGGG - Intronic
1098659186 12:73071692-73071714 GTGGTCACCCAGATTAAGGGTGG - Intergenic
1099270883 12:80508856-80508878 GTGGAATACCAGATAAAGCGTGG - Intronic
1101174569 12:102135942-102135964 ATGGTATCTCACATAAATGCAGG - Intronic
1107108335 13:36670661-36670683 GTGAAATCTCAGATAAAAGGGGG - Intergenic
1110339005 13:74367108-74367130 CTGGTATCAAAGAAAAATGGCGG + Intergenic
1110390644 13:74969491-74969513 GTCTAATCTCAGATAAATGGGGG - Intergenic
1112127393 13:96483258-96483280 GGGGTTCCCCAGATAAAAGGTGG + Intronic
1113095330 13:106657734-106657756 TTGGTATGCCAGAAAAATGTAGG - Intergenic
1115069280 14:29301651-29301673 ATGGAATCCCAAATAAATAGAGG - Intergenic
1122262480 14:100531225-100531247 GGGGTATCCCAGACAGAGGGAGG + Intergenic
1123919447 15:25060193-25060215 CTGGTATTCCAGAGAAAAGGTGG + Intergenic
1123920800 15:25068438-25068460 ATGGTACCCCAGAGAAAAGGTGG + Intergenic
1131966363 15:97848171-97848193 CTGGATTCTCAGATAAATGGAGG + Intergenic
1132854196 16:2037526-2037548 TTGGTTTCCCAGCTCAATGGTGG + Exonic
1135603931 16:23806994-23807016 GTGGTATTTCAAATAAGTGGGGG - Intergenic
1136502911 16:30682531-30682553 GTGGTATGCCAGATCAAAGGAGG + Intergenic
1138481586 16:57306907-57306929 TTGGAAAACCAGATAAATGGAGG - Intergenic
1140833033 16:78769121-78769143 TTGGTATTCCAAATAATTGGTGG + Intronic
1147250445 17:39150149-39150171 GTGGTCTCCCTGAAAATTGGTGG + Intronic
1148030106 17:44613811-44613833 GTGGTGTCCCAGCTACATGGTGG + Intergenic
1155634187 18:27932567-27932589 GTGGTAAACCATGTAAATGGTGG + Intergenic
1156867523 18:41905327-41905349 GTTGTATCGGAAATAAATGGTGG - Intergenic
1157371070 18:47112432-47112454 GTGGTATCTCAAATAAATTTAGG - Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1162290371 19:9775485-9775507 GTGGTATTTCAGATCAATTGGGG + Intronic
928041154 2:27879123-27879145 GTGGTAACCCAGAAAAAAAGGGG - Intronic
928723922 2:34149341-34149363 GTGATATCTCAGATACAAGGAGG + Intergenic
930756032 2:54974169-54974191 GTGATAAACCAGATAAAGGGTGG - Intronic
932628678 2:73319705-73319727 TAGGCATCCCAGATATATGGTGG + Intergenic
933205289 2:79500356-79500378 TTTGTATCCCATAGAAATGGTGG - Intronic
933665737 2:84963461-84963483 GTGGTATCCCAGAAAATGAGAGG + Intergenic
934661052 2:96143952-96143974 GAGGTATGCCAGACAGATGGTGG + Exonic
941217682 2:162734192-162734214 GTGATATCCCAGATTCATGAAGG - Intronic
943497462 2:188640442-188640464 GTGGTAATCCAGATATATGCAGG - Intergenic
944993236 2:205262256-205262278 GTAGTATCCTAGAGAAATAGTGG - Intronic
945379405 2:209121740-209121762 GTGCTAACCCAGATTAAGGGCGG + Intergenic
1172458875 20:35099981-35100003 GTGATACCCCAGAAAAAGGGCGG - Intergenic
1183559198 22:38557270-38557292 GTGCTATCCCAAATAATTTGGGG - Intronic
1184451811 22:44586900-44586922 GTGACATCCCAGAAAAGTGGGGG + Intergenic
949473398 3:4419576-4419598 GTGGTTTTCCAGTTAGATGGTGG + Intronic
953517712 3:43612429-43612451 GTGGTATCCCTGAGAAAGGCAGG - Intronic
953662063 3:44898730-44898752 GTGGTATGCCTCATAAATGCTGG + Intronic
954493397 3:50929964-50929986 TTGGTATCCCAGATTCATAGTGG + Intronic
957247984 3:77736921-77736943 GTGCTAACCCAGATTAAGGGAGG + Intergenic
970911869 4:21286106-21286128 GCGGTAACCAAGATAAGTGGAGG - Intronic
971978523 4:33722652-33722674 GTTATATCCCAGATAACTGATGG + Intergenic
975943541 4:79677175-79677197 GTGAAATCACAGATAAGTGGGGG - Intergenic
976874699 4:89838009-89838031 TTTGTCTCCCAGATAAAGGGAGG - Intronic
977734788 4:100400564-100400586 GTACTATCCCAGATATAAGGAGG - Intronic
979856558 4:125639815-125639837 GTTGTAACCCAAATTAATGGAGG + Intergenic
980386701 4:132094182-132094204 GTGTTCACCCAGATTAATGGTGG + Intergenic
982851423 4:160320892-160320914 GTAGACTCCCAGAGAAATGGAGG - Intergenic
983798134 4:171892279-171892301 GTGGTATCCCCCATATATAGAGG + Intronic
983822253 4:172210367-172210389 GTGGTATCCCAGAGTCATGTAGG - Intronic
984059974 4:174979549-174979571 GTGGCAACCCAGATTAAGGGTGG + Intergenic
984687934 4:182692438-182692460 TTTGTATCCCAGAGAATTGGAGG + Intronic
991440783 5:66646291-66646313 GTGGCATCCCTTATAAATGTTGG - Intronic
995031611 5:107488061-107488083 CTGGGGTCCCAGAAAAATGGTGG + Intronic
996642439 5:125772560-125772582 GTGACATCCCAGATAAGAGGTGG + Intergenic
1005420585 6:25644629-25644651 GTGCTCACCCAGATTAATGGTGG + Intergenic
1007431382 6:41779446-41779468 GGGGCATCCAAGAGAAATGGTGG + Intronic
1011026315 6:82873265-82873287 GTGCTCACCCAGATAAAGGGTGG - Intergenic
1012616466 6:101284374-101284396 GTGCCATCCCAGAGAGATGGAGG - Intergenic
1024166772 7:46741460-46741482 GTTGTTTCACAGATAAATGTTGG + Intronic
1025150466 7:56542732-56542754 GTGGGAACCCAGAGAAACGGTGG - Intergenic
1027292189 7:76726213-76726235 GTGGTGTCCCAGATGATTTGGGG + Intergenic
1029504415 7:100953841-100953863 GTGGTCACCAAGATAGATGGAGG - Exonic
1032181873 7:129686704-129686726 GTGGTATACAAGATGAATTGAGG + Intronic
1034559876 7:151872952-151872974 GTGAAATCCCAGATTAATGGGGG - Intronic
1039401095 8:37269934-37269956 GTGCTATCAGAGATAACTGGTGG - Intergenic
1042389627 8:68218483-68218505 GTGGTAGCCCAAAGAAAAGGTGG - Intronic
1044329264 8:90897226-90897248 TTGGAATCGCAGATAAGTGGTGG - Intronic
1046418091 8:113941400-113941422 GTGCCAGCCCAGATTAATGGTGG + Intergenic
1048226306 8:132589756-132589778 GTGGTCTTCTAGAGAAATGGTGG - Intronic
1054766960 9:69050266-69050288 GTAATATCACAGATAAATTGTGG - Intronic
1060219432 9:121756560-121756582 GTGGTATGCTGGATAAATGTTGG + Intronic
1187498799 X:19821027-19821049 GTGGTATCCAATATATATTGAGG - Intronic
1192848344 X:74927872-74927894 GGGGTGTCTCAGATAAAAGGTGG + Intergenic
1197281467 X:124541746-124541768 GTGGTATCATAGATTAAAGGTGG + Intronic
1198768845 X:140106877-140106899 GTGGCATCCCAGAAAAATACTGG - Intergenic
1199084305 X:143611030-143611052 GTGCCCACCCAGATAAATGGTGG - Intergenic
1200469817 Y:3571285-3571307 GTGGAATTCCATGTAAATGGAGG - Intergenic
1201327108 Y:12773694-12773716 GTGGTATTCCAAGTTAATGGGGG + Exonic