ID: 1091634381

View in Genome Browser
Species Human (GRCh38)
Location 12:2186157-2186179
Sequence CATCCCACGCTAATTGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091634381_1091634384 -10 Left 1091634381 12:2186157-2186179 CCAGGACCAATTAGCGTGGGATG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1091634384 12:2186170-2186192 GCGTGGGATGGTTGCAATAAAGG 0: 1
1: 0
2: 0
3: 3
4: 59
1091634381_1091634385 10 Left 1091634381 12:2186157-2186179 CCAGGACCAATTAGCGTGGGATG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1091634385 12:2186190-2186212 AGGTCTCCCTTCCCGACATGTGG 0: 1
1: 0
2: 0
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091634381 Original CRISPR CATCCCACGCTAATTGGTCC TGG (reversed) Intronic
912180157 1:107209605-107209627 CCTCCCACATTAATAGGTCCAGG + Intronic
917796493 1:178536704-178536726 GATCTCAATCTAATTGGTCCAGG - Intronic
1084585778 11:70061341-70061363 CAGCCCACACTAATTTGGCCAGG - Intergenic
1088759704 11:112917803-112917825 CATCCCATGCCAAATGATCCTGG - Intergenic
1091634381 12:2186157-2186179 CATCCCACGCTAATTGGTCCTGG - Intronic
1094468790 12:30782937-30782959 CTTCCCACACCAATTGCTCCTGG + Intergenic
1103953873 12:124566373-124566395 CGCCCCACGCTAATTGGGCCCGG + Intronic
1111530425 13:89529828-89529850 CATCAGCCCCTAATTGGTCCTGG + Intergenic
1127921091 15:63494679-63494701 CATCCCCCTCAAATGGGTCCTGG - Intergenic
1138435083 16:56994110-56994132 CTTCCCACCCAAAATGGTCCTGG - Intronic
1154198020 18:12280261-12280283 CATCCCACGCGCATGCGTCCTGG + Intergenic
926787385 2:16531501-16531523 CTTCCCATGCTGATTTGTCCTGG - Intergenic
1173284375 20:41656906-41656928 CATCCTATGCTGATTGGTGCAGG + Intergenic
950227747 3:11249799-11249821 CTTCCCAGACTAATTGATCCCGG + Intronic
951657087 3:25021470-25021492 CATCCCATGCTAATGGGATCTGG + Intergenic
954443225 3:50533069-50533091 CCTTCCATCCTAATTGGTCCAGG - Intergenic
962037093 3:131663604-131663626 AATCCCACACTCAGTGGTCCTGG - Intronic
964558212 3:157964274-157964296 CTTCCCACAATGATTGGTCCAGG - Intergenic
966295386 3:178414870-178414892 CATCACATGATAATTGGTACAGG + Intergenic
968981761 4:3853963-3853985 CACTCCACGCCTATTGGTCCTGG + Intergenic
969353716 4:6613138-6613160 CAGGCCATGCTGATTGGTCCAGG - Intronic
970797523 4:19931330-19931352 TATCCCAAGCAAATTGGTGCAGG + Intergenic
975492235 4:75002009-75002031 CATCCCAGGCTAATGCATCCTGG - Intronic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
985031852 4:185797255-185797277 CATCCCTCGCTCATTTCTCCCGG + Intronic
986245668 5:6004476-6004498 CATCCTGCGCTGATGGGTCCTGG + Intergenic
999458468 5:151737522-151737544 CATGCCCAGCTAATTTGTCCTGG + Intergenic
1012307602 6:97677696-97677718 CTTCCCACTCTCATTGGTCTGGG + Intergenic
1016935364 6:149445700-149445722 TATCCCACAGTGATTGGTCCAGG + Intergenic
1019360494 7:602134-602156 GACCCCACGCTAACTGGGCCAGG + Intronic
1021784412 7:24137764-24137786 CATGCCATGCTAATTGGAGCAGG + Intergenic
1053060641 9:35028568-35028590 CATCACAAGCTAAGAGGTCCAGG + Intergenic
1058423414 9:104855140-104855162 CATACCAAGCGAAGTGGTCCTGG - Intronic
1059743504 9:117178543-117178565 CATCCCTCACTAACTGCTCCAGG + Intronic
1061765999 9:132881895-132881917 CACCTCACCCTAGTTGGTCCTGG + Intronic
1190429430 X:50365139-50365161 CATGCCACTGTAATTGCTCCAGG - Intergenic
1192880323 X:75276005-75276027 CATCCCAAGCTAAGGGGGCCAGG - Intronic