ID: 1091635916

View in Genome Browser
Species Human (GRCh38)
Location 12:2196544-2196566
Sequence AGCTGTGTTATGCACTAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091635916_1091635917 -9 Left 1091635916 12:2196544-2196566 CCTGTTTAGTGCATAACACAGCT 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1091635917 12:2196558-2196580 AACACAGCTGACACACTATATGG 0: 1
1: 0
2: 0
3: 6
4: 115
1091635916_1091635918 10 Left 1091635916 12:2196544-2196566 CCTGTTTAGTGCATAACACAGCT 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1091635918 12:2196577-2196599 ATGGTTGCCATAAATCATAATGG 0: 1
1: 0
2: 0
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091635916 Original CRISPR AGCTGTGTTATGCACTAAAC AGG (reversed) Intronic
906501724 1:46346228-46346250 AGCTGTCTTCCTCACTAAACTGG - Intronic
914994103 1:152525814-152525836 AGCTGTGTTTAGCACTAATCAGG - Intronic
915024175 1:152811753-152811775 AGCTGTGATATCCTCTACACTGG - Intronic
919371698 1:196736174-196736196 GGCTGTGCAATGCATTAAACTGG + Intronic
920427900 1:205892979-205893001 AGCTGTGCTATGCACTCTCCTGG - Intergenic
921721280 1:218474471-218474493 AACTGTGCTCTGCACAAAACAGG + Intergenic
924011687 1:239672055-239672077 AGATGAGTTATGCACAAGACAGG + Intronic
1071727591 10:88215598-88215620 ATCTGTCTGATGCACAAAACTGG - Intergenic
1073439073 10:103541792-103541814 AGCTGTACTATGCAGAAAACCGG + Intronic
1073880968 10:107979818-107979840 AGCTCAGTTATTCTCTAAACTGG - Intergenic
1074717942 10:116236825-116236847 ATCTGTCTTCTCCACTAAACAGG + Intronic
1075482474 10:122794300-122794322 AGATGTGTTCTGCAATAAGCAGG + Intergenic
1076435421 10:130438028-130438050 TGCTGTGTTTTGCAGTAAAGTGG - Intergenic
1081278287 11:41178026-41178048 AGCCCTGTCATGCACTAAATAGG - Intronic
1081756330 11:45547414-45547436 AGCTCTGTGATGGACTAAACAGG - Intergenic
1083066162 11:59925806-59925828 AGCTGTGCTATGCACTCTCCTGG - Intergenic
1086061393 11:82703219-82703241 GGTTTTGTTATGCTCTAAACAGG + Intergenic
1088492134 11:110398493-110398515 AGCTGTGCTATGCACTCTCCTGG - Intergenic
1091196045 11:133731440-133731462 ACCTGGGTCATGCACTAAATAGG + Intergenic
1091635916 12:2196544-2196566 AGCTGTGTTATGCACTAAACAGG - Intronic
1092351585 12:7760380-7760402 AGCTGGTTTATACACAAAACGGG + Intergenic
1094356141 12:29579755-29579777 AGCTGTTTTATGTGCTGAACTGG - Intronic
1095185668 12:39198054-39198076 AGCTGTGCTATGCACTCTCCTGG + Intergenic
1095912896 12:47447129-47447151 AGCTGTGCTATGCACTCTCCTGG + Intergenic
1096308068 12:50496558-50496580 AGCTGTGCTATGCACTCTCCTGG + Intergenic
1101501369 12:105307492-105307514 AGCTGTGCTATGCACTCTCCTGG + Intronic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1109245281 13:59947137-59947159 AGCTGTGTCATGCTCGAAAGTGG - Intronic
1111138271 13:84080282-84080304 AGCTGTGTCATGTTCCAAACAGG + Intergenic
1114967915 14:27986566-27986588 TGCTGGGTTATTCACTAAACAGG + Intergenic
1115833486 14:37370534-37370556 AGCTGTGTAATTCACTAAGCTGG + Intronic
1116624374 14:47246207-47246229 AGCTGTGTTTTGCACATAATTGG - Intronic
1117754445 14:58959293-58959315 AGCTGTGCTAGGCTCTAATCTGG + Intergenic
1122031389 14:98915182-98915204 AGCTATGTTCTGCAATAAATTGG + Intergenic
1127732437 15:61813252-61813274 AGCTATTTCTTGCACTAAACTGG - Intergenic
1132278999 15:100596233-100596255 AACTGTGTCATGCACTAGACAGG + Intronic
1132352751 15:101150024-101150046 GGCTGTATTATGCACTCGACGGG + Intergenic
1132876364 16:2140331-2140353 AGCTGTATTGTACACAAAACAGG + Intergenic
1133698180 16:8284867-8284889 ACATTTGTTTTGCACTAAACGGG + Intergenic
1133893340 16:9902559-9902581 AGCTGAGTTAAGCAGTCAACTGG + Intronic
1135166297 16:20141969-20141991 AACTGTGGTTTGCACTAGACCGG - Intergenic
1136233819 16:28902890-28902912 AGATGTGCAATGCACTGAACAGG + Exonic
1138178027 16:54920160-54920182 AGTTGTGTCCTGCAATAAACTGG - Intergenic
1140613774 16:76634707-76634729 AGCTTTGTTAAACCCTAAACGGG - Intronic
1143727396 17:8858774-8858796 AGCTGTGTTCTGCACTTAGTGGG + Intronic
1157986062 18:52438816-52438838 AGTTGTGTTATGCAATAAGAGGG + Intronic
1162910723 19:13846786-13846808 AGCTGTGTTATGGACTGAGCCGG + Intergenic
1164261928 19:23575693-23575715 AGCTGTGCTATGCACTCTCCTGG + Intronic
1166963894 19:46516156-46516178 AGGTGTGTGAAGCACTTAACAGG - Intronic
930523816 2:52500906-52500928 AGTTGTGTTAGCCAGTAAACAGG + Intergenic
930633566 2:53781057-53781079 AACTGTGCTAAGCACTGAACAGG + Intronic
930918356 2:56721280-56721302 AGCTGTGCTATGCACTCTCCTGG - Intergenic
931753411 2:65350515-65350537 AGTTGTGTTATGAGCAAAACTGG + Intronic
936799780 2:116252957-116252979 AGCTGTGCTATGCACTCTCCTGG - Intergenic
938081731 2:128373814-128373836 AGCTGTGGGGTGCACTGAACTGG + Intergenic
940301442 2:152179967-152179989 AGCTGTGCTATGCACTCTCCTGG + Intergenic
940532286 2:154893806-154893828 AGATGTGTTATGTGCAAAACAGG - Intergenic
941374295 2:164707986-164708008 AACTGTGTTAGGTACTAAAGAGG + Intronic
942835335 2:180289057-180289079 TGTTGTGGTATGCACTTAACTGG + Intergenic
945068471 2:205967364-205967386 ACCTGTGTCAGGTACTAAACAGG - Intergenic
946206681 2:218113996-218114018 AGCTGTGCTATGCACTGTCCTGG - Intergenic
1169820959 20:9709467-9709489 AGCTTTGTTAAGAAGTAAACAGG - Intronic
1170904660 20:20502719-20502741 AACTGTGATATGCACTCACCTGG - Intronic
1170985157 20:21251262-21251284 AGCTGTGGTAGTCAATAAACGGG + Intergenic
1172825335 20:37778296-37778318 AGCTGTGTTATTCTAAAAACAGG + Intronic
1178862302 21:36299584-36299606 AGCTGTTTTATGAAACAAACAGG + Intergenic
953250600 3:41243254-41243276 AGCTGTGTTTTGGAATAAAATGG + Intronic
954358373 3:50102410-50102432 AGATGTGTTTTTCACTAAAATGG - Intronic
956499510 3:69866712-69866734 AGCTTTGTTATGAATAAAACAGG + Intronic
959453670 3:106533784-106533806 AGATGTGGTACTCACTAAACAGG - Intergenic
963778499 3:149464029-149464051 ACCTGCGTGATGCACTACACCGG - Intergenic
970612335 4:17737246-17737268 AGCTGTGTTATGTACAAACAAGG + Intronic
972080388 4:35142023-35142045 AGCTGTGCTATGCACTCTCCTGG - Intergenic
972487020 4:39551538-39551560 ATCTGTGTCATGGATTAAACTGG - Exonic
980114697 4:128667820-128667842 CCCTGTGTTAGGAACTAAACTGG + Intergenic
982992447 4:162295475-162295497 AGGTGGGTTATGCAATAAAATGG - Intergenic
984158034 4:176216036-176216058 AGAAGTATTATGCACTAAAAGGG + Intronic
985306853 4:188552307-188552329 AGCTAAGTTATTCACTAAACCGG - Intergenic
985500906 5:244425-244447 AGCTGTGCTATGCACTCTCCTGG - Intronic
988450179 5:31334158-31334180 GGCTGTTTTATGCACTCCACAGG + Intergenic
990024714 5:51172316-51172338 AGCTGTGTGTTGCACAAAAGTGG - Intergenic
990306926 5:54503121-54503143 AGCTGTGCTATGCACTCTCCTGG + Intergenic
997892664 5:137688764-137688786 AGCTATCATATGCATTAAACGGG + Intronic
997945635 5:138198372-138198394 AGCTCTTTTGTGCACTAATCTGG - Intronic
998779272 5:145638259-145638281 TGCTGTGTTCCCCACTAAACGGG + Intronic
1004306893 6:14509301-14509323 AACTGTGTTATGCATTGAGCAGG + Intergenic
1004653732 6:17637406-17637428 AGGTTTATTTTGCACTAAACAGG + Exonic
1007419192 6:41709142-41709164 AGCTGTGTTATTGAATGAACAGG - Intronic
1009250432 6:61291955-61291977 AGCTGTGCTATGCACTCTCCTGG + Intergenic
1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG + Exonic
1022056319 7:26738870-26738892 AGCTGTGATCTGCAATAAAGAGG + Exonic
1023804577 7:43863429-43863451 AGCTGTGCTATGCACTCTCCTGG + Intergenic
1025122707 7:56318671-56318693 AGCTGTGCTATGCACTCTCCTGG - Intergenic
1026809726 7:73453221-73453243 AGCAGTGTTCTGCATTAAAATGG - Intronic
1028878955 7:95857409-95857431 AGATATGTTATTCTCTAAACAGG + Intronic
1029216305 7:98952880-98952902 AGCTGAGTCATGCAAGAAACTGG - Intronic
1030631849 7:111904577-111904599 AGCTGTGTTATGAGCTAAACAGG - Intronic
1036008909 8:4698407-4698429 AGCTCTGTTCTGCATAAAACAGG + Intronic
1037220071 8:16508108-16508130 TGCTGGGATATGCACGAAACAGG + Intronic
1042111076 8:65381234-65381256 ATCTGTGTTCTTCTCTAAACTGG - Intergenic
1044442552 8:92238833-92238855 AGCTGTGTTATGCACTCTCCTGG - Intergenic
1044949731 8:97423960-97423982 AGCTATGTTAGGGACTAAAGGGG - Intergenic
1045240941 8:100400844-100400866 AGCTGTGTTGTGCTTTAAAAGGG - Intronic
1049857656 8:144873326-144873348 AGCTGTGCTATGCACTCTCCTGG - Intergenic
1051257469 9:15229521-15229543 AGGTTTGTTATGCACAACACTGG - Intronic
1051526683 9:18052770-18052792 AGCTGTGTTTTGTACTAGAGTGG + Intergenic
1057629534 9:96708029-96708051 AGCTGTGTAATGCACTTATCTGG - Intergenic
1058927439 9:109681078-109681100 AGCTGTGCTAATCACTAAACTGG - Intronic
1059978479 9:119743456-119743478 CACTGTGTTAAGCACTATACAGG - Intergenic
1060860821 9:126953520-126953542 AGCTGTGTCATCTACTACACAGG - Intronic
1061602763 9:131682630-131682652 AGCTGTGCTATGCACTCTCCTGG - Intronic
1192734222 X:73833154-73833176 AGCTGTGTTCTGCTTTAAAAAGG + Intergenic
1197503357 X:127269698-127269720 AGCTTTGTTATACAGTAATCTGG + Intergenic
1199657473 X:150010851-150010873 AGCTGTGCTGTGCTCCAAACAGG - Intergenic
1202132650 Y:21627934-21627956 AGCTGTGTTATACACTCTCCTGG + Intergenic