ID: 1091634315

View in Genome Browser
Species Human (GRCh38)
Location 12:2185790-2185812
Sequence TGTGTGGCCCTGGGCAGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 421}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091634307_1091634315 0 Left 1091634307 12:2185767-2185789 CCAGCACTGCCTCCTGCCCTGTC 0: 1
1: 0
2: 8
3: 107
4: 731
Right 1091634315 12:2185790-2185812 TGTGTGGCCCTGGGCAGAAGCGG 0: 1
1: 0
2: 2
3: 37
4: 421
1091634306_1091634315 1 Left 1091634306 12:2185766-2185788 CCCAGCACTGCCTCCTGCCCTGT 0: 1
1: 0
2: 7
3: 93
4: 671
Right 1091634315 12:2185790-2185812 TGTGTGGCCCTGGGCAGAAGCGG 0: 1
1: 0
2: 2
3: 37
4: 421
1091634302_1091634315 30 Left 1091634302 12:2185737-2185759 CCCTGTCTGTGGCACTTTGTCAG 0: 1
1: 0
2: 19
3: 146
4: 914
Right 1091634315 12:2185790-2185812 TGTGTGGCCCTGGGCAGAAGCGG 0: 1
1: 0
2: 2
3: 37
4: 421
1091634303_1091634315 29 Left 1091634303 12:2185738-2185760 CCTGTCTGTGGCACTTTGTCAGG 0: 1
1: 4
2: 59
3: 395
4: 1528
Right 1091634315 12:2185790-2185812 TGTGTGGCCCTGGGCAGAAGCGG 0: 1
1: 0
2: 2
3: 37
4: 421
1091634309_1091634315 -9 Left 1091634309 12:2185776-2185798 CCTCCTGCCCTGTCTGTGTGGCC 0: 1
1: 0
2: 9
3: 68
4: 690
Right 1091634315 12:2185790-2185812 TGTGTGGCCCTGGGCAGAAGCGG 0: 1
1: 0
2: 2
3: 37
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091634315 Original CRISPR TGTGTGGCCCTGGGCAGAAG CGG Intronic
900175883 1:1291186-1291208 TGGCTGGCCCTGCACAGAAGGGG + Intronic
900524502 1:3121834-3121856 TGTGTGGCCCTGGCGGGAAGTGG + Intronic
900545120 1:3224463-3224485 AGAGTGGCCCTGGGCACATGCGG - Intronic
900857657 1:5198900-5198922 TGTGTGCCCATGGGGTGAAGAGG - Intergenic
901061306 1:6473220-6473242 TGCCTGACCCTGGGCAGATGGGG + Intronic
901205066 1:7489866-7489888 TGTCTGGCCCCGAGCAGACGGGG + Intronic
901207134 1:7503729-7503751 TGTGTGGCCCTCGGGAGGTGGGG + Intronic
901688842 1:10959682-10959704 TCTTTGCCCCTGGGGAGAAGAGG - Intronic
901925291 1:12562097-12562119 TGTGTAGCCCTGGCCAGGAATGG + Intergenic
902688234 1:18092869-18092891 GGTGTGGTCCTGCCCAGAAGGGG - Intergenic
903134758 1:21302258-21302280 TGTGGGGCCTGGGCCAGAAGAGG - Intronic
903185615 1:21627197-21627219 AGGGTGGCCCTAGGCAGCAGCGG - Intronic
903244449 1:22005568-22005590 CCTGTGGCCCTGGGCAGCGGGGG + Intronic
903279393 1:22242000-22242022 TGTGTGGGCCAGGGCTGAGGAGG + Intergenic
903337360 1:22634152-22634174 TGACTTGCCCTGGGCAGATGTGG - Intergenic
903374256 1:22855988-22856010 TCTGTGGCTCTGGGTAGAGGTGG - Intronic
903735929 1:25530037-25530059 TGTGTGGGGGTGGGCAGAGGGGG - Intergenic
904380440 1:30107162-30107184 TGTGTGGCCCTGGGCTACAGGGG - Intergenic
904770991 1:32881389-32881411 TGAGTGGCACTGTGGAGAAGAGG + Intergenic
904942589 1:34175839-34175861 AGTGAGGCACTGGGGAGAAGAGG - Intronic
904986135 1:34550125-34550147 TGTGTTCCCATGGGCAGGAGTGG - Intergenic
905240993 1:36581417-36581439 TGTGTGATCCTGGCCAGGAGTGG + Intergenic
905262598 1:36730196-36730218 TGTGTGGGCCAGGGCAGATGGGG - Intergenic
905265806 1:36753669-36753691 GGTGTGGCCATGTGCAGAAGGGG + Intergenic
905319612 1:37106593-37106615 TTTGGGGTCCTGGGCAGATGTGG - Intergenic
905404977 1:37726489-37726511 AGTGTGGCCCTGGGGAGAAGGGG + Intronic
905646693 1:39629798-39629820 TGTGGGGTCCTTGGCAGAACTGG - Intronic
905876216 1:41433450-41433472 TGAGGGGCCCTGGGCTGCAGGGG - Intergenic
906686280 1:47765459-47765481 TGTGGGGCCCTCAGCAGGAGGGG - Exonic
906848700 1:49223981-49224003 TGTGTGGTCCTGGGCTTAATTGG + Intronic
907436977 1:54456259-54456281 AGTGTGGCCCAGAGCAGAACAGG + Intergenic
907784378 1:57597386-57597408 TGTGTAGCACTGGGAAGAAACGG + Intronic
909065366 1:70930186-70930208 TGTGTGGGACTGGGAACAAGAGG + Intronic
909907839 1:81221135-81221157 TGGGTGGCCGTGGGCAGACCTGG - Intergenic
910362483 1:86427498-86427520 TGTGTGCCACTGAGAAGAAGAGG - Intronic
912543044 1:110431292-110431314 TGGCTGTCCCTTGGCAGAAGGGG + Intergenic
915119043 1:153617168-153617190 TGTCTGGGCCTGGGCAGGTGAGG - Intergenic
915460924 1:156070244-156070266 AGCCTGGCCCTGGGGAGAAGAGG + Exonic
915649768 1:157301233-157301255 TGTATGACCCTAGGCAGAACCGG - Intergenic
915661674 1:157410336-157410358 TGTATGGTCCTAGGCAGAACTGG + Intergenic
915720102 1:157978646-157978668 AGTGTGGCCCTGGGGAAAATGGG - Intergenic
916023717 1:160815853-160815875 TGTGAGGCCCAGGGCTGAGGAGG - Intronic
918045318 1:180937709-180937731 TGTGTGTCCCTGTGCAGTGGAGG - Intronic
919661716 1:200254223-200254245 TCTGTGGCTCTGGGCAGAATTGG - Intergenic
920049946 1:203157835-203157857 GAGGTGGCCCTGGGCAGCAGAGG + Intronic
922616663 1:226964914-226964936 TGTGCTGTCCTGGGCAGCAGGGG + Intronic
924374420 1:243390493-243390515 AGTGTGGCCCGGGGCGGGAGAGG + Intronic
924463916 1:244283564-244283586 TGTGTGCCCCTGGACTGCAGGGG + Intergenic
924467543 1:244312103-244312125 TGGGTGGCTCTGGGCAGAAAGGG + Intergenic
1063950130 10:11214414-11214436 TGTGGGGTCCTGGGCAGACAAGG - Intronic
1064263924 10:13809236-13809258 CGTGTGATCCTGGGCTGAAGGGG - Intronic
1064278376 10:13928694-13928716 GGGGTGTCCCTGGGCAGGAGAGG + Intronic
1065342602 10:24722197-24722219 GGAGTGGCACTGGGAAGAAGGGG - Exonic
1067338496 10:45382696-45382718 TGGGAAGCCCGGGGCAGAAGGGG - Intronic
1067437287 10:46287151-46287173 GGTGTGGCCCCGGGCATAAGGGG + Exonic
1067573562 10:47389108-47389130 TGTTTAGCCCTGGGGAGAGGAGG + Intergenic
1067937052 10:50622274-50622296 TGTTTTGGCCTGTGCAGAAGGGG - Intronic
1067945295 10:50685120-50685142 TCTGTGGTCCTGGGGAGGAGAGG - Intergenic
1069476362 10:68736479-68736501 TGTGGGGCCCAGGGCAGGATTGG - Intronic
1069716997 10:70527585-70527607 TGTGTGGCCCTTTCCAGAAAAGG + Intronic
1069908105 10:71744048-71744070 TGTGTCTCCTTGGCCAGAAGTGG + Intronic
1070371009 10:75781925-75781947 TGTTTGGCCCTGGGGTGATGGGG + Intronic
1070866805 10:79711992-79712014 TCTGTGGTCCTGGGGAGGAGAGG - Exonic
1070880595 10:79850113-79850135 TCTGTGGTCCTGGGGAGGAGAGG - Exonic
1071633717 10:87234215-87234237 TCTGTGGTCCTGGGGAGGAGAGG - Exonic
1071647165 10:87366431-87366453 TCTGTGGTCCTGGGGAGGAGAGG - Exonic
1072626936 10:97118597-97118619 TGTGTTCTCCTGGGCAGAAGAGG - Intronic
1072640192 10:97205791-97205813 TGTGTGGCTCTGGGATGCAGTGG + Intronic
1072966707 10:99979992-99980014 TGAGTGGACCTGAGCAGGAGAGG - Intronic
1074071802 10:110078627-110078649 TGTGTAGCCTTGGGTAAAAGTGG + Intronic
1074156453 10:110804366-110804388 TGTGTGTCTCTGGGCCAAAGGGG + Intronic
1075482032 10:122790005-122790027 TGTGGGGCCCTGGCCAGGGGTGG - Intergenic
1075758920 10:124840417-124840439 TGCTTGACCCTGGGCAGCAGAGG - Intergenic
1076232716 10:128835118-128835140 GGTGCTGCCCTGGGCTGAAGGGG - Intergenic
1076381818 10:130028672-130028694 GCTGTGGCCCTGGGCAGAGTGGG + Intergenic
1076593460 10:131608601-131608623 TGTTTGCTCCTGGGAAGAAGTGG + Intergenic
1077183762 11:1227560-1227582 TGTTGGGCCCTAGGCAGGAGTGG + Intronic
1077486936 11:2843269-2843291 TGTGTGGAGCTGGGCACAAGTGG - Intronic
1078090171 11:8260095-8260117 TGTGGGGGACTGGGCAGGAGAGG - Intronic
1079701283 11:23551739-23551761 TGTTTCTCCCTTGGCAGAAGAGG - Intergenic
1080267713 11:30418984-30419006 TGTGTAGCCCTAGCCAGAAAAGG + Intronic
1080761149 11:35249973-35249995 TGTGTTGCCTTTGGCAGGAGTGG + Intergenic
1082816730 11:57514449-57514471 TCTGGGGACCTGGGCAGATGCGG - Intronic
1083823292 11:65184313-65184335 GGTGTGGCGCTGGGCCAAAGTGG - Intronic
1084004659 11:66316615-66316637 TGTGTGGCCCTGGAGGCAAGTGG - Exonic
1084204989 11:67586025-67586047 TGTCTGGCCTGGGGCAGACGGGG + Intronic
1084289559 11:68153074-68153096 TGTGAGGCCCTGAGCAGCTGGGG - Intergenic
1084356358 11:68641363-68641385 TGGCTGGCCCTGAGCAGCAGGGG + Intergenic
1084466599 11:69326808-69326830 TGTGTCTACCTGGGGAGAAGTGG - Intronic
1084709051 11:70832724-70832746 TGCAAGGCCCTGGGCAGAAGAGG - Intronic
1085045108 11:73348078-73348100 AGTGTGGACCTGAGCTGAAGTGG + Intronic
1087175483 11:95091252-95091274 GGTGTGGTCCTGGGCAGCTGTGG - Intronic
1088751391 11:112844910-112844932 TGTGAAGTCCTGGGCAGCAGGGG - Intergenic
1089460470 11:118650204-118650226 TGTGTGGCCCTGGGGTGCTGGGG + Intronic
1091634315 12:2185790-2185812 TGTGTGGCCCTGGGCAGAAGCGG + Intronic
1093235313 12:16603223-16603245 TGTTTGGCCTTGGGCATAAAAGG + Intronic
1095978184 12:47954099-47954121 TGGGTGGGCCTGGGCAGAGGGGG - Intergenic
1096404974 12:51337155-51337177 TGTTTGGCCCTTAACAGAAGAGG - Intronic
1096524530 12:52202684-52202706 TGCGTGGACCTTGGCAGAGGCGG - Intergenic
1097147358 12:56950966-56950988 TGGGTGGCCTTGGGGAGCAGTGG - Intergenic
1097182644 12:57179989-57180011 GGTGTGGGGCTGGGAAGAAGAGG + Intronic
1097360144 12:58650664-58650686 TGTGTGGCCTTGGGATCAAGAGG - Intronic
1098205852 12:68109119-68109141 GGGGTGGTCCTGGGCAGAATAGG - Intergenic
1098387812 12:69937108-69937130 TGTGTGTCCCTAGGAGGAAGAGG - Intronic
1101298503 12:103452164-103452186 TGTTTGGCTATGGGCTGAAGTGG + Intronic
1101580682 12:106038741-106038763 TGGGAGGCCATGGCCAGAAGAGG - Intergenic
1101639603 12:106578554-106578576 TGTGGGTCCCTGGGAAAAAGGGG + Intronic
1101930129 12:109006966-109006988 TGTGTGGCCAGTGGGAGAAGAGG + Intronic
1101953729 12:109196227-109196249 TGTGTGCTCCTGGGCAGAGCTGG + Intronic
1102346277 12:112163256-112163278 GGTGTGGGCCTGGGGAGGAGAGG + Exonic
1103167661 12:118784064-118784086 TGTGTGCCACTGGGCAGTGGGGG - Intergenic
1103397548 12:120619509-120619531 TGAGTGTCCCTGGGAGGAAGAGG + Intergenic
1103551944 12:121744354-121744376 TCTGTGGCCCTGGGCGGTGGAGG + Intronic
1103902202 12:124309135-124309157 TGTGTGGCCCTGGGGCCCAGTGG + Intronic
1104844797 12:131841366-131841388 TGTGTGGCCTTATGCAGAAAAGG + Intronic
1105014253 12:132776523-132776545 TGTGAGGCGCTGGGCACAGGCGG - Intronic
1105014270 12:132776602-132776624 TGTGAGGCGCTGGGCACAGGCGG - Intronic
1105029476 12:132872825-132872847 AGACTGGCTCTGGGCAGAAGCGG + Intronic
1105484045 13:20809074-20809096 TGTGTGTACCTTGTCAGAAGAGG + Exonic
1107549956 13:41464937-41464959 GGTGGGCCCCTGGGCAGGAGAGG + Intronic
1108415802 13:50197078-50197100 TGACTGGCCCTGGATAGAAGTGG + Intronic
1109630106 13:65034385-65034407 TGGGGCGCCCAGGGCAGAAGTGG - Intergenic
1113592683 13:111512201-111512223 TGTGAGGCCCTGGACAAAAAGGG + Intergenic
1113773893 13:112931255-112931277 TGCGTGACTCTGGGCAGGAGTGG + Intronic
1114727811 14:24957169-24957191 TCTGTGGCCATGGCCAGAAAAGG + Intronic
1114756274 14:25263607-25263629 TTTGGGGACCTGGGTAGAAGAGG - Intergenic
1116769028 14:49105797-49105819 TGTGTGGCAGTGGGCAACAGGGG - Intergenic
1116997099 14:51335559-51335581 TGGGTGGCCAGGGGCAGATGGGG + Intergenic
1118710196 14:68512570-68512592 TGTGGGGGCCAGGGCAGAGGTGG - Intronic
1119566850 14:75636240-75636262 TGTGAGGCCCTGGTCAGACCAGG + Intronic
1119804881 14:77476107-77476129 TTTGTGGCCCTTTGCAGATGTGG - Exonic
1122151128 14:99726779-99726801 TGGGTGGCCGTGGGCAGCAGAGG - Exonic
1122159057 14:99769507-99769529 TGCATGGCCCTGGGGAGAATGGG - Intronic
1122189753 14:100031826-100031848 TGTGTGGCCCTGGGAGAAACAGG + Intronic
1122213432 14:100188041-100188063 GGCGTGAACCTGGGCAGAAGAGG - Intergenic
1122284441 14:100642324-100642346 TGGGGGGCCCAGGGCAGAAGAGG + Intergenic
1122374359 14:101248395-101248417 TGCCTGGCCCCGGGGAGAAGGGG - Intergenic
1122771641 14:104100312-104100334 TGTGGGGCCGTCAGCAGAAGCGG + Intronic
1122871346 14:104640468-104640490 TCAGTGGGCCTGGGCAGCAGAGG - Intergenic
1123724207 15:23086077-23086099 TGTGGGGAACTGGGCAGATGGGG - Intergenic
1126235956 15:46384482-46384504 TATGTGGCCAGGGGGAGAAGGGG - Intergenic
1127521262 15:59745332-59745354 AGAGTGGCCATGGGGAGAAGGGG + Intergenic
1127820401 15:62649674-62649696 TGAGTGGCCTTGGGCATAGGTGG + Intronic
1128053685 15:64684350-64684372 TGTGAGGGCCTGGGCAGGGGTGG - Exonic
1128518360 15:68358413-68358435 TGGGTGGCCCTGTTCAGAAGTGG + Intronic
1129253638 15:74321910-74321932 TGCGTGGCCCTTGGCAGATGAGG + Intronic
1129274029 15:74433775-74433797 TAGGTGGCCCTGGGCGGAGGCGG + Exonic
1130053010 15:80499400-80499422 TCTGTGGCCTTTGACAGAAGAGG - Intronic
1130923140 15:88365770-88365792 TCTGGGGTCCTGGACAGAAGGGG - Intergenic
1130943374 15:88530778-88530800 TTTGTGGCGCCGGGCAGAACAGG - Exonic
1132644481 16:992468-992490 TGGGGGTCCCTGGGTAGAAGGGG + Intergenic
1132654249 16:1035260-1035282 AGTGTGGGGCTGGGCAGAGGAGG + Intergenic
1132714932 16:1285520-1285542 TGCGTGGGCCTGGGAAGCAGGGG - Intergenic
1132769135 16:1551342-1551364 TGACTGGCCCTGGGGAGGAGGGG - Intronic
1132788642 16:1672480-1672502 TGGGTGGCCCTGGGATGAAACGG + Intronic
1133314628 16:4875046-4875068 TGGATGGCTCAGGGCAGAAGAGG - Exonic
1136153334 16:28366192-28366214 TGGTGGGCCCTGGGCAGTAGGGG - Intergenic
1136164801 16:28446369-28446391 TATCTAGCCCTGGGCAGAAAAGG + Intergenic
1136198165 16:28668612-28668634 TATCTAGCCCTGGGCAGAAAAGG - Intergenic
1136209752 16:28749075-28749097 TGGTGGGCCCTGGGCAGTAGGGG + Intergenic
1136214511 16:28782788-28782810 TATCTAGCCCTGGGCAGAAAAGG - Intergenic
1136259233 16:29062632-29062654 TATCTAGCCCTGGGCAGAAAAGG - Intergenic
1136274299 16:29169419-29169441 GGTGAGGCCCCGGGCAGCAGGGG + Intergenic
1137705318 16:50531626-50531648 GGTGTGGCCAGGGTCAGAAGAGG - Intergenic
1138455182 16:57116881-57116903 TGTGTTGCTGTGGGCAGCAGGGG + Intronic
1138491790 16:57381392-57381414 TGTGTGTTCACGGGCAGAAGGGG - Intronic
1138567806 16:57846212-57846234 TGGGTGGGGCTGGGCAGTAGAGG + Intronic
1139255523 16:65538068-65538090 AGTTTGGCCCTGGGCACAAAGGG + Intergenic
1139327686 16:66164793-66164815 GGTGGGGCCCTGGGCAGGTGCGG - Intergenic
1139663077 16:68435539-68435561 TCTGTGGCCCTCGGCAGAACTGG - Intronic
1139923269 16:70472629-70472651 TCTGTGGGCCTGGGCAGCTGGGG + Intronic
1140143898 16:72286798-72286820 TCTGTGAGCCTGGGAAGAAGAGG - Intergenic
1140803306 16:78508804-78508826 GGGGTGCCCCTGGTCAGAAGGGG + Intronic
1141073200 16:80977419-80977441 TGTTTTCCCCTGGGCAGAAGGGG + Intronic
1141141151 16:81497634-81497656 TGTCTGGGCCTGGGCAGCCGAGG + Intronic
1141413425 16:83852046-83852068 TGTGGTGCCTTGGGCAGGAGGGG + Intergenic
1141485889 16:84340005-84340027 GCTGTGGCCCTGGGCTGATGGGG + Intergenic
1141979900 16:87543596-87543618 GGTGTAGCACTGGGCAGGAGAGG + Intergenic
1142078583 16:88135065-88135087 GGCGAGGCCCCGGGCAGAAGGGG + Intergenic
1142388091 16:89779692-89779714 CATGTGGCTCTGGGCAGAAATGG + Intronic
1142480193 17:214261-214283 TGTGTGGCCCAGTGCAGAGAGGG - Intronic
1142709025 17:1713667-1713689 TGTGTGACAGTGGGAAGAAGTGG - Intergenic
1142813349 17:2406886-2406908 TGAGTGGCCTGGGGCAGAACAGG - Intronic
1142848751 17:2694389-2694411 CCTGTGGCCCTGGCCAGGAGTGG + Intronic
1143047725 17:4095593-4095615 TGTGTGCCCCTGGCCACAAAAGG + Intronic
1143293959 17:5856706-5856728 TTTATGGACCTGGGAAGAAGAGG - Intronic
1143467296 17:7146085-7146107 AGTGTGGCCCTGCGCTGGAGAGG + Intergenic
1144426197 17:15144608-15144630 GGTGAGTCCCTGGGCAGAGGTGG + Intergenic
1145207456 17:20992142-20992164 TGTGTGGCCTTTGACTGAAGTGG - Intergenic
1145239629 17:21232904-21232926 TGGGTCTGCCTGGGCAGAAGGGG - Intergenic
1146475311 17:33157900-33157922 TGTGAGCCCCTGGGGAGAAGTGG - Intronic
1146655016 17:34629949-34629971 AGTGTGTCCCAGGACAGAAGGGG + Intronic
1146665822 17:34702639-34702661 TGTGAGGCTCTGGACACAAGGGG - Intergenic
1146887517 17:36482642-36482664 TGTGTGGCCCTTGTTAGAGGCGG - Intergenic
1147418456 17:40310028-40310050 AGTGTGGCCCAGGCCAGAACAGG + Intronic
1148461483 17:47841254-47841276 GGGGCGGCCCTGGCCAGAAGCGG - Exonic
1148463006 17:47848800-47848822 TGTGTTGGCCTGGGCAGCTGGGG - Intronic
1148777348 17:50103058-50103080 TGTGTGGGACTCGGCACAAGTGG + Intronic
1148984603 17:51610809-51610831 TGTTTTGCCCAGGGCAGAATTGG + Intergenic
1150208072 17:63424207-63424229 TGAGAGACCCTGGGGAGAAGCGG - Exonic
1150523633 17:65897122-65897144 TGTGTGTCACTAGGGAGAAGAGG + Intronic
1150640775 17:66948094-66948116 TGTGGGGCCCTGGGCTGAGAGGG - Intergenic
1151875635 17:76866836-76866858 TGTGTGGCCCAGGGGAAGAGGGG + Intergenic
1152335902 17:79700197-79700219 TGGGGGGCCCTGGGCAGGTGGGG - Intergenic
1152488101 17:80608809-80608831 TGAGTGCCCTTGGGCAGATGCGG + Intronic
1152642077 17:81453553-81453575 TGTGTGGCTGTGGGCAGTGGAGG + Intronic
1152797594 17:82315761-82315783 TGTGTGGCCGTGGGAAGGGGAGG - Intronic
1153707367 18:7759675-7759697 TATGTGGCCCTGTGCACAATAGG + Intronic
1154313338 18:13284280-13284302 TCTCAGGCCATGGGCAGAAGTGG - Intronic
1155565920 18:27133878-27133900 GGTGTGGCGCTGTCCAGAAGTGG + Intronic
1156487279 18:37474438-37474460 TGTGTGGCCTTGGGGTGACGGGG + Intronic
1157424950 18:47576884-47576906 TGGGTGGCCCTGGGCAGGCTGGG + Intergenic
1157502858 18:48203148-48203170 AGTGAGGCCCCGGGCAGAAAAGG - Intronic
1157591733 18:48840292-48840314 TGTAGGGCCCAGAGCAGAAGTGG + Intronic
1158241103 18:55379472-55379494 AGTGTGTCCCTGGGAAGCAGAGG + Intronic
1158416875 18:57256647-57256669 TGTGGGGCCCTGGCCAGGGGTGG + Intergenic
1158747464 18:60217983-60218005 TTTGTAGACCTGGGCAAAAGAGG + Intergenic
1160583409 18:79900225-79900247 GATGTGGCCTTGGGCAGAGGTGG - Intergenic
1160697877 19:493436-493458 TGTGTTGCCCTGAGGGGAAGGGG - Intronic
1160808415 19:1002500-1002522 TGGATGGCACTGGGCACAAGGGG + Intronic
1161383767 19:3980283-3980305 TCTGTGTCCCTGGGCACAGGTGG - Intronic
1161583832 19:5094549-5094571 TCTGTGGGCGTGGGAAGAAGGGG + Intronic
1161615572 19:5268445-5268467 TGGGTGGCCGTGGACAGAGGTGG + Intronic
1162329251 19:10017318-10017340 TCTCTGAACCTGGGCAGAAGGGG + Intronic
1162798853 19:13100237-13100259 TGTGTGGCCGTGGTCCTAAGTGG + Intronic
1162907305 19:13831474-13831496 TGGGGGGCCCTGAGCAGTAGGGG - Exonic
1162909251 19:13840556-13840578 GCTGTGGCCCTGGGCAGAGCAGG - Intergenic
1163368190 19:16887947-16887969 TGAGGGGCCTTGTGCAGAAGAGG + Intergenic
1163447152 19:17353417-17353439 TGTGAGGACCTGAGCAGACGGGG - Intronic
1163727262 19:18929721-18929743 AGGATGGCTCTGGGCAGAAGAGG - Intronic
1163727776 19:18932368-18932390 TGGGTGGCGCTGGGCTGAGGCGG + Intronic
1163828105 19:19535083-19535105 TGTGTGGCCCGGAGCAGAACGGG + Exonic
1164099751 19:22044285-22044307 TGTCAGGACCCGGGCAGAAGAGG + Intergenic
1164724113 19:30453736-30453758 TGGGTGGGCCTGGGCAAAACGGG + Intronic
1164794742 19:31016463-31016485 TCTCTTGCCTTGGGCAGAAGAGG - Intergenic
1165243985 19:34487461-34487483 TGGGAGGCCCTGGGCAGAGCAGG + Intronic
1165954005 19:39490301-39490323 AGTGTGGCCCTGGGGTAAAGGGG + Exonic
1167107155 19:47437002-47437024 TGTTTGGCTCTGGGCTGAACCGG - Intronic
1167510377 19:49892695-49892717 TCTGAGGTCCTGGCCAGAAGGGG - Intronic
1168297138 19:55382974-55382996 TGTGTGGCCTTGGGCAAATGTGG + Intronic
1168540236 19:57203894-57203916 TGTGTGGCCATGGCCAGGCGCGG + Intronic
927212013 2:20644877-20644899 AGTGTGGTCCTGGGAGGAAGCGG - Intronic
927640665 2:24843614-24843636 TATGTGGCTCTTGTCAGAAGAGG + Intronic
928938737 2:36706500-36706522 TGTGTGGCCCTGGGAGGAGCAGG - Intronic
929248658 2:39729616-39729638 TGTGTTACCCTTGTCAGAAGGGG - Intergenic
929563000 2:42967567-42967589 TGTCAGGCCCTGGGCAGGGGTGG - Intergenic
931345490 2:61441486-61441508 TGTGTGGCCCTGGGCTCCAGAGG - Intronic
931994788 2:67829594-67829616 TGTGTGACCTTGGGCAGGAAGGG - Intergenic
932522451 2:72427833-72427855 TGGGTGGCCATGGGCAGGACTGG - Intronic
932579311 2:72983198-72983220 CGTGTGGCCTTGGGGAGAAGGGG + Intronic
933972859 2:87484124-87484146 TCTGTGGCCCTGGGCTGATGTGG - Intergenic
934570972 2:95373135-95373157 TGTGTGGCCCAGGGGAGACAGGG + Intronic
936056639 2:109266901-109266923 TGTATGTCCCTGAGCAGGAGAGG + Intronic
936269420 2:111037386-111037408 TCTGTTGCCCTGGGGAGAGGGGG + Intronic
936320862 2:111466089-111466111 TCTGTAGCCCTGGGCTGATGTGG + Intergenic
936525172 2:113236504-113236526 TGTGGGGCCCTGGCCTGGAGAGG - Intronic
937297410 2:120817980-120818002 TGTGAGGCCCTGGGCAAACCAGG - Intronic
937447903 2:121974442-121974464 TGTGTGGCTCTGGGCAAACCAGG + Intergenic
937916376 2:127101080-127101102 CAAGTGGCCCTGGGCAGCAGAGG + Intronic
937989341 2:127653724-127653746 TGTGGGTCCCTGGGCAGATGAGG + Intronic
938201641 2:129377268-129377290 AGTGAGGCCCTGGGCAGACAGGG - Intergenic
938727976 2:134123449-134123471 TGTATGACCCTGGGAAGGAGAGG - Intronic
939017631 2:136920513-136920535 TGGGTGGCCATGGGCAGACCTGG + Intronic
944584073 2:201158223-201158245 TGTGTGGTGCAGGGCAAAAGAGG - Intronic
945019596 2:205557570-205557592 TGTGTGGCCTTGGGCAGTGATGG + Intronic
947797420 2:232903487-232903509 TGGGTGGCCCAGGACAGGAGTGG + Intronic
948030150 2:234810858-234810880 GGTTTTGCCCTGGGCAGTAGGGG - Intergenic
948444676 2:238023065-238023087 TGTGAGGGCCTCCGCAGAAGGGG + Intronic
948685965 2:239669946-239669968 TGAAGGGCCCTGGTCAGAAGTGG + Intergenic
948815294 2:240507398-240507420 TGGGTGGCCCTGGGTGGCAGGGG - Intronic
948888014 2:240893464-240893486 TGCGTGGCCCACGGCAGATGAGG - Intronic
1168760235 20:345832-345854 TATGTGGCCTTGGCCAGACGCGG + Intergenic
1169266131 20:4168244-4168266 TGTGGTGCCCTCGGCAGCAGGGG - Intronic
1170755853 20:19206364-19206386 TTTGAGGCCCTGGGCAAGAGGGG + Intergenic
1171305535 20:24102645-24102667 TGTGTGGCCATGGGCAGGATGGG - Intergenic
1171968571 20:31549121-31549143 AGTCAGGACCTGGGCAGAAGGGG + Intronic
1172106072 20:32518033-32518055 TGTGTGTCCCTCGGCAGGACAGG - Intronic
1172278197 20:33692369-33692391 GCTGTGGCCCTGGTCAGAGGAGG - Intergenic
1172811125 20:37649147-37649169 TGTGTGTCATTGGGCAGAGGAGG - Intergenic
1173228682 20:41177378-41177400 TCTGTGGCCATGAGCAGAAAAGG + Intronic
1174002203 20:47383034-47383056 TGAGTGGCCCACTGCAGAAGAGG + Intergenic
1175767472 20:61601415-61601437 TGTGGGGCACTGGGCACCAGAGG - Intronic
1175913331 20:62414754-62414776 TGTGTGGACCTGGCCAGAGGTGG + Intronic
1175970287 20:62682922-62682944 TGTGTGGCCCTGGACTGGCGAGG - Intronic
1176093596 20:63329609-63329631 TGGGCAGCCCTGGGCAGCAGGGG + Exonic
1176178956 20:63740766-63740788 TGTGCGTCTCTGTGCAGAAGAGG + Intronic
1176377799 21:6095435-6095457 TGTCTTGCCCTGGCCAGAGGCGG + Intergenic
1177993451 21:28066705-28066727 TGTCTTTCCCAGGGCAGAAGTGG + Intergenic
1177996745 21:28109194-28109216 TGTGTGGCAGTGGGGAGAGGTGG + Intergenic
1179745675 21:43442813-43442835 TGTCTTGCCCTGGCCAGAGGCGG - Intergenic
1180228707 21:46413411-46413433 GGTCTTGCCCTGGGCAGAGGCGG + Intronic
1180967290 22:19797280-19797302 TCTGTGGCCCTGGGCAGTTCTGG + Intronic
1181324878 22:22037055-22037077 TGGGTGGGGCTGGGCAGATGAGG - Intergenic
1181439357 22:22927802-22927824 TGTGCAGCCCTGGGCAGCTGTGG - Intergenic
1181720822 22:24773121-24773143 TGTGTGGCCCAGAGCAGTGGAGG - Intronic
1181855378 22:25777679-25777701 ATTGTGGCCCTGGGCTGGAGTGG + Exonic
1182084578 22:27552530-27552552 TGTGTGTGCGTGCGCAGAAGGGG - Intergenic
1182548741 22:31090130-31090152 GGTGGGGCTCTGGGCAGCAGGGG - Exonic
1182742339 22:32577108-32577130 GATTAGGCCCTGGGCAGAAGTGG + Intronic
1183398816 22:37589031-37589053 TGTGTGGCCCAGGGCAGAGCTGG - Intergenic
1183500460 22:38175709-38175731 TGTGGGGTGCTGGGGAGAAGAGG - Intronic
1184527848 22:45036047-45036069 TGTGTAGCCCTGGGCGGGTGTGG - Intergenic
1184868837 22:47220200-47220222 GGTGTGGCACAGGGCAGAGGAGG - Intergenic
1184923098 22:47619612-47619634 TGTGTGTTCCTGGGAAGAGGGGG + Intergenic
949515174 3:4800974-4800996 TATGTGGCCCTTTCCAGAAGTGG - Intronic
950744113 3:15073436-15073458 TGTTGGGCCCAGGGCAGAAATGG - Exonic
951225756 3:20119492-20119514 TTTGTGGCATTGGGCAGGAGTGG + Intronic
951918044 3:27822492-27822514 TTTGGGGCCTTTGGCAGAAGAGG - Intergenic
953603181 3:44387662-44387684 TGGCTGGCCCTTGGCAGATGTGG + Intronic
954106202 3:48410994-48411016 TGTGGGGCCTGGGGCAGGAGAGG - Exonic
954385658 3:50242547-50242569 TGGGTGGGGCTGGGCAGACGGGG - Intronic
954654372 3:52185035-52185057 TTTGTGACCCTGGGCAGCTGTGG + Intergenic
954753752 3:52827940-52827962 TGTGTGGCAGTGGGCAGGAGGGG + Intronic
955189602 3:56748116-56748138 TGTTTGAGCCTGGGAAGAAGAGG - Intronic
955957621 3:64306481-64306503 TGTGTGTGCATGGGCAGAGGAGG + Intronic
958543788 3:95513374-95513396 TATGTAGGCCTGGGCAGCAGTGG + Intergenic
960682425 3:120263193-120263215 TGGGTGGCCCTTGGCAGGTGTGG + Intronic
960987555 3:123290620-123290642 TGTGAGGCCCTGAGTAGCAGAGG - Intronic
961465238 3:127077295-127077317 GGTGTGCACCTGGGCAGTAGGGG + Intergenic
961866354 3:129956152-129956174 TCTCTGGCTCTGGGCAGATGGGG - Intergenic
964388031 3:156170001-156170023 TGAGTAGCCTTGGGCAGTAGAGG - Intronic
964409338 3:156382035-156382057 TGTGTGGCCCTAGGTACAATAGG + Intronic
965632453 3:170747153-170747175 TCTGTGTCACTGAGCAGAAGGGG + Intronic
965928664 3:174014948-174014970 TGAGTGGCCATGAGCAGTAGGGG + Intronic
965966745 3:174500938-174500960 TGTTTGAACCTGGGCAGAGGAGG - Intronic
966432175 3:179843840-179843862 TGTGTGTCCATGGGAGGAAGGGG - Intronic
968664994 4:1816138-1816160 TGTGGTGCCCTGGGCAGATGAGG + Intronic
968691397 4:1992164-1992186 GGTGTGTGCCTGGGCAGCAGGGG + Intronic
968729786 4:2264272-2264294 TGTGTGGCAGTGGGCAGCACAGG + Intergenic
968854092 4:3105670-3105692 TGTGTGCCCCAGGACAGCAGGGG + Intronic
970319779 4:14863570-14863592 CGTGTGGCCTGGGGAAGAAGAGG - Intergenic
970440299 4:16075985-16076007 AGCGTGTTCCTGGGCAGAAGAGG + Exonic
970612970 4:17742732-17742754 TGTGTAGCCCTCAGCAGAAAGGG - Intronic
970650074 4:18167999-18168021 AGTGTGCCCCAGAGCAGAAGTGG + Intergenic
970837104 4:20422603-20422625 TGAGAGGCAGTGGGCAGAAGGGG + Intronic
972773368 4:42219012-42219034 TGTGTGGCCATGAGCAGCGGGGG - Intergenic
973242332 4:47970196-47970218 AGTGTGGCCCTGGATAGAGGGGG + Intronic
974906484 4:68064549-68064571 TGTGTGGCCTTGGGCAGAACAGG - Intronic
974943340 4:68494857-68494879 AGTGTAGTCCTGAGCAGAAGAGG + Intronic
977836270 4:101649111-101649133 TGTGAGGACCTGGGGAGAAATGG + Intronic
978112033 4:104975658-104975680 TGTTTGCCCCTAGGCAAAAGGGG + Intergenic
979269413 4:118742753-118742775 TGTGTGTGCCTGGGCAGGCGTGG - Intronic
980581417 4:134758527-134758549 CGAGTGGCCCTGTGCAGGAGAGG + Intergenic
981602000 4:146500450-146500472 TGTGTGTAGCTGGGTAGAAGGGG - Intronic
986558219 5:9033133-9033155 TTTGTGGCACTGGGTGGAAGAGG + Intergenic
988913647 5:35870804-35870826 TGTCTGGCCCAGGGTGGAAGTGG + Intronic
989125563 5:38049284-38049306 TGGTTGGCACTGGGCAGAACGGG - Intergenic
989235440 5:39142846-39142868 TTTGTGGCCCTGGACAGTATTGG + Intronic
991686844 5:69189509-69189531 GGTGGGGCCCTGGGCGGAAGGGG + Intergenic
992653213 5:78882229-78882251 TGATTAGCCCTGGGGAGAAGGGG + Intronic
996085781 5:119303724-119303746 TGTGTGGCCCTGCTTGGAAGAGG - Intronic
997409653 5:133681277-133681299 TGTGAGGCCTGGGCCAGAAGCGG + Intergenic
997884319 5:137616618-137616640 TTTGTGCCCCTGGACAGAGGAGG - Intergenic
998004694 5:138649195-138649217 TGTGTGGCCGTGTGCACCAGTGG - Intronic
999030798 5:148288824-148288846 TGAGTGTCCGTGGGCAGAGGAGG + Intergenic
999729394 5:154464749-154464771 TGTGGTGCCCAGGGCAGAACAGG - Intergenic
1000257417 5:159553190-159553212 AGAGTGGCACTGGGTAGAAGGGG - Intergenic
1000335164 5:160236621-160236643 CCCGTGGGCCTGGGCAGAAGAGG - Intronic
1001287557 5:170435047-170435069 TGTCTGGGCTGGGGCAGAAGGGG + Intronic
1001374899 5:171246800-171246822 TGTGTGACCATGGGCACATGTGG + Intronic
1001883818 5:175270521-175270543 TGGGTGGCTCTGGAGAGAAGGGG - Intergenic
1001955558 5:175846095-175846117 TGTGTGTGCATGGCCAGAAGTGG - Intronic
1003175360 6:3750029-3750051 TGTGAGGCTCTGGGGAGCAGAGG + Intronic
1003628864 6:7768437-7768459 TGTTTTGCCCTGGGCAGAGTGGG + Intronic
1003979111 6:11372848-11372870 TATGTGGCCATGGGCAGAGGAGG - Intronic
1004205279 6:13586771-13586793 TGTGTGGCTCTGGGCTTATGAGG + Intronic
1005856287 6:29865476-29865498 CATGGGCCCCTGGGCAGAAGTGG + Intergenic
1006611096 6:35295024-35295046 CGTGTGGCACTGGGTAGATGGGG + Intronic
1007745639 6:44041421-44041443 TCTGTGGCCCAGGACAGTAGTGG + Intergenic
1009496151 6:64350505-64350527 TGTATGGATCTGGGCATAAGAGG + Intronic
1010010020 6:71038552-71038574 TATGTGGTCCTGGGAATAAGAGG + Intergenic
1010791530 6:80070500-80070522 GGAGTGGCACTGGGAAGAAGGGG - Intergenic
1014052733 6:116974762-116974784 TGTGTAGCCCTGAGGATAAGAGG - Intergenic
1014391906 6:120873752-120873774 TGGGTGGCCATGGGCAGACCTGG - Intergenic
1014764718 6:125393191-125393213 TGGGTGGCCTTGGGTAGAGGTGG + Intergenic
1016376583 6:143427395-143427417 TGTGTGCCTCTGCCCAGAAGGGG - Exonic
1016492691 6:144624630-144624652 TGACTGGGGCTGGGCAGAAGGGG + Intronic
1017821086 6:158049501-158049523 AGTGAGGCCTTGGGCAAAAGTGG - Intronic
1017824101 6:158069026-158069048 TGTGTGGACCTGGGGTGCAGGGG + Intronic
1018601819 6:165552264-165552286 TGCCTGGCTCTGGGCAGAAAAGG + Intronic
1018683063 6:166280846-166280868 TGTGTGACACTGGTCAGAGGAGG + Intergenic
1018721774 6:166578329-166578351 TGGGTGGCCCTAGGAAGTAGTGG + Intronic
1019148027 6:169987124-169987146 TGGGTGGGCCTGGGCAGGTGTGG - Intergenic
1019377321 7:699739-699761 TGGGTGGCCATGGGCTGCAGTGG + Intronic
1019512862 7:1426733-1426755 TGTGTGGGCCTGGGTTGATGGGG + Intergenic
1019716231 7:2540745-2540767 TGTGGGGCCGTGGGGAGCAGGGG - Intronic
1019739124 7:2664101-2664123 AGGGTGGCCCTGGGGACAAGAGG + Exonic
1020274724 7:6617085-6617107 TGGGTGGCCCGAGGCAGAGGTGG + Intronic
1021027657 7:15687933-15687955 TTTGGGGCCCCGGGCAGAATAGG - Intergenic
1021970309 7:25959255-25959277 TATGTGGGCCTGGGGAGATGTGG - Intergenic
1022148990 7:27579299-27579321 TATGTGGCACGGGGCTGAAGGGG + Intronic
1024291432 7:47807401-47807423 TGAATGGACCTGGGGAGAAGGGG + Intronic
1027218419 7:76198935-76198957 TCTGTGGCCCTATCCAGAAGTGG + Intergenic
1027228820 7:76260724-76260746 CGAGTGGCCCTGGGGAGGAGGGG + Intronic
1029441904 7:100591445-100591467 TGTTTGACCCTGGGCTGAGGTGG + Intronic
1029519480 7:101051046-101051068 TGTGTGGATCATGGCAGAAGAGG + Intronic
1029540558 7:101179910-101179932 TGGGAGGGGCTGGGCAGAAGGGG + Intronic
1032239204 7:130148136-130148158 GGTGTGGCCCTGTGAAAAAGAGG - Intergenic
1032696784 7:134344096-134344118 TGTCTGGCCCTTGTGAGAAGGGG - Intergenic
1033141981 7:138835551-138835573 TGTATGGCCCTGAGCGGAACTGG + Intronic
1034091769 7:148370567-148370589 TGTGTGGCACTGTGCGGAAGAGG - Intronic
1034972084 7:155425528-155425550 TTTGTGGCTCTGGGCTGAGGTGG - Intergenic
1034998087 7:155591046-155591068 TGTGTGGCTCTCAGCAGAAAGGG + Intergenic
1035372380 7:158387625-158387647 TGTGAGGCCCTGGGAAGACGCGG + Intronic
1036478963 8:9120732-9120754 TGTGTGGCAGTGGCCAGCAGGGG + Intergenic
1036725406 8:11216363-11216385 TGTGGGGCCCTGGGCACTAGAGG - Intergenic
1037892863 8:22633080-22633102 TGGCCGGCCCTGGGCAGAACTGG + Intronic
1037931288 8:22881817-22881839 TGTGTGGCCGTGAGCAGGTGGGG + Intronic
1039043677 8:33431055-33431077 TGTGTGGGCCTGGGTAGAGACGG + Intronic
1039604056 8:38866457-38866479 TGTGTGGCCCTGTTCCTAAGAGG + Intergenic
1039665183 8:39517907-39517929 TGAGTGGCCCCGGCCAGGAGGGG + Intergenic
1041376525 8:57212710-57212732 TGAGTGGTCCAGAGCAGAAGGGG + Intergenic
1043404578 8:79917304-79917326 GGTGTGGCCCTGGGAAGGGGTGG + Intergenic
1045432082 8:102123886-102123908 TGGGGCGCGCTGGGCAGAAGGGG - Intronic
1045758568 8:105574822-105574844 TGCGTGTGCCTGGGCAGCAGTGG - Intronic
1047445225 8:124913481-124913503 TGGGTGGAACTGGGCTGAAGGGG - Intergenic
1048672372 8:136737217-136737239 TGTCTGGCCCTGGGCTGATGAGG + Intergenic
1048868183 8:138776185-138776207 CGTCTGGGCCTGGGCAGCAGAGG + Intronic
1049015882 8:139919774-139919796 TGTGTGGCCCAGAGCAGGTGCGG + Intronic
1049264564 8:141660517-141660539 TGGGAGGTCCTGGGAAGAAGTGG + Intergenic
1049565908 8:143338888-143338910 TGAGTGGCCTGGGGAAGAAGAGG - Intronic
1049571333 8:143371578-143371600 AGTGTGGCCCTGGCCAGAGTGGG - Intronic
1049619915 8:143593436-143593458 TGGGTGGGACTGGGCAGGAGGGG + Intronic
1049802697 8:144525532-144525554 TGTGGGGGCCTGGGCAGAGCTGG + Intronic
1053016811 9:34666394-34666416 TGTATGACCCTGGGCCGAGGAGG + Intergenic
1055319979 9:75073653-75073675 TGTTTGAACCTGGGCAGCAGAGG + Intronic
1057353630 9:94318936-94318958 TCTGTGGTCCTGGGGAGGAGAGG + Exonic
1057654121 9:96938656-96938678 TCTGTGGTCCTGGGGAGGAGAGG - Exonic
1058606569 9:106729653-106729675 TCTGTGGCACTGGGCAGGATGGG - Intergenic
1058610270 9:106768793-106768815 TGGGTGTCTTTGGGCAGAAGGGG - Intergenic
1059459070 9:114418284-114418306 TGTGTGGGGGTGGGGAGAAGAGG + Intronic
1060520317 9:124290560-124290582 TGGTTTGCCCAGGGCAGAAGTGG + Intronic
1061111528 9:128575533-128575555 TGTGTTGCCTTGGGCAGGAAGGG + Intronic
1061433985 9:130549019-130549041 TGTTTGGGCCTGGGAAGAGGAGG + Intergenic
1061497123 9:130981517-130981539 TCTGTGGCCCTGAGGGGAAGTGG - Intergenic
1062129598 9:134885370-134885392 AGTGTGGGGCTGGGCAGAGGCGG + Intronic
1062133529 9:134912990-134913012 AGTGTGGGGCTGGGCAGAGGCGG - Intronic
1062181799 9:135194976-135194998 TGAGTGGTCCTGGGCAGGTGTGG - Intergenic
1062254685 9:135615332-135615354 GGTGTGGGCCGGGGCAGAGGAGG - Intergenic
1062344461 9:136108520-136108542 TGTATGGCCACAGGCAGAAGAGG - Intergenic
1062348689 9:136128057-136128079 TGTGGGGCCCTGCGCAGATGGGG + Intergenic
1062359303 9:136180004-136180026 TGTGGGCCCCTGGGCAGACCAGG + Intergenic
1062361729 9:136191513-136191535 TGGGATGCCCTGGGCAGAAAAGG - Intergenic
1062364941 9:136203990-136204012 TGGGTGGCCCTCGGCAGCACAGG + Intronic
1185736202 X:2498724-2498746 TGTGTGGGCCCTGGCAGAAGAGG - Intronic
1187133740 X:16527109-16527131 TCTGTGGCCCTACCCAGAAGGGG + Intergenic
1187526669 X:20060866-20060888 TGTCTGTGCCAGGGCAGAAGTGG - Intronic
1187528913 X:20079159-20079181 ACTGTGGCCCTGTGAAGAAGTGG + Intronic
1188859894 X:35244190-35244212 TATGGGCTCCTGGGCAGAAGGGG - Intergenic
1189395911 X:40622791-40622813 TGTGTGTCCTCTGGCAGAAGTGG - Intergenic
1189409467 X:40757010-40757032 TGTGTTGCCCTGTGGAGAACTGG - Intergenic
1190679245 X:52810999-52811021 TGTGGGGTCCTGGGCAGGGGAGG + Intergenic
1191178228 X:57529523-57529545 TGTGTGGCCCTGGAAATGAGAGG - Intergenic
1192591888 X:72367269-72367291 CATGTGGGCCTGGGCAGAGGAGG - Intronic
1198633519 X:138669670-138669692 TGTGGGGGCCAGGGGAGAAGGGG - Intronic
1200178978 X:154138943-154138965 TGTAGGGGCCAGGGCAGAAGCGG - Intergenic
1200866819 Y:8052691-8052713 TATGTGGCTCTGGCCACAAGTGG + Intergenic
1200900229 Y:8424118-8424140 TATGTGGCTCTGGCCACAAGTGG - Intergenic
1202251394 Y:22877233-22877255 TATGTGGTCCTGGCCACAAGTGG - Intergenic
1202404382 Y:24510982-24511004 TATGTGGTCCTGGCCACAAGTGG - Intergenic
1202466397 Y:25159100-25159122 TATGTGGTCCTGGCCACAAGTGG + Intergenic