ID: 1091637266

View in Genome Browser
Species Human (GRCh38)
Location 12:2206586-2206608
Sequence CAGTGAGTAGGTAGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 6, 3: 37, 4: 498}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091637266_1091637274 29 Left 1091637266 12:2206586-2206608 CCCACCTCCCTACCTACTCACTG 0: 1
1: 0
2: 6
3: 37
4: 498
Right 1091637274 12:2206638-2206660 TCTCTCTTGAATAGCCAGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091637266 Original CRISPR CAGTGAGTAGGTAGGGAGGT GGG (reversed) Intronic
900366312 1:2313280-2313302 CCGTGGGGAGGTGGGGAGGTAGG + Intergenic
900598783 1:3494269-3494291 CAGTGAAGTGGTGGGGAGGTGGG - Intronic
900941818 1:5803813-5803835 GGGTGAGTAGGTGGGTAGGTTGG - Intergenic
900984657 1:6066325-6066347 AAGTGAGGAGGTGGGGAGTTGGG - Intronic
901181984 1:7348133-7348155 CAGTGAGAAGACAGAGAGGTAGG - Intronic
901327455 1:8376552-8376574 TGGTAAGTAGGTAGTGAGGTGGG - Intronic
901352711 1:8611905-8611927 GAGGGAGTAGTGAGGGAGGTAGG - Intronic
902322177 1:15675747-15675769 CAGTAGGTAGGTAGGTAGGTAGG - Intergenic
902322178 1:15675751-15675773 CAGGCAGTAGGTAGGTAGGTAGG - Intergenic
902412834 1:16221486-16221508 AAGTGAGTAGACAGGCAGGTGGG + Intergenic
902809215 1:18878870-18878892 CCATGAGTAGGGAGGGAGGAGGG - Intronic
902990563 1:20184782-20184804 GAGGGAGGAGGGAGGGAGGTGGG + Intergenic
903607405 1:24584959-24584981 CAGTGAGTGGGTGGGCGGGTGGG + Intronic
903868573 1:26415891-26415913 CAGAAAGTTGGTAGAGAGGTAGG + Intronic
904853022 1:33473241-33473263 GGGTAAGTAGGTAGGTAGGTAGG - Intronic
904853023 1:33473245-33473267 CAGTGGGTAAGTAGGTAGGTAGG - Intronic
905029737 1:34873972-34873994 CATTTAGTTGGTAGGGAGATTGG - Intronic
905346130 1:37312295-37312317 CTGGGAGTAGGTAGGGATCTGGG - Intergenic
905371303 1:37483927-37483949 CAGAGGGTGGGGAGGGAGGTGGG + Exonic
905656698 1:39690538-39690560 GAGGGAGGAGGTATGGAGGTTGG + Intronic
905930569 1:41784023-41784045 CAGGGAGTAGGTAGGGAAGAAGG + Intronic
906126835 1:43432082-43432104 CAGTGACCAGGTTGGGAGCTGGG - Intronic
906289123 1:44608410-44608432 AGGTGAGTGGGTAGGTAGGTAGG + Intronic
906784770 1:48605307-48605329 CAGAGAGTAGGAAATGAGGTTGG - Intronic
906799509 1:48723919-48723941 CAGTGAGTAGGGGCTGAGGTAGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907190915 1:52647933-52647955 AAGTGAGAAGGTTGGAAGGTTGG + Intronic
908176844 1:61564446-61564468 CTGGGAGTAGGTAGAGAGATGGG + Intergenic
909618402 1:77639065-77639087 CGGTAGGTAGGTAGGTAGGTAGG + Intronic
909799475 1:79787953-79787975 CAGGGATTGGGCAGGGAGGTGGG + Intergenic
910041378 1:82855778-82855800 AAGTGATTAGGTCAGGAGGTTGG + Intergenic
911190092 1:94939849-94939871 CATTGAGTAGGTTGGGAAGGTGG - Intergenic
911985972 1:104622154-104622176 CTTTGAGTAGGCTGGGAGGTAGG + Intergenic
912002679 1:104855528-104855550 GGGTAAGTAGGTAGGTAGGTAGG - Intergenic
913395790 1:118370400-118370422 GAGAGAGGAGGGAGGGAGGTGGG - Intergenic
914437189 1:147670488-147670510 CCCTGAGTAGGTGAGGAGGTGGG - Exonic
915907458 1:159889268-159889290 GAGGGAGTAGTTAGGGGGGTGGG + Intronic
916452773 1:164937048-164937070 CAGTGAGTTGGGATGGGGGTGGG + Intergenic
916715083 1:167441286-167441308 CACTGAGGAGGCAGGGAGTTGGG - Intronic
916959915 1:169878937-169878959 TAGTGGGTAGGGAGGAAGGTAGG - Intronic
917320969 1:173781034-173781056 GAGGGAGGAGGGAGGGAGGTGGG + Intronic
917570960 1:176265256-176265278 CAGAGAGAAGATAGGTAGGTAGG - Intergenic
918592319 1:186253909-186253931 CAGTAAGTGGGAAGGGGGGTTGG - Intergenic
919772158 1:201169132-201169154 CTGTGTGTAGGTATAGAGGTGGG + Intronic
921165185 1:212502011-212502033 CAGGGAGATGGTGGGGAGGTGGG + Intergenic
921755029 1:218845503-218845525 CAGGGAATAGGGAAGGAGGTAGG + Intergenic
922201379 1:223404416-223404438 CAATGGGGAGGTGGGGAGGTGGG - Intergenic
922471279 1:225878871-225878893 GTGTGTGTAGGTAGGTAGGTAGG - Intronic
923265600 1:232310844-232310866 CAGTGGGTAGATAAGGAGGTGGG + Intergenic
924459602 1:244247235-244247257 CAGTAGGTAGGTAGGTGGGTAGG - Intergenic
924459603 1:244247239-244247261 ATGTCAGTAGGTAGGTAGGTGGG - Intergenic
1063290665 10:4743758-4743780 CATGGAGTAGGTGGAGAGGTAGG + Intergenic
1063947426 10:11191569-11191591 CACTGAGTAGCAGGGGAGGTTGG + Intronic
1064014596 10:11762578-11762600 CGGTGAGGAGGGAGGGAGCTGGG + Intronic
1064341649 10:14491003-14491025 CAGTGACTTGGGAGGGAGGAGGG + Intergenic
1064526309 10:16260381-16260403 GAGGGAGAAGGTAGGAAGGTAGG + Intergenic
1064739318 10:18416127-18416149 CAGGGAGGAGGAAGAGAGGTGGG - Intronic
1064873330 10:19964324-19964346 CAATAAGAAGGAAGGGAGGTTGG + Intronic
1065510990 10:26478332-26478354 CAGTGAGTGGGGCGGGAGGATGG + Intronic
1066350361 10:34631487-34631509 CAGGCAGTAGGTAAGGAAGTGGG - Intronic
1067785448 10:49242406-49242428 CAGTGAGTTGGTAGGGAAGCCGG - Intergenic
1067792327 10:49297820-49297842 AAATGGGGAGGTAGGGAGGTGGG + Intergenic
1067928134 10:50531715-50531737 CAGTGGGCAGGTAGGGAAGGTGG - Intronic
1069462902 10:68611822-68611844 CCATGAGTAGCTCGGGAGGTGGG + Intronic
1069642099 10:69962732-69962754 CTGAGAGGAGGGAGGGAGGTGGG - Intronic
1069842769 10:71350115-71350137 GAGTGAGTCTGTAGGGAGCTGGG - Intronic
1069843119 10:71352358-71352380 CTGTGAGAAGGTAGGCAGGAGGG + Intronic
1070208718 10:74292110-74292132 AAGTAGGTAGGTAGGCAGGTAGG - Intronic
1070379104 10:75863715-75863737 CAATGAGTAGGTGGCGAGCTAGG + Intronic
1070823923 10:79380038-79380060 CAGGCAGGAGGAAGGGAGGTGGG - Intergenic
1071863462 10:89700244-89700266 CAGTTAGTGGGGAGTGAGGTCGG + Intergenic
1071865832 10:89730467-89730489 CTGTGAGTGGGTGGGGAGTTAGG + Intronic
1073075937 10:100825972-100825994 CAGGGAGTCTGCAGGGAGGTGGG + Intronic
1073953736 10:108842568-108842590 TAGTAGGTAGGTAGGTAGGTAGG + Intergenic
1074107664 10:110400460-110400482 CAGGCAGGAGGTAGGGAGGATGG + Intergenic
1074395578 10:113095352-113095374 CACTGGGTAGGATGGGAGGTGGG + Intronic
1074478683 10:113797606-113797628 CAGTGAGTAAATGGGGAGGGTGG - Intergenic
1075730351 10:124631971-124631993 CAGAGGGTAGGTAGGAAGGAAGG + Intronic
1076323281 10:129599968-129599990 AGGTAAGTAGGTAGGTAGGTAGG + Intronic
1076323282 10:129599972-129599994 AAGTAGGTAGGTAGGTAGGTAGG + Intronic
1076330851 10:129665183-129665205 GAGTGGGTAGGTGGGGGGGTGGG - Intronic
1077366351 11:2162846-2162868 GAGTGTGTAGGGAGGGAGGCTGG + Intergenic
1078102856 11:8339925-8339947 CAGGGAGAAGGTAGGCGGGTCGG - Intergenic
1078397890 11:10998083-10998105 CTGGGAGGAGGAAGGGAGGTTGG - Intergenic
1078579100 11:12525145-12525167 GAGTGGGAAGGTAGGCAGGTCGG + Intronic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1078692642 11:13597435-13597457 CAGCGAGGAAGTAGGGAAGTGGG + Intergenic
1078713311 11:13816009-13816031 CCTTGAGTAGGGAGGGAGGTGGG + Intergenic
1080968972 11:37247116-37247138 CAGATAGTAGGTACGTAGGTAGG - Intergenic
1081121249 11:39269062-39269084 CAGTGAATTGCTAGGGAGATAGG - Intergenic
1081655824 11:44856833-44856855 AAGTGTGTAGGGAGGGAGGGAGG - Intronic
1081997863 11:47376651-47376673 CAGGGAGGAGGGAGGAAGGTGGG - Intronic
1083188108 11:61029657-61029679 GTGTGTGTAGGTAGGTAGGTAGG + Intergenic
1083799597 11:65038828-65038850 CAGTGAGTAGGGACTGAGGGTGG + Exonic
1084684863 11:70687584-70687606 CAGTGTGGGGGTAGGGGGGTGGG + Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085073526 11:73570889-73570911 CAGTGACTAAGTAAGGAGATGGG - Intronic
1085667022 11:78422951-78422973 CTGTGAGTGGGTAGGGGGTTGGG + Intergenic
1085829884 11:79888198-79888220 CAGTGACCAGGTAGGGAAGATGG + Intergenic
1086079933 11:82892959-82892981 CACTGAGTAGGTAGGTAGGTGGG + Intronic
1086783652 11:90937738-90937760 CAGTGAGTAGGGTGGGACCTGGG - Intergenic
1087223145 11:95568154-95568176 GACTGAGTAGGTAGGGAGAAAGG + Intergenic
1087704708 11:101477202-101477224 CAGAGAGCAGGCAGGAAGGTTGG - Intronic
1088158314 11:106837138-106837160 GAGTGTGCAGGTTGGGAGGTGGG - Intronic
1088606642 11:111540070-111540092 CAGGGAACAGGTTGGGAGGTGGG - Intergenic
1090407536 11:126486124-126486146 CAGAGTGGAGGAAGGGAGGTGGG + Intronic
1090968613 11:131620342-131620364 TAGTGAATAGGAAGGGAGATGGG - Intronic
1091490644 12:929743-929765 AGGTGAGCAGGTAGGGAAGTAGG - Intronic
1091637266 12:2206586-2206608 CAGTGAGTAGGTAGGGAGGTGGG - Intronic
1092238776 12:6825187-6825209 CAGTGACTAGATGGGGTGGTGGG - Intronic
1094194157 12:27728702-27728724 CAGGAAGAAGGGAGGGAGGTGGG - Intronic
1096912345 12:54996896-54996918 CAGAGAGTAGGTAGACATGTAGG - Intergenic
1097222124 12:57457131-57457153 CAGGGACTAGGGAGGGAGGGAGG + Exonic
1097393163 12:59040471-59040493 GAGTGACTTGGAAGGGAGGTGGG - Intergenic
1097481495 12:60131891-60131913 CAATAACTAGATAGGGAGGTGGG + Intergenic
1098256132 12:68617656-68617678 CACTGAGGAGGCAAGGAGGTTGG - Intronic
1099830132 12:87831948-87831970 AGGTAAGTAGGTAGGTAGGTAGG + Intergenic
1100931511 12:99615140-99615162 CATTAGGTAGGTAGGTAGGTAGG + Intronic
1101219414 12:102621807-102621829 CAGGGACTAAGTAGGGAAGTGGG + Intergenic
1101736378 12:107466325-107466347 CAGTGAGAAGGTGGGGCGCTTGG + Intronic
1102660649 12:114524660-114524682 CAGTTAGAAGGTATGGAGGAAGG - Intergenic
1103174188 12:118847651-118847673 CAGTGACTGTGTAGGGAGGCTGG + Intergenic
1103602629 12:122063867-122063889 CGGTCAGTAGGCAGGGAGGTGGG + Intergenic
1105370128 13:19794919-19794941 CAGTGGGGAGGTAGGCAAGTGGG + Intergenic
1105882455 13:24616250-24616272 CAGTGAGTAGTTATGGAGCCTGG - Intergenic
1105886879 13:24649884-24649906 AAGGGAGGAGGTAGGGAGGAAGG - Intergenic
1106363158 13:29050937-29050959 GAGAGAGGAAGTAGGGAGGTGGG + Intronic
1106780840 13:33057440-33057462 CAGTGAATAGCAAGGGAGATGGG + Intronic
1106808097 13:33332176-33332198 CTGTGGATAGGTGGGGAGGTGGG - Intronic
1108580936 13:51827727-51827749 GAATGGGGAGGTAGGGAGGTGGG - Intergenic
1109452631 13:62538208-62538230 CACTGAGTAGGAGGAGAGGTGGG - Intergenic
1110783238 13:79491110-79491132 CAGGGAGAAAGAAGGGAGGTAGG - Intronic
1110816497 13:79866079-79866101 CAGTGAGAAGGAAGGGTGGTGGG + Intergenic
1111637104 13:90919670-90919692 CAGAAAGAAGGTAGGCAGGTAGG - Intergenic
1112101188 13:96191131-96191153 CAGTGATAATGTAGAGAGGTGGG - Intronic
1112434756 13:99383891-99383913 CAGAGAGTAGAGAGGCAGGTGGG - Intronic
1112676001 13:101702897-101702919 CATTGAGTAGATAGGGGCGTAGG + Intronic
1113295966 13:108959032-108959054 CAGTGAGTAGGTGGGGAGGGTGG + Intronic
1113348204 13:109501885-109501907 CAGTAGGTAGGTAGGTAGGTAGG - Intergenic
1113348205 13:109501889-109501911 TAGACAGTAGGTAGGTAGGTAGG - Intergenic
1113674115 13:112196354-112196376 CAGGGAGGAGGGAGGGAGGGAGG - Intergenic
1113952035 13:114077466-114077488 CATTGAGTGGGGAGGGAGGAAGG - Intronic
1114791627 14:25666141-25666163 CAAGGAGTGGGTAAGGAGGTCGG - Intergenic
1114811828 14:25909796-25909818 AAGTAAGTAGGTAGGAAGGTAGG + Intergenic
1116028004 14:39537543-39537565 CAGTGAGGAGATATGGAAGTGGG - Intergenic
1116169132 14:41376020-41376042 AAGAGAGTGGGTAGGTAGGTAGG + Intergenic
1116338125 14:43685835-43685857 AGGTGGGTAGGTAGGTAGGTAGG + Intergenic
1116581231 14:46644470-46644492 TAGTAAGTAGGCAGGTAGGTAGG + Intergenic
1116994068 14:51304023-51304045 CAGTGAGAAGGAAGGAAGGAAGG - Intergenic
1117303645 14:54452131-54452153 AAGTGAGTAGGTCGTGAGGGTGG - Intergenic
1118072463 14:62260828-62260850 AGGTGGGTAGGTAGGTAGGTAGG - Intergenic
1118469386 14:66061063-66061085 GGGTGGGTAGGTAGGTAGGTAGG + Intergenic
1119180213 14:72600325-72600347 CAGAGAGGAGGGAGGGAGGGAGG - Intergenic
1119479799 14:74952149-74952171 CAGGTGGTAGGTAGGCAGGTGGG - Intronic
1119558052 14:75568434-75568456 CACTGAGAGGGTAGGGAGTTAGG + Intergenic
1119768608 14:77206216-77206238 CATTGAGGGGGTGGGGAGGTGGG + Intronic
1119883031 14:78116567-78116589 CAGTTGGAAAGTAGGGAGGTTGG + Intergenic
1119884049 14:78125368-78125390 GTGTGTGTAGGTAGGTAGGTAGG + Intergenic
1121006999 14:90496709-90496731 CAGTGATGGGGTTGGGAGGTGGG - Intergenic
1122776767 14:104120433-104120455 CAGTGAGTAGGATGGGTGGCAGG + Intergenic
1202920792 14_KI270723v1_random:29127-29149 CAGAGAGTAGGGAAGGAAGTCGG + Intergenic
1202924124 14_KI270724v1_random:8454-8476 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
1123634747 15:22293028-22293050 GAGGGAGTAGTGAGGGAGGTAGG + Intergenic
1125956363 15:43793417-43793439 CAGTGAGGAGGTTGGGAGAAGGG - Intronic
1126429266 15:48563414-48563436 CAGGGAGCAGGCAGGGAGGAGGG + Intronic
1127553817 15:60067464-60067486 AAGTAGGTAGGTAGGTAGGTAGG + Intergenic
1127560540 15:60132341-60132363 GAGGGAGGAGGAAGGGAGGTAGG + Intergenic
1127666974 15:61157335-61157357 CTGTGTGATGGTAGGGAGGTAGG + Intronic
1127854775 15:62945363-62945385 CAGAGAGAAGGAAGGAAGGTAGG - Intergenic
1128322382 15:66702727-66702749 CAGGGAGTAAGAAGGGAGCTGGG + Exonic
1128681274 15:69653652-69653674 CAGTGAATAGGAAAGGAGGCTGG + Intergenic
1129160569 15:73745368-73745390 GAGTGAGTAGGAAAGGAGGGAGG - Intronic
1129610128 15:77046669-77046691 CAGGTAGTAGGTAAGTAGGTGGG + Exonic
1130239372 15:82171715-82171737 TAGAGAGTGGGGAGGGAGGTTGG + Intronic
1131800128 15:96059863-96059885 CTGTGAGGAAGTAAGGAGGTTGG + Intergenic
1131879258 15:96845167-96845189 CATTGAGTAGGCATGGAGCTTGG + Intergenic
1132676357 16:1122930-1122952 CTGTGGGTGGGTATGGAGGTAGG - Intergenic
1132997537 16:2830969-2830991 AAGGGAGAAGGTAGGGAGGACGG - Intronic
1133454511 16:5930720-5930742 GGGTGAGTAGGTGGGCAGGTGGG + Intergenic
1134133114 16:11663224-11663246 CAGTGAGTTTGTAGGGGGGAAGG + Intergenic
1134742583 16:16561070-16561092 GTGTGTGTAGGTAGGTAGGTTGG + Intergenic
1135142573 16:19934418-19934440 AGGTAAGTAGGTAGGTAGGTAGG - Intergenic
1135759580 16:25126340-25126362 CAGAGAGGAGGCAGGGAGGCCGG - Intronic
1138018730 16:53456909-53456931 CTGACAGTAAGTAGGGAGGTAGG + Intronic
1138351422 16:56348036-56348058 CAGTGATGGGGTTGGGAGGTGGG - Exonic
1140076258 16:71701327-71701349 TAGGTAGTAGGTAGGTAGGTAGG - Intronic
1140087714 16:71811286-71811308 ATGTGTGTAGGTAGGTAGGTAGG - Intergenic
1141243078 16:82281024-82281046 CAGACAAGAGGTAGGGAGGTAGG + Intergenic
1141320907 16:83007962-83007984 AAGTAAGTCGGTAGGTAGGTAGG - Intronic
1141490675 16:84370485-84370507 GTGTGAGGAGGGAGGGAGGTGGG + Intronic
1141873935 16:86808706-86808728 AGGAGAGTAGGTAGTGAGGTTGG - Intergenic
1142503170 17:345386-345408 CAATGAGAAGTTAGAGAGGTGGG - Intronic
1142960614 17:3550282-3550304 CCTTGAGTAGGTAGGGAGGTAGG - Intronic
1143785592 17:9253263-9253285 CAGTGAGAAGGTAGGGATACGGG + Intronic
1143961733 17:10726904-10726926 CAGGGAATAAGTAGGGAGGGTGG + Intronic
1144698577 17:17322195-17322217 CAGTGAGTAGGAAGGGCTCTAGG + Intronic
1144727036 17:17507207-17507229 CAGGGAGGAGGGAGGGAGGGAGG + Intronic
1144782765 17:17816186-17816208 CAGTGAGTGGGTTGGGGGGCTGG - Exonic
1145819216 17:27818450-27818472 CAGGGAGTGGGTGTGGAGGTAGG - Intronic
1147427109 17:40351214-40351236 CAGGGAGGGGGTAGCGAGGTGGG - Intronic
1147645223 17:42029193-42029215 CAGTGAGTTGGTAGAAAAGTGGG - Intronic
1147846439 17:43407235-43407257 GAGTGGGGAGGTGGGGAGGTGGG + Intergenic
1148473005 17:47907162-47907184 GAGTGAGTAGGGAAGGAGGGAGG + Intronic
1148620613 17:49031972-49031994 CAGTGAGTGGGCTGGGAAGTGGG + Exonic
1148745723 17:49916899-49916921 CAGAGTGGAGGTAGGGAGGCTGG - Intergenic
1150933476 17:69610657-69610679 CTGTGAGTAGGTAGTGATATAGG + Intergenic
1150999617 17:70359424-70359446 CATTTAGGAGGTATGGAGGTAGG - Intergenic
1151216157 17:72577767-72577789 CAGTGAGTAGGCTTGGAGGGAGG - Intergenic
1151618940 17:75233196-75233218 AAGTGGGTAGTTGGGGAGGTTGG + Intronic
1151986792 17:77548793-77548815 CAGTGGGTGGGTAGGGGGGCTGG + Intergenic
1153108360 18:1554857-1554879 CTGTGAGGAGGTTGGGAGGTGGG - Intergenic
1153951807 18:10064148-10064170 CAGTGGGTAGGTGAGGAGGAAGG - Intergenic
1154286152 18:13058639-13058661 CAGTGAGGAGGGAGGGTGGCTGG + Intronic
1155937660 18:31770937-31770959 GAGTGGGGAGGTAGGGAGATAGG + Intergenic
1156812055 18:41264215-41264237 CAGTGGGTGGGTGGGGAGGGGGG + Intergenic
1157216147 18:45785353-45785375 CAGTGAGGAGGGAGGGGGTTTGG + Intergenic
1157253221 18:46114777-46114799 CAGTGAGCTGGAAGGGAGGAGGG + Intronic
1157474204 18:48011080-48011102 GTGTGAGGAGGTGGGGAGGTAGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158233055 18:55280094-55280116 CAGAGAGGAGGTAGGGAGGGGGG + Intronic
1158240348 18:55370384-55370406 CAGTACATAGGTAGGTAGGTAGG + Intronic
1158577984 18:58656316-58656338 CAGTGAGGAAGGAAGGAGGTAGG - Intergenic
1159254784 18:65931619-65931641 CAGTCAGGAGGCAGGGAAGTAGG - Intergenic
1159310094 18:66696904-66696926 CAGGCATTAGGTAGGTAGGTAGG + Intergenic
1159310095 18:66696908-66696930 CATTAGGTAGGTAGGTAGGTAGG + Intergenic
1159627650 18:70713487-70713509 CAGCAAGGAGGAAGGGAGGTTGG + Intergenic
1159678364 18:71314860-71314882 CAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1160000191 18:75011012-75011034 CAGTGAGTAGGAAGGGTGGTGGG + Intronic
1160265925 18:77340879-77340901 CAGTGAGAAATTAGGGAGGAAGG + Intergenic
1160709496 19:544535-544557 CAGTGAGGGAGAAGGGAGGTGGG + Intronic
1161027446 19:2043083-2043105 CTGTGAGGAGGGAGGGAGCTGGG - Intronic
1161083255 19:2321901-2321923 CAGGGTGCAGGTGGGGAGGTCGG - Intronic
1162322879 19:9980082-9980104 CAGGGAGTGGGCAGGGAGGCAGG - Intronic
1162475479 19:10896861-10896883 TAGTGAGCAGATAGGGAAGTGGG + Intronic
1163798064 19:19348576-19348598 CAGTGGGTAGGTTGGCAGGCTGG - Intronic
1165739252 19:38195822-38195844 CGGTGAGTAGGGACGGAGGGGGG - Intronic
1165768707 19:38366257-38366279 CAGGGAGTGGGTAGGGAAATGGG - Intronic
1165924591 19:39319704-39319726 AAGTAAGTAGGTGGGGTGGTGGG - Intergenic
1166626102 19:44357259-44357281 TGGTAAGTAGGTAGGTAGGTAGG - Intronic
926593154 2:14761123-14761145 CAGTGAGCAAGTGGGGAGGTCGG - Intergenic
926875406 2:17471231-17471253 TAGTGAGAAAGTAGGGAGGCAGG - Intergenic
927904445 2:26847215-26847237 CCGGGATTAGCTAGGGAGGTGGG + Intergenic
929403568 2:41613620-41613642 CGGTGATTAGGTAAGGAGGTAGG + Intergenic
929604113 2:43224283-43224305 CAGTGAGGAGGAAGGGAAGGCGG - Exonic
930003668 2:46879495-46879517 GGGTGAGTAGGTAGGTGGGTGGG + Intergenic
930793855 2:55366619-55366641 AAGTGATTAGGGTGGGAGGTGGG + Intronic
930870491 2:56166125-56166147 CTGTCAGTGGGTAGGGAGCTAGG + Intergenic
931514993 2:63045179-63045201 CAGTGAGTGGGCAGTGGGGTCGG + Exonic
932498828 2:72162227-72162249 CACTAAGTAGCCAGGGAGGTGGG - Intergenic
932846085 2:75137127-75137149 CAGTGAGTATGTAGGCTGTTAGG + Intronic
933778122 2:85784016-85784038 CAGTCAGTAGTCAGGGAGGAAGG + Intronic
934112446 2:88756332-88756354 CAGGGAGGAGGCAGGGTGGTGGG - Intergenic
934576822 2:95407169-95407191 CAGTGACTAGGGAGGGCAGTGGG - Intronic
934639042 2:96015337-96015359 CAGTGACTAGGGAGGGCAGTGGG - Intergenic
934768704 2:96894692-96894714 CAGTGAGTGGGTAGGTAGATGGG - Intronic
934794606 2:97090075-97090097 CAGTGACTAGGGAGGGCAGTGGG + Intronic
935085237 2:99838398-99838420 CAGTGAGGAGGAAGGGAGAGTGG - Intronic
935210874 2:100938582-100938604 CAGAGAGGAGGGAGGGAGGGAGG - Intronic
935983786 2:108652879-108652901 CAGTGAGGAGGCAGGGAGGGAGG - Intronic
936136220 2:109896533-109896555 CAGTGAGGAGGCAGGGAGGGAGG - Intergenic
936163661 2:110102793-110102815 CAGGGAGGAGGCAGGGTGGTGGG - Intronic
936208477 2:110474952-110474974 CAGTGAGGAGGCAGGGAGGGAGG + Intergenic
937311285 2:120904885-120904907 CAGAGAGAAGGGAGGGAGTTTGG + Intronic
937428530 2:121818963-121818985 CATTGAGAGGGTGGGGAGGTTGG + Intergenic
937872865 2:126798424-126798446 AAGAGGGTAGGTAGTGAGGTGGG - Intergenic
938122670 2:128644853-128644875 CAGGGAGGAGGAAGGGAGGAGGG - Intergenic
938730574 2:134143899-134143921 CAGTGAGAAGATAGGGATGTGGG + Intronic
939525720 2:143291389-143291411 GAGTGAGGAGGGAGGGAGGGAGG - Intronic
940290921 2:152076942-152076964 CAGAGAGTAAGCAGGGAGGGGGG + Intronic
940321811 2:152385326-152385348 CAGTTTGTAGGGAGGGAGGCTGG + Intronic
941327908 2:164140844-164140866 CAGAGACTAGGTAGGGAGAAGGG - Intergenic
942956953 2:181784573-181784595 AAGTGATTAGGTAGGTGGGTAGG + Intergenic
943555040 2:189392653-189392675 CAGGGAGGAGGTAGGGAAGATGG + Intergenic
944433653 2:199663224-199663246 CAGCGACTTGGGAGGGAGGTGGG + Intergenic
944722020 2:202433243-202433265 GAGTAAGTAGATAGGTAGGTAGG + Intronic
945499873 2:210558599-210558621 CTGTGAGAAGGTAGGTATGTAGG + Intronic
945806999 2:214501929-214501951 AGGTGAGTCGGTGGGGAGGTGGG - Intronic
946419968 2:219559183-219559205 CAGAGAGGAGGTAGAGAGGTAGG - Intronic
946428625 2:219613245-219613267 CAGTGAGTAAGGGGGGAGATGGG + Intronic
946483845 2:220081703-220081725 CAGTGAGTGGGGAGGCAGGGCGG + Intergenic
947454793 2:230244389-230244411 CAGTGAGTCAGCAGGGATGTGGG - Intronic
948362488 2:237432851-237432873 TAGTGAGTAAGTGGGGAGGCAGG + Intergenic
948389904 2:237604582-237604604 CGGTGGGGAGGTGGGGAGGTGGG - Intergenic
948558418 2:238834256-238834278 GTGTGTGTAGGTAGGTAGGTAGG - Intergenic
1168868529 20:1109296-1109318 CTGTGTGTATGTAGGGTGGTGGG - Intergenic
1168926592 20:1586742-1586764 GAGTGGGTGGGTGGGGAGGTTGG - Intronic
1169241620 20:3986265-3986287 GAGTGAGGAGGGAGGGAGGAAGG - Intronic
1169996480 20:11563200-11563222 AAGGGAGGAGGAAGGGAGGTGGG + Intergenic
1170722680 20:18897661-18897683 CAGGGAGTCGGTGGGGAGGGAGG + Intergenic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1171785872 20:29464168-29464190 AAGGAAGTAGGGAGGGAGGTAGG - Intergenic
1172286715 20:33745853-33745875 GACTGAGTAAGTAGGAAGGTGGG + Intronic
1172898414 20:38316591-38316613 CAGTGAGGAGGTCGGGAGGCAGG + Intronic
1173379057 20:42521116-42521138 GAGTAGGTAGGTAGGTAGGTAGG - Intronic
1173379058 20:42521120-42521142 AGGTGAGTAGGTAGGTAGGTAGG - Intronic
1173955554 20:47029685-47029707 TAGTGAGTAGGCAAGGAGCTTGG - Intronic
1174012321 20:47460067-47460089 CAGATAATAGGTAGGTAGGTAGG - Intergenic
1175558240 20:59890576-59890598 AGGTAAGTAGGTAGGTAGGTAGG + Intronic
1175558241 20:59890580-59890602 AAGTAGGTAGGTAGGTAGGTAGG + Intronic
1175602038 20:60282080-60282102 CAGTGAGCAGGTGGGTAGGTGGG + Intergenic
1175780253 20:61677643-61677665 AAGTGGGTAGGTAGGTGGGTGGG + Intronic
1175929668 20:62487794-62487816 CAGGGAGGGGGTAGGGAGGGCGG - Intergenic
1176251080 20:64120257-64120279 CTGTGAGTAGGACGGGAGGCTGG + Intergenic
1176388224 21:6150359-6150381 CAGGGAGGAGGAAGGGAGGGAGG + Intergenic
1178138375 21:29654130-29654152 GAGTGTGTAGGTGGGGAGGTGGG + Intronic
1179735248 21:43387889-43387911 CAGGGAGGAGGAAGGGAGGGAGG - Intergenic
1179884444 21:44307551-44307573 CAGTGAGCAGTGAGGGGGGTGGG - Intronic
1180057181 21:45365059-45365081 CAGAGAGTAGGAGGGGAGGGAGG - Intergenic
1180182361 21:46123679-46123701 GGGTGAGTAGGTGGGTAGGTGGG + Intronic
1180295233 22:10928452-10928474 AAGGAAGTAGGGAGGGAGGTAGG - Intergenic
1181438385 22:22923266-22923288 CAGGCAGGAGGCAGGGAGGTGGG - Intergenic
1182321347 22:29480138-29480160 CAGTGAGAGGGTGGGGAGGAGGG - Intergenic
1182668357 22:31975092-31975114 GAGTGAGAAGGTGGGAAGGTGGG + Intergenic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1183235620 22:36614650-36614672 CAGAGAGCAGGCAGGGTGGTGGG + Intronic
1183307027 22:37088060-37088082 CAGTGAGTAGGAACAGAGCTGGG + Intronic
1183382894 22:37499261-37499283 CAGCGAGTAGCCAGGGAGGTGGG - Intronic
1183661422 22:39223841-39223863 CAGTAGGTGGGAAGGGAGGTGGG + Exonic
1183730905 22:39617837-39617859 CAGAGAGCAGGGAGGGAGGAGGG - Intronic
1183733486 22:39630970-39630992 CAGGGAGGATGGAGGGAGGTGGG + Intronic
1183763131 22:39843634-39843656 CAGTGAGGAGGGAGGCAGGCAGG + Intronic
1184099082 22:42332248-42332270 CAGGGAGAAGCTTGGGAGGTCGG + Intronic
1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG + Intergenic
1184938031 22:47739395-47739417 TAGTGAGTGGGGTGGGAGGTGGG + Intergenic
1184973441 22:48043980-48044002 CAGTAGGTAGGTAGATAGGTAGG + Intergenic
1184989278 22:48156220-48156242 CAGTGGGTAGGGAGAGAGGGAGG - Intergenic
951526830 3:23661364-23661386 TAGTGAGTGGGTAGGAGGGTTGG + Intergenic
953017902 3:39096029-39096051 CAGGGACTAGGGAGGGAGGCAGG + Exonic
953391350 3:42535699-42535721 CAGTGAGTGGGGAGGGATGAGGG + Intronic
953415146 3:42711543-42711565 CAGGGAGGAGGCAGGGAGGCTGG - Intronic
954695827 3:52425227-52425249 CAGTGGGTAGAAAGGGAGCTTGG + Intergenic
955283682 3:57618132-57618154 AAGTGAGGAGGAAGGGAGGGAGG + Intergenic
955723369 3:61906777-61906799 CTGTAGGTAGGTAGGTAGGTAGG + Intronic
956382686 3:68682702-68682724 CTGTCAGTGGGTAGGGAGCTAGG - Intergenic
956557096 3:70536166-70536188 GAGTGAGGGGGTAGGGGGGTAGG - Intergenic
957080746 3:75633837-75633859 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
958821995 3:98986107-98986129 CAGTGAGTAGCCTGGGAGTTGGG - Intergenic
959244107 3:103841337-103841359 CGGTAGGTAGGTAGGTAGGTAGG - Intergenic
959437207 3:106330601-106330623 CAGGAGGTAGGTAGGTAGGTAGG - Intergenic
960627929 3:119699625-119699647 CTGTGAGAAGATAAGGAGGTGGG + Intergenic
961519144 3:127456743-127456765 CAGAGAGGAAGTGGGGAGGTGGG + Intergenic
961958123 3:130825385-130825407 CAGGGAGGAGGGAGGGAGGGAGG + Intergenic
962905010 3:139793575-139793597 CAGGGAGTAGGTATGGAGTGGGG + Intergenic
963202604 3:142600220-142600242 CAGTGAGGAGGGAGTGAGGCTGG + Intronic
963945270 3:151138996-151139018 TAGTAGGTAGGTAGGCAGGTAGG - Intronic
964514654 3:157494623-157494645 CAGGGAGTAGGGATGCAGGTGGG + Intronic
964626066 3:158761280-158761302 CTGTGTGTTGGTAGGAAGGTAGG + Intronic
965526466 3:169724552-169724574 CAGGGATTAGGGAGGGAGGAAGG + Intergenic
965607101 3:170508460-170508482 CACTGGGTAGGCAGGAAGGTTGG + Intronic
966431081 3:179832347-179832369 TGGTGGGTAGGTAGGCAGGTGGG - Intronic
966431106 3:179832451-179832473 AGGTGGGTAGGTAGGTAGGTGGG - Intronic
966431203 3:179832836-179832858 TGGTGGGTAGGTAGGTAGGTGGG - Intronic
966431218 3:179832896-179832918 ATGTAAGTAGGTAGGTAGGTGGG - Intronic
966886214 3:184379494-184379516 CAGAGAGAAGGTAGGGAGGCAGG + Intronic
967458718 3:189720777-189720799 CAGGGAGCAGATAGGGAGATAGG + Intronic
967753650 3:193143342-193143364 CAGTAGTTAGGTAGGTAGGTAGG - Intergenic
967753651 3:193143346-193143368 CAGTCAGTAGTTAGGTAGGTAGG - Intergenic
968505849 4:971207-971229 CAATGAGTGGGCAGGGTGGTGGG - Intronic
968829521 4:2925663-2925685 CAGGGAGAAGGCAGGGAGGGAGG + Intronic
968948088 4:3676033-3676055 CAATGGGGAGGTGGGGAGGTGGG + Intergenic
969318234 4:6394998-6395020 CAGGGCGGAGGCAGGGAGGTGGG - Intronic
969487050 4:7478200-7478222 CAGTGAGTATGCAGTGATGTGGG + Intronic
969690209 4:8699989-8700011 CAGTGAGGAGGGAGGGAGACGGG - Intergenic
970331315 4:14987236-14987258 TAGTTAGTAGGTAGAGAGCTGGG - Intergenic
970872182 4:20828773-20828795 ATGTGTGTAGGTATGGAGGTAGG - Intronic
971230461 4:24796976-24796998 CAGGGAGTAGGCAGGAAAGTGGG - Intronic
971774598 4:30946471-30946493 CAGTGTGGTGGGAGGGAGGTGGG - Intronic
972111745 4:35570322-35570344 CTGTAAGTAGGGAGGGAGTTGGG - Intergenic
972249156 4:37281016-37281038 GAGAGAGTAGGTAGAGAGGGTGG + Intronic
972674806 4:41250044-41250066 CTGTAGGTAGGTAGGTAGGTAGG - Intergenic
974877156 4:67714691-67714713 CAGTGAGGAAGAAGGAAGGTTGG + Intergenic
976486299 4:85608955-85608977 CAGGGAGTAGGTAGAGAGCCAGG - Intronic
976518354 4:85997511-85997533 AGGTAAATAGGTAGGGAGGTAGG + Intronic
976724402 4:88201625-88201647 CCTTGAGTAGCTAGGGAGTTAGG - Intronic
977754877 4:100656867-100656889 TAGTGAGTTGGTTGGGAGGAAGG + Intronic
977754938 4:100657515-100657537 TAGTGAGTTGGTTGGGAGGAGGG - Intronic
977953740 4:103003039-103003061 CAGTGAGTAGAAGGGGAGGAAGG - Intronic
977982109 4:103336473-103336495 CAGGGAGGAGGAAGGGAGGGAGG - Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978497636 4:109377320-109377342 CTGTGAGTATGTAGAGAGATGGG + Intergenic
978521348 4:109619063-109619085 CAATAAATAGGTAGGTAGGTAGG - Intronic
978607200 4:110493700-110493722 CAGTAAGTGGGTAGGGAGCCAGG - Intronic
980384131 4:132063759-132063781 CAGTGAGGAGGTAAGGAGGGAGG - Intergenic
981959456 4:150518607-150518629 CAATGAGAAGGAAGGGAGGCTGG - Intronic
983404194 4:167304667-167304689 AGGTAAGTAGGTAGGTAGGTAGG + Intergenic
983404195 4:167304671-167304693 AAGTAGGTAGGTAGGTAGGTAGG + Intergenic
983551849 4:169025794-169025816 CAGTGAGCAGTGAGGGAGGACGG + Intergenic
983798893 4:171902621-171902643 CAGTGAGAGGGTAGGGAGGCTGG + Intronic
985828697 5:2212667-2212689 CAGTGAGGAGGTGGAGAGGCTGG + Intergenic
985968949 5:3360347-3360369 CAGTGGGTATTTAGGGAGGAAGG - Intergenic
986740176 5:10699179-10699201 AAGTAGGTAGGTAGGTAGGTAGG - Intronic
986740177 5:10699183-10699205 AGGTAAGTAGGTAGGTAGGTAGG - Intronic
990040901 5:51378021-51378043 CATTTAGCAGGTAGGGAGGCAGG + Intergenic
990993048 5:61703660-61703682 CCTTAAGTAGGTAGGAAGGTTGG - Intronic
992157652 5:73970941-73970963 CAGGGAGTGGGGAGGGAGGAAGG + Intergenic
993371601 5:87099442-87099464 CAGTAAGAATGTGGGGAGGTAGG - Intergenic
996811440 5:127519972-127519994 CAGTGACTGGGTATGGAGGAAGG - Intronic
998022489 5:138781629-138781651 AAGTGAGTAGGAACTGAGGTAGG + Intronic
998502519 5:142645841-142645863 CAGTGACTGTGGAGGGAGGTTGG - Intronic
999269631 5:150289328-150289350 CAGTGTGTATGTAGGGATGAAGG - Intronic
999538100 5:152540927-152540949 AAGGCAGTAGCTAGGGAGGTAGG - Intergenic
1000069798 5:157729645-157729667 CAGCTACTAGGAAGGGAGGTGGG + Intergenic
1000200429 5:159004528-159004550 GAGGTAGTAGGTAGGTAGGTAGG + Intronic
1000200430 5:159004532-159004554 TAGTAGGTAGGTAGGTAGGTAGG + Intronic
1000432797 5:161169994-161170016 AAGGAAGTAGGTGGGGAGGTTGG - Intergenic
1000811061 5:165862640-165862662 TAATGAATAGGTAGGTAGGTAGG + Intergenic
1001291900 5:170469572-170469594 CAGTCAGTAGCTGGGGAGGCAGG - Intronic
1001404279 5:171464663-171464685 CAGCAGGTAGGTAGGTAGGTAGG - Intergenic
1001791116 5:174458648-174458670 GTGTGGGGAGGTAGGGAGGTGGG - Intergenic
1002190738 5:177476173-177476195 CTGTGAGGAGGGAGGGAGGGAGG - Intergenic
1002842356 6:917145-917167 CATTGAGTAGGTTGAGAAGTGGG - Intergenic
1002877049 6:1220010-1220032 CAGTCTGTAGGTATGAAGGTAGG + Intergenic
1004086577 6:12455171-12455193 AAATGGGTAGGTAGGTAGGTAGG + Intergenic
1005582190 6:27245978-27246000 GAGTGAGTGGGGAGGGAGGAAGG - Intergenic
1006338610 6:33433580-33433602 GATTGGGCAGGTAGGGAGGTTGG + Intronic
1006625997 6:35398205-35398227 CAGAGAGTGGGTGGTGAGGTGGG + Intronic
1006774285 6:36580021-36580043 CACTGAGTGGGAAGGGAGGGTGG + Intergenic
1007107698 6:39294996-39295018 AAGTGTGGAGGAAGGGAGGTGGG - Intergenic
1008054538 6:46932751-46932773 CAATGACTCTGTAGGGAGGTGGG - Intronic
1010012287 6:71062212-71062234 CAGAGACTGGGTAGGGTGGTGGG - Intergenic
1012505411 6:99940972-99940994 CAGAGACAAAGTAGGGAGGTGGG - Intronic
1013213083 6:108003990-108004012 CAGAAACTAGGTAGGGAGGCTGG - Intergenic
1014610724 6:123541495-123541517 TAGACAGTAGGTATGGAGGTTGG - Intronic
1014796427 6:125730269-125730291 CACTTAGTATGTAGGGAAGTTGG - Intergenic
1015549515 6:134397558-134397580 AAGTAGGTAGGTAGGTAGGTAGG - Intergenic
1015739676 6:136440396-136440418 GAGTGAGTAGGTATGTGGGTGGG + Intronic
1017056290 6:150438992-150439014 CAGGGAGAAGGGTGGGAGGTGGG + Intergenic
1018143441 6:160862236-160862258 CAGTGTCGAGGAAGGGAGGTGGG + Intergenic
1018621666 6:165734987-165735009 TAGATAGTAGGTAGGTAGGTAGG + Intronic
1018621715 6:165735276-165735298 CAGTTGGTAGGTAAGTAGGTAGG + Intronic
1018621734 6:165735364-165735386 GGGTGGGTAGGTAGGTAGGTAGG + Intronic
1019059094 6:169242827-169242849 CAGTGGGAAGGTGGGAAGGTGGG - Intronic
1019059133 6:169242943-169242965 CAGTGGGAAGGTGGGAAGGTGGG - Intronic
1019059173 6:169243066-169243088 CAGTGGGAAGGTGGGAAGGTGGG - Intronic
1019368853 7:650374-650396 GAGTGAGCAGGGAGGGAGGGAGG - Intronic
1019428123 7:986894-986916 CAGCCAGGAGGTAGGGAGCTTGG - Intronic
1021491802 7:21227145-21227167 GGGTGGGTAGGTAGGTAGGTAGG - Intergenic
1022437840 7:30407183-30407205 CAGTGAGCAGGTGGGAAGCTGGG + Intronic
1023487710 7:40704437-40704459 GGGTGAGTAGTCAGGGAGGTAGG + Intronic
1023558042 7:41443643-41443665 CAGTGAGGAAGGAGGGTGGTGGG + Intergenic
1023736077 7:43237135-43237157 AAGGAAGTAGGTAGGTAGGTAGG + Intronic
1023736078 7:43237139-43237161 AAGTAGGTAGGTAGGTAGGTAGG + Intronic
1023849162 7:44140680-44140702 CAGTGCGCAGGGTGGGAGGTGGG + Intronic
1024094221 7:45971687-45971709 CAGGGAGCAGGGAGGGAGGCAGG - Intergenic
1024136821 7:46417256-46417278 CCATGGGTAGGTTGGGAGGTGGG - Intergenic
1025854770 7:65267309-65267331 CAATGACTAGGTAGAGAGCTGGG - Intergenic
1028622689 7:92842638-92842660 CAGTGAGAAAGTGGGAAGGTGGG + Intergenic
1028987769 7:97021509-97021531 AAGGGAGTAGGACGGGAGGTTGG - Intronic
1029103784 7:98157251-98157273 CGGTAGGTAGGTAGGTAGGTAGG + Intronic
1029374125 7:100167744-100167766 CAGGCAGGAGGAAGGGAGGTTGG + Intronic
1032438390 7:131921190-131921212 CAGTGAGAAGGTAGAAAGGCAGG - Intergenic
1033152423 7:138926919-138926941 CAGTGGGAAGGAAGGGAGTTGGG - Intronic
1033460699 7:141545017-141545039 CAGTGAGTAGGAACAAAGGTAGG - Intergenic
1033661600 7:143406894-143406916 CAGTGAACAGGTTGTGAGGTGGG - Intronic
1034234804 7:149558326-149558348 GAGGGAGTGGCTAGGGAGGTTGG - Intergenic
1034897168 7:154885039-154885061 CACTGAGCAGGCAAGGAGGTAGG + Intronic
1035299995 7:157890996-157891018 GAGTAAGGAGGTGGGGAGGTGGG - Intronic
1035413977 7:158667921-158667943 CAGAGGGTAGGTAAGGAGGGCGG - Intronic
1035414046 7:158668123-158668145 CAGAGGGTAGGTAAGGAGGGCGG - Intronic
1035471084 7:159109334-159109356 CTGTGAGGCGGCAGGGAGGTTGG + Intronic
1036213755 8:6863130-6863152 CAGGGAGCGGGTAGGGAGGCTGG + Intergenic
1036452213 8:8878708-8878730 GAGTGAGGAGGAAGGGAGGGAGG + Intronic
1036542751 8:9734799-9734821 AAGTAGGTAGGTAGGTAGGTAGG - Intronic
1036542752 8:9734803-9734825 TAGTAAGTAGGTAGGTAGGTAGG - Intronic
1036584054 8:10106812-10106834 GAGTGGGTAGGTAGGTGGGTGGG - Intronic
1036584056 8:10106816-10106838 GTGTGAGTGGGTAGGTAGGTGGG - Intronic
1036719945 8:11164914-11164936 AAGTGGGAAGGTAGGCAGGTGGG - Intronic
1036734271 8:11295840-11295862 CAGTGAGTAGGTAGGGACTGGGG + Intronic
1037115859 8:15226182-15226204 AAGTAAGTAGGGAGGTAGGTAGG - Intronic
1037609650 8:20465301-20465323 CTGTGAGTAGGCAGGGGTGTTGG + Intergenic
1037814966 8:22107291-22107313 CAGTGAACAGATAGAGAGGTGGG - Exonic
1037841589 8:22248985-22249007 CAGTGAGCTGGTATGGAGGGTGG + Intronic
1037877366 8:22554611-22554633 GAGTGAGTCAGTAGGGAGGAGGG + Intronic
1038240556 8:25804229-25804251 GGGTGGGTAGGTAGGTAGGTAGG - Intergenic
1038366678 8:26942875-26942897 AAGTAGGTAGGTAGGTAGGTAGG + Intergenic
1038904472 8:31883636-31883658 CAGCAAGTAGTAAGGGAGGTGGG + Intronic
1038953083 8:32437182-32437204 CAATGAATAGGTAGGTAGGTAGG - Intronic
1040067886 8:43163111-43163133 CAGTGAGGTGGGAGGGAGGTTGG + Intronic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1042703080 8:71637865-71637887 AAGTGAGTCGGTAGGGTGCTGGG - Intergenic
1042873501 8:73419353-73419375 CTGTGAGCAGGTAGAGAGGATGG + Intergenic
1043461122 8:80461296-80461318 ATGTGTGTAGGTAGGTAGGTAGG + Intergenic
1044357047 8:91234808-91234830 AAGTAGGTAGGTAGGTAGGTAGG - Intronic
1044357048 8:91234812-91234834 AAGGAAGTAGGTAGGTAGGTAGG - Intronic
1044539103 8:93390333-93390355 CAGTGAGATGGTGGGGAGGTGGG - Intergenic
1044539246 8:93391468-93391490 CAGCTAGTAAGTAGGAAGGTCGG - Intergenic
1044697172 8:94935089-94935111 CGGTAGGTAGGTAGGTAGGTAGG + Intronic
1045692625 8:104775119-104775141 CAGTGAGTGGGGAGGGAGACAGG + Intronic
1046285882 8:112092440-112092462 CAGTGATTAGGTAGGGGTGGTGG + Intergenic
1046771015 8:118116497-118116519 CAGTGAGTAGATCAGGAGGGAGG - Intergenic
1047380499 8:124357762-124357784 TAGTAAGTAGGAAGAGAGGTTGG + Intronic
1048412797 8:134193033-134193055 CAGTAGGTAGGTAGATAGGTAGG + Intergenic
1048577769 8:135706444-135706466 CTGTGTGTAGTTTGGGAGGTAGG - Intergenic
1049425470 8:142536093-142536115 GAGTGGGTGGGTAGGTAGGTGGG + Intronic
1049426995 8:142542133-142542155 CAGTGAGTGGTTGGGGAAGTCGG - Exonic
1049620184 8:143594627-143594649 CAGGGAGAAGTCAGGGAGGTGGG + Intronic
1050045100 9:1534673-1534695 TAGTAAGTAGGTACGTAGGTAGG - Intergenic
1051679437 9:19592477-19592499 AGGTGGGTAGGTAGGTAGGTAGG - Intronic
1052408810 9:28096622-28096644 CACTGAGTAGGTAGGTAGGTGGG - Intronic
1052697624 9:31898551-31898573 CTGTCAGGAGGTGGGGAGGTAGG - Intergenic
1052716167 9:32120050-32120072 CAGTGACTAGTCAGGAAGGTTGG + Intergenic
1055395592 9:75870573-75870595 GTGTGTGTAGGTAGGTAGGTAGG + Intergenic
1055668276 9:78573852-78573874 CAGTGAGAGGGTAGGGAGCCAGG - Intergenic
1056198150 9:84248690-84248712 CTGTCAGTAGGTGGGGAGCTGGG + Intergenic
1057975585 9:99602586-99602608 CAGTGTGTAGGTAGGAAGCCAGG - Intergenic
1060714662 9:125912936-125912958 TAGTGAGTGGCTAGGTAGGTAGG + Intronic
1060920315 9:127415978-127416000 CATAGAATAGGTAGAGAGGTGGG - Intergenic
1061246148 9:129402124-129402146 CAGGGAGGAGGTGGGGAGGAGGG - Intergenic
1061319901 9:129822344-129822366 CAGTGAGTATGTAGGGTCATGGG - Intronic
1061471763 9:130832496-130832518 CAGCCAGGAGGTAGGAAGGTAGG - Intronic
1061640304 9:131948993-131949015 CAGGAAGAAGGTAGGCAGGTTGG - Intronic
1061904875 9:133691462-133691484 CAGTGAGAAGGCAGGGTGGCCGG + Intronic
1062050615 9:134444682-134444704 GAGCAAGTAGGTAGGGAGGAGGG - Intergenic
1062085030 9:134643922-134643944 CAGTGTGGAGGTGGGGAGATGGG - Intronic
1062343785 9:136105441-136105463 CAGAGAGCAGGGAGGGAGCTGGG + Intergenic
1203446664 Un_GL000219v1:63322-63344 AAGGAAGTAGGGAGGGAGGTAGG - Intergenic
1185670044 X:1801142-1801164 TGCTGAGTAGGTAGGTAGGTAGG - Intergenic
1185933502 X:4229795-4229817 CAGTGGATAGATAGGTAGGTAGG - Intergenic
1185933573 X:4230407-4230429 GGGTAAGTAGGTAGGTAGGTAGG - Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186244122 X:7602581-7602603 AGGTAAGTAGGTAGGTAGGTAGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1187002807 X:15199870-15199892 CAGCTGGTAGGCAGGGAGGTAGG + Intergenic
1187447646 X:19373058-19373080 CAGGGAGGAGGGAGGGAGGGAGG + Intronic
1188052059 X:25499760-25499782 CAATAGGTAGGTAAGGAGGTAGG - Intergenic
1188079292 X:25816072-25816094 AAGTAAGTAAGTAGGTAGGTAGG + Intergenic
1188079293 X:25816076-25816098 AAGTAAGTAGGTAGGTAGGTAGG + Intergenic
1189341523 X:40208044-40208066 AGGTAAGTAGGTAGGTAGGTAGG - Intergenic
1189667351 X:43370952-43370974 CAGAGAGTGGGGAGGGAGGGAGG + Intergenic
1190059869 X:47203695-47203717 CGGTGAGTAGGGTAGGAGGTTGG + Exonic
1190157880 X:48008332-48008354 CAGGGAGTAGGTATAGAGCTTGG - Intronic
1190173652 X:48131217-48131239 CAGGGAGTAGGTATAGAGCTTGG - Intronic
1190339714 X:49286724-49286746 CAGTGAGTGGGCAGGCAGCTTGG + Exonic
1190456418 X:50632432-50632454 CAGTGAGTAGGCAAGGACCTAGG + Intronic
1192219729 X:69189397-69189419 CAGTTAGTAGGCATGAAGGTTGG - Intergenic
1192545340 X:72008238-72008260 CACTGAGCAGATAGGGACGTGGG - Intergenic
1192872449 X:75197077-75197099 CAGTGAGTGGGGAGGGAGGTGGG - Intergenic
1195597665 X:106711169-106711191 CGGTGAGTAGGTGGGGAGAGAGG - Intronic
1198831886 X:140759605-140759627 CAGTGACTTGGGAGGGAGGCAGG - Intergenic
1199955781 X:152741047-152741069 GTGTGAGAAGGGAGGGAGGTGGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1202050113 Y:20772045-20772067 GAGTGAGAAGGCAGGCAGGTAGG - Intronic