ID: 1091637813

View in Genome Browser
Species Human (GRCh38)
Location 12:2211263-2211285
Sequence TACTGTGAGGTGTAAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 674}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091637813_1091637817 5 Left 1091637813 12:2211263-2211285 CCACTTTCTTACACCTCACAGTA 0: 1
1: 0
2: 0
3: 24
4: 674
Right 1091637817 12:2211291-2211313 GTTCCAGCAGCTTATTGGATTGG 0: 1
1: 0
2: 3
3: 11
4: 98
1091637813_1091637820 21 Left 1091637813 12:2211263-2211285 CCACTTTCTTACACCTCACAGTA 0: 1
1: 0
2: 0
3: 24
4: 674
Right 1091637820 12:2211307-2211329 GGATTGGTCCAGGCTGTGCCTGG 0: 1
1: 0
2: 0
3: 50
4: 188
1091637813_1091637815 0 Left 1091637813 12:2211263-2211285 CCACTTTCTTACACCTCACAGTA 0: 1
1: 0
2: 0
3: 24
4: 674
Right 1091637815 12:2211286-2211308 ACCATGTTCCAGCAGCTTATTGG 0: 1
1: 0
2: 0
3: 7
4: 112
1091637813_1091637821 24 Left 1091637813 12:2211263-2211285 CCACTTTCTTACACCTCACAGTA 0: 1
1: 0
2: 0
3: 24
4: 674
Right 1091637821 12:2211310-2211332 TTGGTCCAGGCTGTGCCTGGTGG 0: 1
1: 0
2: 4
3: 46
4: 491
1091637813_1091637819 11 Left 1091637813 12:2211263-2211285 CCACTTTCTTACACCTCACAGTA 0: 1
1: 0
2: 0
3: 24
4: 674
Right 1091637819 12:2211297-2211319 GCAGCTTATTGGATTGGTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091637813 Original CRISPR TACTGTGAGGTGTAAGAAAG TGG (reversed) Intronic
900356449 1:2267367-2267389 TCCTGTGAGGAGCAAGGAAGGGG + Intronic
900775174 1:4577990-4578012 TTCTATAAGGTGTAAGGAAGGGG + Intergenic
900835197 1:4997872-4997894 CACTGTGAGATTTCAGAAAGTGG - Intergenic
900836026 1:5004762-5004784 GACTGTAAGGTATAAGAGAGAGG - Intergenic
901905573 1:12406613-12406635 TACTCTGCGGTGGAAGAATGGGG + Intronic
904281610 1:29424410-29424432 TAGTGTGAGGTGTATGGAGGTGG - Intergenic
904544168 1:31255374-31255396 TACTTTGAGATGTTAGTAAGCGG + Intergenic
905886705 1:41495684-41495706 TACTGTCTGGTGGAAGGAAGAGG - Intergenic
906896906 1:49784479-49784501 TAGTGTGTGGTTTGAGAAAGGGG - Intronic
906957063 1:50382940-50382962 TTCTGTGAGGTGTGAGATAAGGG + Intergenic
907882368 1:58563063-58563085 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
908106200 1:60844994-60845016 TTCTGTAAGGTGTAATGAAGAGG - Intergenic
908440442 1:64148380-64148402 TACAGTGAGTTGTAAGCTAGTGG + Intronic
908725601 1:67173110-67173132 TACTCTGAGGTATACAAAAGGGG - Intronic
908904337 1:68990757-68990779 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
909291089 1:73884771-73884793 TAATGTGAGGTGTTAGTAATAGG + Intergenic
909431895 1:75597759-75597781 TTGTATGTGGTGTAAGAAAGAGG - Intronic
910004535 1:82380366-82380388 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
910131715 1:83915460-83915482 TAGTATAAGGTGTAAGGAAGGGG - Intronic
910177646 1:84448037-84448059 TTCTTTAAGGTGTAAGGAAGGGG - Intergenic
910421418 1:87067740-87067762 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
910605278 1:89076795-89076817 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
911652573 1:100406552-100406574 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
911938134 1:104007320-104007342 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
912091302 1:106080060-106080082 GACTGTGAGGTGGAAGACAGAGG - Intergenic
913425671 1:118726375-118726397 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
913426649 1:118738561-118738583 TCCAGTGAGGTGTAAGAAAAGGG - Intergenic
913580822 1:120225010-120225032 TACTGGGGAGTGTCAGAAAGTGG - Intergenic
913627356 1:120673389-120673411 TACTGGGGAGTGTCAGAAAGTGG + Intergenic
914400148 1:147311652-147311674 TCGTATGAGGTGTAAGGAAGGGG - Intergenic
914562754 1:148836448-148836470 TACTGGGGAGTGTCAGAAAGTGG - Intronic
914610075 1:149293774-149293796 TACTGGGGAGTGTCAGAAAGTGG + Intergenic
914995511 1:152540034-152540056 AACTGTGAGTTGTAAGCAAAGGG - Intronic
915170489 1:153973851-153973873 CACTGTGAGGTGAAGGCAAGAGG - Exonic
916783493 1:168062440-168062462 TACTGAGAGGAGTTTGAAAGCGG - Intronic
916877922 1:168989854-168989876 TAGTGTGTGGTGTAAGAGAGGGG - Intergenic
916920763 1:169463491-169463513 TAATTTGAGGTGGAACAAAGAGG + Intergenic
917022874 1:170609404-170609426 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
917682336 1:177380080-177380102 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
917712259 1:177697475-177697497 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
917727815 1:177844366-177844388 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
917768137 1:178245740-178245762 TTGTGTGAGGTGCAAGGAAGGGG + Intronic
918156681 1:181854042-181854064 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
918178232 1:182063876-182063898 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
918661182 1:187090740-187090762 CACTGGGAAGTGTCAGAAAGTGG - Intergenic
919215039 1:194542221-194542243 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
919402871 1:197141554-197141576 TTCTGTAAGGTTTAAGAATGAGG - Intronic
920282315 1:204853508-204853530 TACTTTGAGGTGTAGTTAAGCGG + Intronic
920440092 1:205975024-205975046 TACTGTGATGTGTATGTAAGTGG - Intergenic
920981293 1:210838312-210838334 TTATGTAAGGTGTAAGGAAGGGG - Intronic
923142439 1:231172123-231172145 TACAGTGAGGAGCAATAAAGGGG - Intronic
923424133 1:233851746-233851768 AACTGTGAGGATGAAGAAAGGGG - Intergenic
923431941 1:233931105-233931127 TTGTATAAGGTGTAAGAAAGGGG - Intronic
924487536 1:244500517-244500539 TTGTGTGAGGTTTAAGGAAGGGG + Intronic
924865184 1:247971592-247971614 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1063219497 10:3953353-3953375 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
1065246448 10:23763567-23763589 TTCTATAAGGTGTAAGGAAGGGG - Intronic
1066356725 10:34691914-34691936 TTATGTGTGGTGTAAGGAAGGGG - Intronic
1066608827 10:37212737-37212759 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
1067199271 10:44152445-44152467 TGGTATGAGGTGTAAGGAAGGGG - Intergenic
1067366358 10:45633105-45633127 TACTTTTTGCTGTAAGAAAGTGG - Intronic
1067573829 10:47393098-47393120 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1067946309 10:50691494-50691516 TACAGTGAAGTGCAAGAACGTGG + Intergenic
1068002484 10:51351915-51351937 TTCTATAAGGTGTAAGGAAGGGG + Intronic
1068368934 10:56089071-56089093 TTATGTAAGGTGTAAGGAAGGGG - Intergenic
1068469594 10:57444646-57444668 TTATATAAGGTGTAAGAAAGGGG + Intergenic
1068493770 10:57758341-57758363 TTCTACGTGGTGTAAGAAAGGGG - Intergenic
1068572430 10:58645054-58645076 TACTACAAAGTGTAAGAAAGAGG - Intronic
1069100772 10:64317841-64317863 GTCTGTTAGGTTTAAGAAAGAGG - Intergenic
1071340439 10:84641821-84641843 TTCTATAAGGTGTAAGGAAGGGG - Intergenic
1071340816 10:84646557-84646579 TTCTATAAGGTGTAAGGAAGGGG + Intergenic
1071412570 10:85411381-85411403 TTATGTAAGGTGTAAGGAAGGGG + Intergenic
1071762718 10:88627320-88627342 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1072025370 10:91450343-91450365 TTGTATGAGGTGTAAGGAAGGGG - Intronic
1072072089 10:91928239-91928261 TACTTTCAGTTGTAAGAATGTGG + Intronic
1072357894 10:94629913-94629935 TTGTGTAAAGTGTAAGAAAGGGG + Intergenic
1072664370 10:97383258-97383280 TACTGGGAGGTGTACAAAAATGG - Intronic
1075230858 10:120676129-120676151 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1075912278 10:126134999-126135021 AACTGTGATGTGGAAGGAAGCGG + Intronic
1076174530 10:128357569-128357591 TTGTGTAAGGTGTAAGAAAGGGG - Intergenic
1077812825 11:5655972-5655994 TTCTATAAGGTGTAAGGAAGGGG - Intergenic
1077835703 11:5925626-5925648 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
1078587658 11:12607707-12607729 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1078808983 11:14738774-14738796 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1078810976 11:14762806-14762828 CAGTGTGATGTGTGAGAAAGAGG + Intronic
1078813617 11:14797036-14797058 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1079396944 11:20072110-20072132 TTGTATGAGGTGTAAGGAAGGGG + Intronic
1079578262 11:22029904-22029926 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1079777099 11:24545451-24545473 TACTATGTGGTGTAAAAAAGGGG + Intronic
1079846399 11:25475620-25475642 GACTTTCAGGTGTAAGAAATAGG + Intergenic
1080095352 11:28399267-28399289 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1081251898 11:40846351-40846373 TTGTATGAGGTGTAAGGAAGGGG + Intronic
1081297107 11:41404801-41404823 TAATGTGACATGTAAGTAAGTGG + Intronic
1081394275 11:42566814-42566836 TCGTATGAGGTGTAAGGAAGTGG - Intergenic
1082635601 11:55589497-55589519 TGCTGTGATTTGTAAGAAAGAGG + Intergenic
1082640178 11:55650231-55650253 TAGTGTGAGGTAATAGAAAGAGG - Intergenic
1082867011 11:57909445-57909467 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1083427233 11:62594497-62594519 GACTGTGAGTTGACAGAAAGGGG - Exonic
1084541726 11:69791150-69791172 TAGGGTGAGGATTAAGAAAGAGG + Intergenic
1086030328 11:82346993-82347015 TGCTGAGAGGTCTAAGAAAGAGG + Intergenic
1086065453 11:82738929-82738951 TATTGTGAGATGTAATAAAATGG - Intergenic
1086220884 11:84441790-84441812 AAATCTCAGGTGTAAGAAAGGGG + Intronic
1086340757 11:85845959-85845981 ATCTGTGAGCTGTAATAAAGTGG - Intergenic
1086555747 11:88109339-88109361 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1088167106 11:106951909-106951931 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1088404730 11:109461510-109461532 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1088856924 11:113764032-113764054 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
1091215450 11:133898710-133898732 TAGACTGAGGTGTTAGAAAGGGG - Intergenic
1091637813 12:2211263-2211285 TACTGTGAGGTGTAAGAAAGTGG - Intronic
1092075387 12:5668718-5668740 TGGTATAAGGTGTAAGAAAGGGG + Intronic
1092519393 12:9252173-9252195 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1092567460 12:9683545-9683567 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
1092706267 12:11288548-11288570 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1092737115 12:11593016-11593038 GGATGTGAGGTGTAAGAGAGAGG + Intergenic
1092785494 12:12022746-12022768 TTCTGTGAGGTCCATGAAAGAGG + Intergenic
1093740244 12:22677182-22677204 TTGTATGAGGTGTAAGGAAGGGG + Intronic
1094572188 12:31650875-31650897 AGCTGAGAGGTGGAAGAAAGAGG + Intronic
1094608464 12:31970367-31970389 TCCAGTGAGGTGAAAGAAAAAGG - Intronic
1096638222 12:52974799-52974821 CAATGTGAGGAGTGAGAAAGAGG - Intergenic
1097086860 12:56475224-56475246 TACTGTGAGAAGTTATAAAGGGG - Exonic
1097410552 12:59247474-59247496 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
1098324118 12:69282455-69282477 TCATGGTAGGTGTAAGAAAGTGG + Intergenic
1098780601 12:74681346-74681368 TTCTATAAGGTGTAAGGAAGGGG - Intergenic
1099022673 12:77425505-77425527 TTCTTTAAGGTGTAAGGAAGGGG + Intergenic
1099301316 12:80898144-80898166 TTGTGTGTGGTGTAAGGAAGGGG + Intronic
1099531128 12:83782671-83782693 TTGTGTATGGTGTAAGAAAGGGG + Intergenic
1101472212 12:105008655-105008677 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1101784026 12:107865999-107866021 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
1104302044 12:127573068-127573090 TACTGTGTGGTCTAAGATACAGG + Intergenic
1106172617 13:27301196-27301218 AAATGTGGGGTGTAAGAAACTGG - Intergenic
1106604726 13:31217612-31217634 TTGTGTGTGGTGTAAGGAAGGGG + Intronic
1106873857 13:34050764-34050786 TTCTATAAGGTGTAAGGAAGGGG + Intergenic
1107369153 13:39723196-39723218 TACTGTTTGGGGGAAGAAAGAGG + Intronic
1107647095 13:42505585-42505607 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1108160843 13:47637260-47637282 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1108165104 13:47684786-47684808 TTCTATATGGTGTAAGAAAGGGG - Intergenic
1108178321 13:47817196-47817218 TATTGTGTGTTGTCAGAAAGAGG + Intergenic
1108237286 13:48421335-48421357 TTGTATAAGGTGTAAGAAAGGGG - Intronic
1108547539 13:51510890-51510912 TTGTATGAGGTGTAAGGAAGGGG + Intergenic
1108600325 13:51987877-51987899 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
1108815213 13:54282499-54282521 TTATGTGAGGTGTAAGGAAGGGG + Intergenic
1108998757 13:56768175-56768197 TTGTGTAAGCTGTAAGAAAGGGG - Intergenic
1109034297 13:57234877-57234899 TTCTATAAGGTGTAAGGAAGGGG - Intergenic
1109366960 13:61368246-61368268 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1109399575 13:61807898-61807920 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1109399723 13:61809737-61809759 TATTGAGAGGTTTAAGAAAGGGG + Intergenic
1109611613 13:64772497-64772519 TTGTATGAGGTGTAAGGAAGGGG + Intergenic
1110000653 13:70194936-70194958 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1110453004 13:75658012-75658034 TTGTGTGAGGTATGAGAAAGTGG + Intronic
1110825173 13:79963423-79963445 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1110861767 13:80351853-80351875 TTGTATGAGGTGTAAGGAAGGGG + Intergenic
1111056575 13:82958122-82958144 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1111348784 13:86998792-86998814 TCGTGTAAGGTGTAAGGAAGGGG - Intergenic
1111541989 13:89681062-89681084 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1111755657 13:92392370-92392392 TTGTGTACGGTGTAAGAAAGGGG - Intronic
1111763522 13:92497278-92497300 TTGTATGAGGTGTAAGGAAGAGG + Intronic
1112336169 13:98518246-98518268 TACAGTAAGGTGTAAGTCAGAGG - Intronic
1112491314 13:99866894-99866916 TACTGGGAGGTGGGAGAGAGAGG - Intronic
1113967155 13:114159912-114159934 TAATATAAGGTGTAAGAAAGGGG + Intergenic
1113988117 13:114335492-114335514 TTGTGTATGGTGTAAGAAAGGGG - Intergenic
1114762143 14:25328077-25328099 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1115157629 14:30358623-30358645 AACTGTGAGATGTAATAAAATGG + Intergenic
1115357630 14:32465557-32465579 TTGTATGAGGTGTAAGGAAGGGG - Intronic
1115544184 14:34449957-34449979 CACTGTGAGTTTTAAGAAATGGG + Intronic
1115896600 14:38095393-38095415 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1116112768 14:40607862-40607884 TTTTATGAGGTGTAAGGAAGGGG + Intergenic
1116123614 14:40753480-40753502 TTGTATGAGGTGTAAGAAAGGGG + Intergenic
1116281691 14:42916090-42916112 TCGTATAAGGTGTAAGAAAGGGG - Intergenic
1116554386 14:46284883-46284905 TTGTATAAGGTGTAAGAAAGTGG - Intergenic
1118227070 14:63911658-63911680 TTCTTTGAAGTGTAACAAAGAGG - Intronic
1118434809 14:65760785-65760807 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1118515642 14:66525665-66525687 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
1118931168 14:70242299-70242321 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1118937709 14:70302526-70302548 TACTATGAGGTGTCAGAATTTGG + Intergenic
1120564905 14:86043504-86043526 TTCTATAAGGTGTAAGGAAGGGG + Intergenic
1122374389 14:101248486-101248508 AACCGTCAGGTGTAAGGAAGGGG + Intergenic
1123586780 15:21767810-21767832 TGGTATAAGGTGTAAGAAAGGGG - Intergenic
1123623419 15:22210375-22210397 TGGTATAAGGTGTAAGAAAGGGG - Intergenic
1124359932 15:29029180-29029202 TTGTATGAGGTGTAAGGAAGGGG + Intronic
1124667190 15:31603412-31603434 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
1125858071 15:42970312-42970334 TTATGTAAGGTGTAAGGAAGGGG - Intronic
1126470262 15:49002625-49002647 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1126476773 15:49073603-49073625 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1126715391 15:51511011-51511033 TTGTATGAAGTGTAAGAAAGGGG - Intronic
1126995159 15:54434552-54434574 TTGTATAAGGTGTAAGAAAGGGG - Intronic
1127898598 15:63324239-63324261 TACTGGGAGGTGCAAGACAGTGG - Exonic
1128012647 15:64312573-64312595 TTGTATAAGGTGTAAGAAAGGGG - Intronic
1128401423 15:67285624-67285646 TTGTGTGTGGTGTAAGGAAGGGG + Intronic
1128852050 15:70969155-70969177 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
1128857747 15:71033856-71033878 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
1129498681 15:76014516-76014538 TTATATGAGGTGTAAGGAAGGGG + Intronic
1129507492 15:76094288-76094310 TTCTATAAGGTGTAAGGAAGGGG + Intronic
1129563676 15:76597769-76597791 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
1130685915 15:86037487-86037509 TACTGTAAGGTGTGAGTAGGTGG + Intergenic
1131274239 15:90967436-90967458 TTCTGTGAGGTGTAACAGAATGG - Intronic
1131339206 15:91580679-91580701 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1131415874 15:92257299-92257321 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
1131491912 15:92870410-92870432 TACTGTTAGGTGCAAGAGAAAGG + Intergenic
1131634918 15:94222290-94222312 TACTGTGAAGTTTAAGAATAGGG + Intergenic
1131794491 15:96000910-96000932 TACTATGAGGAGAAAGCAAGTGG + Intergenic
1131939555 15:97545929-97545951 ATTTGTGAGGGGTAAGAAAGAGG + Intergenic
1132374723 15:101321380-101321402 TACTCTGATCTGGAAGAAAGAGG + Intronic
1134786391 16:16947839-16947861 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1135479907 16:22814034-22814056 TTCTGGGAGGGGTAAGAGAGTGG + Intergenic
1137020176 16:35417242-35417264 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1137021339 16:35430986-35431008 TATTGAGAGGTTGAAGAAAGAGG + Intergenic
1137474432 16:48794882-48794904 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1139155159 16:64432665-64432687 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1140993784 16:80240811-80240833 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
1142792279 17:2276710-2276732 TACTGTGAAGTGGTAGAAGGAGG - Intronic
1143996809 17:11013525-11013547 TGCTGTGAGGTGAAGGAATGTGG - Intergenic
1144249734 17:13403734-13403756 CACTGTGAGGTCTAAAAAAGAGG - Intergenic
1145204285 17:20973408-20973430 TTGTGTGTGGTGTGAGAAAGGGG + Intergenic
1146615468 17:34353840-34353862 TTGTATGAGGTGTAAGGAAGGGG + Intergenic
1147540773 17:41357060-41357082 TTGTCTGTGGTGTAAGAAAGGGG - Intergenic
1148162864 17:45461559-45461581 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
1150204963 17:63396812-63396834 TACTGGGAGGGGAAAGGAAGGGG + Intronic
1150394094 17:64808213-64808235 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1152235032 17:79134186-79134208 TACTGTGAGCTCCAAGAAGGCGG + Intronic
1153917389 18:9758187-9758209 AACTGAGAGGTCGAAGAAAGAGG - Intronic
1154381798 18:13858462-13858484 TTCTATCAGGTGTAAGGAAGGGG + Intergenic
1156634859 18:39015059-39015081 TATTGGGAGGTGGAGGAAAGGGG - Intergenic
1156733911 18:40229586-40229608 GGCTGTGAGTTGTAAGAGAGTGG - Intergenic
1157066865 18:44360143-44360165 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1157073041 18:44432018-44432040 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1158738016 18:60105944-60105966 TTGTGTATGGTGTAAGAAAGGGG - Intergenic
1159354609 18:67321741-67321763 TTGTATGAGGTGTAAGGAAGGGG + Intergenic
1160104040 18:75952736-75952758 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1164879722 19:31721762-31721784 TAATTTGAAGTGGAAGAAAGAGG + Intergenic
1165003309 19:32783136-32783158 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
1167450874 19:49568295-49568317 TACTGTGATGTGGTGGAAAGAGG + Intronic
925895176 2:8465866-8465888 TACTGCCATTTGTAAGAAAGGGG + Intergenic
926477848 2:13349835-13349857 TTGTTTGTGGTGTAAGAAAGGGG + Intergenic
926506211 2:13719638-13719660 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
928769069 2:34684180-34684202 CACTGAAGGGTGTAAGAAAGAGG + Intergenic
928787058 2:34900852-34900874 TATCTTGTGGTGTAAGAAAGTGG - Intergenic
928850447 2:35739139-35739161 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
930001588 2:46865415-46865437 TACTCTGAGGTGTGGGAAGGGGG + Intergenic
930211228 2:48639517-48639539 TTGTATGTGGTGTAAGAAAGGGG - Intronic
930552037 2:52848042-52848064 TTGTATGAGGTGTAAGGAAGGGG + Intergenic
930774893 2:55161813-55161835 TTCTGTGAGGTGGAGAAAAGGGG - Intergenic
930847343 2:55920015-55920037 CACTGTGAGGTCTCAGAGAGAGG - Intronic
931182781 2:59919787-59919809 TACAGTAAGGTGTGAGACAGTGG - Intergenic
931478688 2:62617582-62617604 TCATGTAAGGTGTAAGGAAGGGG + Intergenic
931592417 2:63899920-63899942 TGCTGTGAGGATTAAAAAAGAGG + Intronic
932482720 2:72056748-72056770 TTATATGTGGTGTAAGAAAGGGG + Intergenic
932600521 2:73121553-73121575 TTGTGTGCAGTGTAAGAAAGGGG - Intronic
932737642 2:74265446-74265468 TACTGTCATGTGAAGGAAAGTGG + Intronic
932765615 2:74467638-74467660 TATTGTGAGTTGTAGGAAAATGG - Intergenic
933105058 2:78314080-78314102 TTCTGTGTGGTGTAAGATAGAGG - Intergenic
934019352 2:87929225-87929247 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
934204641 2:89915660-89915682 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
935231413 2:101100857-101100879 TTCTATAAGGTGTAAGGAAGGGG - Intronic
935399893 2:102649292-102649314 TTATATAAGGTGTAAGAAAGGGG - Intronic
936118757 2:109723940-109723962 TTGTGTAAGGTGTAACAAAGGGG + Intergenic
936633433 2:114229499-114229521 TTGTGTAAGGTGTAAGGAAGTGG + Intergenic
936769087 2:115890252-115890274 TCCTATAAGGTGTAAGGAAGGGG + Intergenic
936834881 2:116697145-116697167 TACAGTGAGGGTCAAGAAAGAGG - Intergenic
936908562 2:117566353-117566375 TTGTGTAAGGTGTAAGGAAGAGG - Intergenic
937233277 2:120414715-120414737 TACTGTGAAAAGTTAGAAAGGGG - Intergenic
938136027 2:128757287-128757309 TGCTGTGAAGTGAAAAAAAGAGG + Intergenic
938136389 2:128761360-128761382 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
938996215 2:136681336-136681358 TTGTATAAGGTGTAAGAAAGTGG - Intergenic
939192669 2:138934280-138934302 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
939216786 2:139248891-139248913 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
939424325 2:142015340-142015362 TTGTGTAAGATGTAAGAAAGGGG - Intronic
939478121 2:142712818-142712840 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
939798696 2:146680210-146680232 CACAGTGAAGTGTAAGAGAGTGG + Intergenic
939849098 2:147282665-147282687 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
940086544 2:149865606-149865628 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
940142585 2:150509683-150509705 GACTCTGAGATGTAAGAAAAAGG - Intronic
940254414 2:151713925-151713947 AACTGGGAGCTGTAAGAAAAGGG + Intronic
940417645 2:153441120-153441142 TTGTATGAGGTGTAAGGAAGGGG + Intergenic
940513232 2:154646667-154646689 TACTGTGAGCTGCTAGAAATTGG - Intergenic
940565605 2:155356628-155356650 GCCTGTGAAGTGTCAGAAAGAGG + Intergenic
940758399 2:157709422-157709444 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
940964356 2:159821242-159821264 TTGTGTGTGGTGAAAGAAAGGGG - Intronic
941415769 2:165219018-165219040 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
941559930 2:167032272-167032294 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
941999653 2:171633251-171633273 TACAATGAGATGTAAGGAAGAGG - Intergenic
942504224 2:176624715-176624737 TTGTGTAAGGTGTAAGGAAGAGG - Intergenic
942638632 2:178036840-178036862 TTCTATAAGGTGTAAGGAAGGGG - Intronic
942792253 2:179774141-179774163 GACTGTGATGTGTATGAATGTGG + Intronic
943047805 2:182879440-182879462 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
943111903 2:183617166-183617188 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
943158540 2:184216410-184216432 TTATATAAGGTGTAAGAAAGAGG + Intergenic
943186532 2:184614252-184614274 TTGTATAAGGTGTAAGAAAGGGG - Intronic
943291144 2:186073361-186073383 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
944093443 2:195940341-195940363 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
944281784 2:197906238-197906260 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
945442848 2:209900929-209900951 TTCTGTGAGGGCTGAGAAAGGGG + Intronic
945857215 2:215083185-215083207 TACTGAGATGTGTAAGATACTGG + Intronic
945919231 2:215738429-215738451 CACTTTGAAGTGTAAAAAAGAGG - Intergenic
948347378 2:237310452-237310474 TACTGTGAGGTTGATGAAAAGGG - Intergenic
948452992 2:238089750-238089772 TTTTATGAGGTGTAAGACAGGGG - Intronic
1170161256 20:13313506-13313528 TGCTGTGTGGTGGAAGAAAAAGG - Intergenic
1171206426 20:23285034-23285056 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1171511879 20:25692734-25692756 AACTGAGAGCCGTAAGAAAGTGG + Intronic
1172971831 20:38879238-38879260 TACAGTGAGGGGTAAGAGAAGGG + Intronic
1173326469 20:42038090-42038112 TTCTGTAAGGTGTAAAAAGGTGG - Intergenic
1174410364 20:50331083-50331105 CAGGGTGAGGGGTAAGAAAGGGG + Intergenic
1175153238 20:56951908-56951930 TACTGTGGGGTGTAAGGGGGTGG - Intergenic
1175157845 20:56984485-56984507 TACTGGAAGCTGGAAGAAAGGGG + Intergenic
1177028291 21:15950320-15950342 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1177230155 21:18309225-18309247 TTGTATAAGGTGTAAGAAAGGGG - Intronic
1177540360 21:22485155-22485177 TTATATGAGGTGTAAGGAAGGGG - Intergenic
1178226868 21:30729630-30729652 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1178813118 21:35902698-35902720 TTGTATGAGGTGTAAGGAAGGGG - Intronic
1182163264 22:28145265-28145287 TTTTGTGATGTGTAAAAAAGGGG - Intronic
1183994245 22:41621024-41621046 TACTGTGAGGTGACAGAGAGGGG + Exonic
949114452 3:302915-302937 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
949175622 3:1058998-1059020 TTGTGTAAGGTGTAAGGAAGTGG + Intergenic
949222373 3:1651108-1651130 TTTTATGAGGTGTAAGGAAGGGG + Intergenic
949250516 3:1978279-1978301 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
949773799 3:7608887-7608909 TTCTGTATGATGTAAGAAAGGGG + Intronic
951361258 3:21727140-21727162 TTGTATAAGGTGTAAGAAAGGGG - Intronic
951678342 3:25267400-25267422 TAATGTGAGGTGAAAGACGGGGG - Intronic
951859409 3:27235083-27235105 TTGTGTGTGGTATAAGAAAGGGG - Intronic
951916114 3:27802565-27802587 CCATGTGAGGTGTGAGAAAGTGG - Intergenic
952078391 3:29727184-29727206 TTGTATAAGGTGTAAGAAAGGGG - Intronic
952347021 3:32497471-32497493 TAGTGTGAGGGGTGGGAAAGTGG + Intronic
952440642 3:33324475-33324497 TAGTGTAAGGTATAAGGAAGGGG + Intronic
952518265 3:34127813-34127835 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
952614501 3:35253579-35253601 TTGTGTAAGGTGTAAGGAAGTGG - Intergenic
952683505 3:36122817-36122839 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
952721374 3:36536564-36536586 TTGTATAAGGTGTAAGAAAGGGG - Intronic
954386048 3:50244614-50244636 TACTGTGTGGTGGTAGAATGTGG + Intronic
954601044 3:51869630-51869652 AACTGAGAGGTTGAAGAAAGAGG - Intergenic
955831675 3:63011228-63011250 TTCTATAAGGTGTAAGGAAGGGG + Intergenic
956253158 3:67255367-67255389 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
956682518 3:71794468-71794490 TTTTGTGAGTGGTAAGAAAGTGG + Intergenic
957639346 3:82831287-82831309 TTGTGTGTGGTGTAAGGAAGGGG - Intergenic
958562800 3:95769530-95769552 TCGTGTAAGGTGTAAGGAAGGGG - Intergenic
959506386 3:107161234-107161256 TTATATAAGGTGTAAGAAAGGGG - Intergenic
959679360 3:109075471-109075493 TTATATAAGGTGTAAGAAAGGGG + Intronic
959926416 3:111926438-111926460 AACTTTGAAATGTAAGAAAGAGG - Intronic
960226713 3:115177842-115177864 TTGTGTAAGTTGTAAGAAAGGGG + Intergenic
960478987 3:118164774-118164796 TTGTGTGTGGTGTGAGAAAGGGG - Intergenic
960654344 3:119986153-119986175 TTCTATAAGGTGTAAGGAAGGGG - Intronic
960656361 3:120008676-120008698 TTCTATAAGGTGTAAGGAAGGGG - Intronic
961418408 3:126779614-126779636 TTATGTAAGGTGTAAGACAGAGG + Intronic
961583870 3:127905976-127905998 TTGTATCAGGTGTAAGAAAGGGG - Intergenic
962073977 3:132061225-132061247 TTCTATATGGTGTAAGAAAGGGG + Intronic
962766219 3:138565657-138565679 TTGTATAAGGTGTAAGAAAGGGG - Intronic
963250953 3:143103071-143103093 TACTATGAGGGGAGAGAAAGAGG - Intergenic
963339581 3:144018834-144018856 AAGTGTGAGGTCAAAGAAAGAGG - Intronic
963691204 3:148505036-148505058 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
964232930 3:154491737-154491759 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
964639062 3:158888882-158888904 TTGTGTAAGGTGTAAGGAAGTGG + Intergenic
965303590 3:167035938-167035960 TTGTGTACGGTGTAAGAAAGGGG + Intergenic
965511396 3:169571808-169571830 TTGTATAAGGTGTAAGAAAGGGG - Intronic
965686469 3:171308378-171308400 TTGTGTGTGGTGTAAGGAAGGGG - Intronic
965755579 3:172022921-172022943 TACTGTTAGGTGTAATAGAAAGG + Intergenic
966070493 3:175871512-175871534 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
966368222 3:179214398-179214420 TCCTGAGAGGAGGAAGAAAGAGG + Intronic
966395820 3:179501712-179501734 TACTGAGATGTGGAAGACAGAGG - Intergenic
966423921 3:179760713-179760735 TTCTGTGAGGTTTAAGGAACAGG + Intronic
967629562 3:191729489-191729511 TACTGTTTGGTGTAAGACACAGG + Intergenic
967767425 3:193296357-193296379 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
968375339 4:35720-35742 TTGTGTATGGTGTAAGAAAGGGG + Intergenic
968692682 4:2002701-2002723 TTGTATGAGGTGTAAGGAAGAGG - Intronic
968828552 4:2917695-2917717 TTGTATGAGGTGTAAGGAAGGGG + Intronic
969164368 4:5293960-5293982 TTCTATAAGGTGTAAGGAAGGGG + Intronic
970496772 4:16634081-16634103 TTATATTAGGTGTAAGAAAGGGG - Intronic
970854781 4:20638814-20638836 CCATGTGAGGTGTAAGAAACTGG + Intergenic
971853491 4:32013710-32013732 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
971883655 4:32413923-32413945 TTTTGTCAGGTGTAAGGAAGAGG - Intergenic
972824949 4:42747474-42747496 TTCTGGGAGGTGAAAGAAGGTGG - Intergenic
972948202 4:44284440-44284462 TTGTATAAGGTGTAAGAAAGGGG - Intronic
973920902 4:55683835-55683857 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
974362391 4:60899109-60899131 AACTGTGAGGAGGAAGAAAAAGG - Intergenic
974452869 4:62089503-62089525 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
974641114 4:64632006-64632028 TTCTATAAGGTGTAAGGAAGGGG + Intergenic
974663391 4:64924347-64924369 TTGTGTATGGTGTAAGAAAGGGG - Intergenic
974769094 4:66387545-66387567 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
974946186 4:68531603-68531625 TTATATAAGGTGTAAGAAAGGGG + Intergenic
974955945 4:68641408-68641430 TTGTATAAGGTGTAAGAAAGGGG + Intronic
975246319 4:72124742-72124764 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
975894609 4:79073857-79073879 TTCTATGTGGTGTAAGGAAGGGG - Intergenic
976093234 4:81478913-81478935 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
976665541 4:87586931-87586953 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
978236452 4:106466729-106466751 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
978259848 4:106742201-106742223 TTTTATGAGGTGTAAGGAAGGGG + Intergenic
978617206 4:110610000-110610022 TACTTAGGGGTGTGAGAAAGTGG - Intergenic
978721534 4:111915888-111915910 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
978771631 4:112462722-112462744 TTTTGTATGGTGTAAGAAAGGGG - Intergenic
978852513 4:113355527-113355549 TACTGAGAGTTTTCAGAAAGAGG + Exonic
978977314 4:114893911-114893933 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
979093913 4:116520171-116520193 TACTTAGAGGTGTAAGGCAGAGG + Intergenic
979697854 4:123634442-123634464 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
979711983 4:123790525-123790547 TACTTTGGGATGTAAAAAAGAGG - Intergenic
979953506 4:126925268-126925290 TAGTATAAGGTGTAAGGAAGGGG + Intergenic
980185093 4:129451028-129451050 TTGTATAAGGTGTAAGAAAGAGG - Intergenic
980649237 4:135688556-135688578 TCGTGTGAAGTGTAAGAAAGTGG - Intergenic
980660272 4:135848862-135848884 TTGTATGAGATGTAAGAAAGGGG - Intergenic
980716932 4:136639327-136639349 GACAGGGAGGTCTAAGAAAGAGG + Intergenic
980765894 4:137303260-137303282 TAGTTTGAGGTGTAGCAAAGTGG - Intergenic
980803990 4:137788612-137788634 TTCTATAAGGTGTAAGGAAGGGG - Intergenic
981149116 4:141360995-141361017 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
981500852 4:145449898-145449920 TACTGTTTGGAGTCAGAAAGAGG + Intergenic
981794476 4:148580666-148580688 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
981847110 4:149182167-149182189 TTCTGTGAGGTATAAGTAACTGG - Intergenic
983051725 4:163055821-163055843 TTGTGTAAAGTGTAAGAAAGGGG + Intergenic
983270881 4:165560309-165560331 AAATGTGAGATGTAATAAAGTGG + Intergenic
983797040 4:171876915-171876937 AACTGTGAAGTGTAAGAGACTGG - Intronic
984300995 4:177917530-177917552 TTGTATAAGGTGTAAGAAAGGGG + Intronic
984628086 4:182031226-182031248 TTCTATAAGGTGTAAGGAAGGGG + Intergenic
984854421 4:184181828-184181850 TTGTATGAGGTGTAAGGAAGGGG - Intronic
985459704 4:190093327-190093349 TTGTGTATGGTGTAAGAAAGGGG - Intergenic
985556494 5:561191-561213 AACTGTGAGGTTCCAGAAAGGGG + Intergenic
985997960 5:3607389-3607411 AATTCTTAGGTGTAAGAAAGGGG - Intergenic
986141018 5:5030013-5030035 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
986511473 5:8511251-8511273 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
986656439 5:10017192-10017214 TTGTATGTGGTGTAAGAAAGAGG - Intergenic
986665190 5:10096277-10096299 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
986793560 5:11187422-11187444 TTGTGTAAGGTGTAAGGAAGCGG - Intronic
986957780 5:13175803-13175825 TACTGGTAGGTGTAAGGGAGTGG - Intergenic
989222943 5:38989334-38989356 TTGTGTAAGGTGTAAGAAAGGGG - Intronic
989518425 5:42372218-42372240 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
989672315 5:43933041-43933063 TTGTATGAGGTGTAAGGAAGGGG + Intergenic
989727180 5:44600260-44600282 TATTATATGGTGTAAGAAAGGGG + Intergenic
990195137 5:53306318-53306340 TTGTATGAGGTGTAAGGAAGGGG + Intergenic
990233031 5:53735692-53735714 TTATATAAGGTGTAAGAAAGGGG + Intergenic
990295189 5:54394685-54394707 TTCAGTCAGTTGTAAGAAAGAGG + Intergenic
990659725 5:57999897-57999919 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
991262738 5:64684615-64684637 TCCTGAGAGTTGTAAGAAAAGGG + Intergenic
992268120 5:75038122-75038144 TACTGTGAAATGAAAGAAACAGG - Intergenic
992362532 5:76055171-76055193 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
992864790 5:80947041-80947063 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
992932184 5:81659988-81660010 TTTTGTAAGGTGTAAGGAAGGGG - Intronic
993336049 5:86660196-86660218 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
993544588 5:89195488-89195510 TTATGTAAGGTGTAAGGAAGGGG + Intergenic
993638946 5:90379683-90379705 TACTTTGAGGTGGAAAAAAAAGG + Intergenic
993892205 5:93488060-93488082 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
993895422 5:93527815-93527837 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
993911998 5:93695007-93695029 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
993921033 5:93802919-93802941 TACTGTTATATGTAAGAAGGGGG - Intronic
994076958 5:95663363-95663385 GATTGTGAGGGGCAAGAAAGAGG + Intronic
994160754 5:96554373-96554395 TTGTGTCAGGTGTAAGGAAGGGG - Intronic
994344260 5:98665671-98665693 TTGGGTAAGGTGTAAGAAAGGGG - Intergenic
994473107 5:100234978-100235000 TTGTGTATGGTGTAAGAAAGGGG + Intergenic
994634673 5:102329470-102329492 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
994802657 5:104398737-104398759 TTTTATAAGGTGTAAGAAAGGGG - Intergenic
994851309 5:105057787-105057809 TACTGTGACCAGGAAGAAAGAGG - Intergenic
994887031 5:105577484-105577506 TTGTATGAGGTGTAAGGAAGGGG + Intergenic
994960327 5:106593795-106593817 TTGTATAAGGTGTAAGAAAGTGG - Intergenic
995118001 5:108503321-108503343 TAATGTCAGGTGTCAGTAAGTGG - Intergenic
995329249 5:110928681-110928703 TTGTGTAAGGTGTAAGGAAGTGG + Intergenic
995335324 5:110991856-110991878 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
995621053 5:114026199-114026221 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
995668253 5:114569145-114569167 TTGTATGAGGTGTAAGGAAGTGG - Intergenic
995864829 5:116679889-116679911 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
996109154 5:119544274-119544296 TTGTATAAGGTGTAAGAAAGGGG + Intronic
996109875 5:119552850-119552872 TTATATAAGGTGTAAGAAAGGGG + Intronic
996878822 5:128270163-128270185 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
996965346 5:129301309-129301331 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
997016693 5:129944229-129944251 TACTGGTAGGTGGAAGAAGGAGG + Intronic
997217103 5:132121652-132121674 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
997767353 5:136518466-136518488 TATTGGGAGTTTTAAGAAAGAGG - Intergenic
997814905 5:137007109-137007131 TTGTATGAGGTGTAAGGAAGGGG - Intronic
998774530 5:145584257-145584279 TTGTATAAGGTGTAAGAAAGGGG - Intronic
999617033 5:153435695-153435717 TACTGTGAGGGGAAGCAAAGAGG + Intergenic
1000590466 5:163151697-163151719 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
1000663239 5:163962227-163962249 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1000811999 5:165874657-165874679 GAATGTGAGGTGTGGGAAAGAGG + Intergenic
1000938646 5:167333625-167333647 TCCAGTGAGGTGGAAGAGAGAGG + Intronic
1002682120 5:180974382-180974404 TTGTGTGTGGTGTAAGATAGGGG - Intergenic
1002832169 6:832266-832288 TTGTATAAGGTGTAAGAAAGTGG - Intergenic
1003249206 6:4410703-4410725 TTGTATAAGGTGTAAGAAAGAGG - Intergenic
1003575033 6:7284960-7284982 TTCTGTGAGGTTGAACAAAGGGG - Exonic
1004593716 6:17078719-17078741 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1004749453 6:18546691-18546713 AACTATAAGGTGTAAGGAAGGGG + Intergenic
1004821572 6:19373464-19373486 TAGGATGAGGTGTAAGAAAAGGG + Intergenic
1004943955 6:20591526-20591548 TTCTATAAGGTGTAAGGAAGGGG + Intronic
1005274656 6:24203454-24203476 TTCTATAAGATGTAAGAAAGGGG - Intronic
1005780782 6:29189675-29189697 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1005846756 6:29787282-29787304 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1005891944 6:30147280-30147302 TTCTGGGAGGTGTAAGAGGGAGG + Intronic
1008834171 6:55806241-55806263 TTCTATAAGGTGTAAGAAAGGGG + Intronic
1009595254 6:65727345-65727367 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1009709183 6:67295841-67295863 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1009818456 6:68768509-68768531 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
1009916308 6:70001041-70001063 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1009991438 6:70847256-70847278 CACTGAGAGATGTTAGAAAGAGG - Intronic
1010303254 6:74286025-74286047 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1010480782 6:76350862-76350884 TATAGTGTGGTGGAAGAAAGGGG + Intergenic
1010517045 6:76785910-76785932 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1010681344 6:78802767-78802789 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1010838335 6:80617020-80617042 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
1010946089 6:81975029-81975051 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1011199416 6:84818745-84818767 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1011887523 6:92115649-92115671 TACTGTGAGATGGTAGAAGGTGG + Intergenic
1012044966 6:94262231-94262253 TACTCTGAGCAGTAAGAAAAAGG + Intergenic
1012118658 6:95336623-95336645 TTGTGTAAGGTGTAAGAAATGGG - Intergenic
1012288739 6:97424470-97424492 TTCAGTGATGTGTCAGAAAGGGG + Intergenic
1012601212 6:101099378-101099400 TTCTATAAGGTGTAAGGAAGGGG - Intergenic
1013038442 6:106409842-106409864 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1013323172 6:109015647-109015669 TACTATGAGGTCTATGAAAAAGG + Intronic
1014256762 6:119168414-119168436 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1014279290 6:119422905-119422927 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1014781534 6:125570723-125570745 TAGAGTGAGTGGTAAGAAAGAGG + Intergenic
1014843107 6:126242752-126242774 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
1014856536 6:126408571-126408593 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1014857003 6:126415156-126415178 GGGTGTAAGGTGTAAGAAAGGGG + Intergenic
1015087570 6:129313978-129314000 TATTGTAAGCTGTAAGAAATAGG - Intronic
1015200427 6:130573624-130573646 TACTGTGATGAGAAAGAAATAGG - Intergenic
1015211763 6:130706578-130706600 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1015288941 6:131516035-131516057 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1015366721 6:132403625-132403647 TACAGTGAAGTGTGAGAAGGAGG - Intergenic
1015860347 6:137671041-137671063 TTGTATGAGGTGTAAGGAAGGGG + Intergenic
1016067723 6:139701107-139701129 GACTGTGAGGTCTATGAAATGGG + Intergenic
1016149232 6:140718126-140718148 TACTGGGAGGTGGGAGAGAGGGG + Intergenic
1016507236 6:144796085-144796107 TTGTGTGAGGTGTAAGGAAGGGG + Intronic
1016542485 6:145181273-145181295 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1016604881 6:145908922-145908944 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
1016905528 6:149146874-149146896 TTCTATAAGGTGTAAGGAAGGGG + Intergenic
1017023243 6:150158737-150158759 TATTGTCATGGGTAAGAAAGGGG + Intronic
1017221224 6:151968239-151968261 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
1017783915 6:157738917-157738939 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
1018144218 6:160867809-160867831 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1018363179 6:163093319-163093341 TGCTTTGAGGGGAAAGAAAGGGG + Intronic
1019081522 6:169434260-169434282 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1020526129 7:9261087-9261109 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1020569084 7:9835454-9835476 CACTGTGGGTTGTTAGAAAGAGG - Intergenic
1020633357 7:10667636-10667658 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1020885463 7:13814506-13814528 TTGTATGAGGTGTAAGGAAGTGG - Intergenic
1020923919 7:14299773-14299795 TACAGGGATGTGTAACAAAGTGG - Intronic
1021264367 7:18501285-18501307 CAGTGTGAGGTGTTAGAGAGAGG + Intronic
1021405923 7:20267218-20267240 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1021525579 7:21583406-21583428 TTCTATAAGGTGTAAGGAAGAGG - Intronic
1022233366 7:28436817-28436839 GATTGTGAGATTTAAGAAAGTGG + Intronic
1022370614 7:29767807-29767829 TTGTGTATGGTGTAAGAAAGGGG - Intergenic
1022486514 7:30783027-30783049 TACTGTGAGGATTAAAAATGTGG - Intronic
1022543856 7:31166822-31166844 TGCTGTGAGTTTTAGGAAAGAGG + Intergenic
1022838027 7:34135520-34135542 TCCTGTGAGGTCTCAGGAAGAGG + Intronic
1022961197 7:35428643-35428665 GACTGTGAAGTGGAGGAAAGGGG + Intergenic
1023195785 7:37637474-37637496 TTGTATGAGGTGTAAGGAAGGGG + Intergenic
1024795055 7:53010130-53010152 TTATATAAGGTGTAAGAAAGTGG + Intergenic
1024846728 7:53653150-53653172 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1024998049 7:55290103-55290125 TTCTATAAGGTGTAAGGAAGGGG + Intergenic
1025726501 7:64066620-64066642 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
1026147836 7:67763099-67763121 AGCTGAGAGGTGGAAGAAAGTGG + Intergenic
1027929022 7:84507200-84507222 TACTGTGATGTATAAGATTGAGG + Intergenic
1028126827 7:87122711-87122733 TACTAAGAGGAGGAAGAAAGAGG - Intergenic
1028384212 7:90235485-90235507 TATTGCTAGGTGTGAGAAAGTGG + Exonic
1028643892 7:93073821-93073843 CACTGGGAAGTGTCAGAAAGTGG - Intergenic
1029003102 7:97176950-97176972 ACCTCTGAGGAGTAAGAAAGGGG - Intronic
1029844693 7:103400740-103400762 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1029887062 7:103884250-103884272 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
1030482777 7:110125078-110125100 TTTTATAAGGTGTAAGAAAGGGG - Intergenic
1030718260 7:112836639-112836661 TTGTGTATGGTGTAAGAAAGAGG + Intronic
1031707129 7:124995278-124995300 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1031858898 7:126956189-126956211 TACTGTCAGTTTTAAGAAAAAGG + Intronic
1031900206 7:127400899-127400921 TCCTGTGAGGAAGAAGAAAGTGG + Intronic
1032082159 7:128865053-128865075 TGCAGTGATGTGTCAGAAAGGGG - Intronic
1032295448 7:130633892-130633914 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1032912125 7:136444865-136444887 GGCTGAGAGGTGAAAGAAAGAGG - Intergenic
1033289761 7:140073446-140073468 TACAGTAAGGGGTAGGAAAGGGG + Intergenic
1033380263 7:140810018-140810040 TATTGGGAGGTGTAAGAAGAAGG + Intronic
1033948481 7:146752791-146752813 TTGTATGAGGTGTAAGGAAGGGG + Intronic
1034143638 7:148848613-148848635 TACTCAGAGCTGTAACAAAGGGG + Intronic
1035432285 7:158830924-158830946 GACTGTGAAGAGTAAGAAAAGGG - Intergenic
1035703343 8:1653865-1653887 GACTCTGAGGTGTAAGTCAGAGG + Intronic
1035794515 8:2341863-2341885 TCGTATAAGGTGTAAGAAAGGGG - Intergenic
1035798278 8:2379845-2379867 TCGTATAAGGTGTAAGAAAGGGG + Intergenic
1036558451 8:9881520-9881542 TTTTGTAAGGTGTAAGGAAGGGG - Intergenic
1037161335 8:15776847-15776869 TACTGTTATGTGAAAGAAACAGG + Intergenic
1037230137 8:16648424-16648446 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1037442536 8:18930934-18930956 TATTGTGATTGGTAAGAAAGTGG - Intronic
1037531793 8:19783423-19783445 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1038916784 8:32032940-32032962 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
1039125119 8:34192422-34192444 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1039262857 8:35791249-35791271 TACTGCAAGGGGTAAGGAAGAGG - Intronic
1039302853 8:36228695-36228717 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1040090208 8:43390837-43390859 TAGAGTGAGGAGGAAGAAAGAGG - Intergenic
1040844688 8:51825012-51825034 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
1040966737 8:53089731-53089753 TTGTATGTGGTGTAAGAAAGTGG + Intergenic
1041511906 8:58661890-58661912 TGCCGGGAGGTGGAAGAAAGAGG - Intergenic
1041722971 8:60992992-60993014 TACTGTGAGGAAGAAGAAAGGGG + Intergenic
1041738687 8:61137014-61137036 TACAATGGGGTGTACGAAAGCGG + Intronic
1042032584 8:64492648-64492670 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1042107317 8:65341939-65341961 TTGTATCAGGTGTAAGAAAGTGG + Intergenic
1042111392 8:65384983-65385005 TTGTATAAGGTGTAAGAAAGCGG - Intergenic
1042682391 8:71400114-71400136 TAGTATAAGGTGTAAGGAAGGGG - Intergenic
1043223426 8:77694890-77694912 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1043420798 8:80096462-80096484 TACTGTGAAGTGCAATGAAGTGG - Intronic
1044116653 8:88344197-88344219 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1044455900 8:92392856-92392878 TTATATGAGGTGTAAGGAAGGGG - Intergenic
1045165680 8:99602171-99602193 TTGTATGAGGTGTAAGGAAGGGG + Intronic
1045391071 8:101715297-101715319 TTGTATAAGGTGTAAGAAAGGGG - Intronic
1045686654 8:104719771-104719793 TACTATGAAGAGAAAGAAAGAGG + Intronic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1045971936 8:108088551-108088573 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1046151155 8:110228151-110228173 AAATGTGGGGGGTAAGAAAGAGG - Intergenic
1046254165 8:111674450-111674472 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1046331162 8:112716894-112716916 TTGTATGAGGTGTAAGGAAGGGG - Intronic
1046972004 8:120233490-120233512 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1047091529 8:121580699-121580721 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1048499179 8:134960316-134960338 TCCTGAGAGGTGGGAGAAAGGGG - Intergenic
1050059665 9:1693366-1693388 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1050141134 9:2516851-2516873 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1050301311 9:4261507-4261529 TACTCTGAGCAGTAAGAAAAAGG - Intronic
1051045302 9:12865986-12866008 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1051549184 9:18310155-18310177 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1051926278 9:22330582-22330604 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1051998835 9:23251736-23251758 TTGTGTAAGGTGTAAGAAAGGGG - Intergenic
1052270341 9:26621891-26621913 TTGTGTGAGGTATAAGGAAGGGG - Intergenic
1052421331 9:28246571-28246593 TTCTATAAGGTGTAAGGAAGGGG - Intronic
1052482281 9:29046562-29046584 TTGTGTTTGGTGTAAGAAAGGGG - Intergenic
1053808881 9:41832416-41832438 TACTGTGATGTGTAAGCTTGGGG - Intergenic
1054621711 9:67355012-67355034 TACTGTGATGTGTAAGCTTGGGG + Intergenic
1054719321 9:68588365-68588387 TTGTATGAGGTGTAAGGAAGTGG + Intergenic
1056861698 9:90190743-90190765 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1057290731 9:93805449-93805471 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1058275103 9:103030535-103030557 TAATGTGTGGTGTAAGACAAAGG - Intergenic
1058493501 9:105528599-105528621 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
1059317487 9:113438737-113438759 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1059608159 9:115859058-115859080 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1059688108 9:116657290-116657312 TATTGTGAGGATTAAGTAAGGGG + Intronic
1059826990 9:118041944-118041966 TTATATAAGGTGTAAGAAAGGGG - Intergenic
1059898890 9:118900143-118900165 TACTCTGAGGTGAAAGGGAGTGG + Intergenic
1061690567 9:132325051-132325073 TGCTGTGATGAGTAAGAAACTGG + Intronic
1203573887 Un_KI270744v1:158424-158446 TTGTGTATGGTGTAAGAAAGGGG - Intergenic
1186138346 X:6544151-6544173 TTCTATAAGGTGTAAGGAAGGGG + Intergenic
1186647212 X:11519805-11519827 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
1187238464 X:17490297-17490319 TTGTATAAGGTGTAAGAAAGGGG + Intronic
1187463790 X:19511138-19511160 TTGTATAAGGTGTAAGAAAGGGG - Intronic
1187638987 X:21265779-21265801 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1187661326 X:21549887-21549909 TTCTATAAGGTGTAAGGAAGGGG - Intronic
1187742769 X:22374338-22374360 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1187802902 X:23084208-23084230 GACTGTGGGGAGTAAGAAAAAGG + Intergenic
1188137863 X:26512119-26512141 TACTTTGAGCTGAAAGAAATTGG + Intergenic
1188628205 X:32314365-32314387 TTGTATAAGGTGTAAGAAAGGGG - Intronic
1188724753 X:33568927-33568949 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1188892818 X:35631575-35631597 TTCTATAAGGTGTAAGGAAGGGG + Intergenic
1189190172 X:39094393-39094415 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1189575241 X:42344255-42344277 TATTATAAGGTGTAAGGAAGGGG - Intergenic
1189614317 X:42768243-42768265 GACTGTGAGGTGGAACAAAGGGG - Intergenic
1189717789 X:43882955-43882977 TACTGTGTGGTGAATCAAAGTGG - Intergenic
1190875867 X:54459610-54459632 TAGTCTGAGGTGTAAAAAATTGG + Intronic
1190960906 X:55246380-55246402 TCATATAAGGTGTAAGAAAGGGG - Intronic
1191001942 X:55669502-55669524 TAGTATAAGGTGTAAGGAAGGGG + Intergenic
1191160027 X:57319985-57320007 TTGTATAAGGTGTAAGAAAGAGG - Intronic
1191181655 X:57570382-57570404 TTGTATGAGGTGTAAGGAAGGGG + Intergenic
1191677080 X:63802719-63802741 TCGTATGAGGTGTAAGGAAGGGG - Intergenic
1191768439 X:64728456-64728478 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1191780601 X:64860288-64860310 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1191809590 X:65172597-65172619 TTCTATAAGGTGTAAGGAAGTGG + Intergenic
1191895050 X:65983714-65983736 TTGTGTAAGGTATAAGAAAGGGG - Intergenic
1191970063 X:66803859-66803881 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
1192042619 X:67638989-67639011 TTGTGTAAGGTGTAAGGAAGGGG + Intronic
1192849406 X:74938719-74938741 CATTGTATGGTGTAAGAAAGAGG + Intergenic
1192921877 X:75715401-75715423 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1192939224 X:75895123-75895145 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1192943693 X:75941046-75941068 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1192992558 X:76476190-76476212 TTCTATAAGGTGTAAGGAAGGGG - Intergenic
1193028461 X:76871946-76871968 TTCTATAAGGTGTAAGGAAGGGG - Intergenic
1193040595 X:76999756-76999778 TTCTATAAGGTGTAAGGAAGGGG - Intergenic
1193072878 X:77324863-77324885 TGCTGTGAGGTGGGAGAAGGGGG + Intergenic
1193385279 X:80863581-80863603 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1193882516 X:86940939-86940961 TACTTTGAGGTGAGAGATAGGGG + Intergenic
1193907205 X:87258583-87258605 ACCTATAAGGTGTAAGAAAGGGG - Intergenic
1193910719 X:87302882-87302904 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1193975358 X:88111763-88111785 TTCTGTAAGATGTAAGGAAGGGG + Intergenic
1193988675 X:88278608-88278630 TTGTATGAGGTGTAAGGAAGGGG + Intergenic
1193998392 X:88395072-88395094 AACTGTCAGGTGTAAGAGACAGG - Intergenic
1194099048 X:89679144-89679166 TTCTGTAAGGTGTAAGGAATGGG - Intergenic
1194158970 X:90427395-90427417 TTATATAAGGTGTAAGAAAGGGG - Intergenic
1194208064 X:91035312-91035334 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1194209631 X:91055969-91055991 TTGTTTAAGGTGTAAGAAAGGGG - Intergenic
1194523551 X:94947625-94947647 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1195142264 X:101973729-101973751 TTTTGTATGGTGTAAGAAAGGGG + Intergenic
1195488179 X:105434884-105434906 TTGTATGAGGTGTAAGGAAGGGG + Intronic
1196013280 X:110911139-110911161 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1196260218 X:113570391-113570413 TAGTATATGGTGTAAGAAAGGGG + Intergenic
1197007719 X:121522825-121522847 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1197045977 X:121999211-121999233 TTTTATGAGGTGTAAGGAAGAGG + Intergenic
1197184096 X:123567377-123567399 TTGTGTAAGGTGTAAGGAAGGGG - Intergenic
1197320023 X:125017032-125017054 TTGTATGAGGTGTAAGGAAGGGG - Intergenic
1197413420 X:126146115-126146137 TTGTGTAAGGTGTAAGACAGGGG + Intergenic
1197628716 X:128833099-128833121 TTGTATGAGGTGTAAGGAAGGGG + Intergenic
1197825968 X:130590641-130590663 TACTGTGATCTGCATGAAAGTGG + Intergenic
1197852038 X:130872864-130872886 TTGTGTAAGGTGTAAGGAAGGGG - Intronic
1198010367 X:132546375-132546397 TACTGTGAGCAGAAAGATAGAGG - Intergenic
1199003888 X:142673370-142673392 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1199007721 X:142721943-142721965 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1199125175 X:144109914-144109936 TTGTATAAGGTGTAAGAAAGGGG - Intergenic
1199895214 X:152120378-152120400 TTCTGTGAGTTGACAGAAAGCGG + Intergenic
1200383603 X:155865866-155865888 TACTGTGATGAGCATGAAAGCGG - Intergenic
1200452064 Y:3340523-3340545 TTCTGTAAGGTGTAAGGAATGGG - Intergenic
1200505284 Y:4004355-4004377 TTATATAAGGTGTAAGAAAGGGG - Intergenic
1201395711 Y:13545573-13545595 TTGTTTGTGGTGTAAGAAAGGGG - Intergenic
1201537257 Y:15064268-15064290 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1201563084 Y:15338391-15338413 TTGTATAAGGTGTAAGAAAGGGG + Intergenic
1201580577 Y:15507733-15507755 TTGTGTAAGGTGTAAGAAAGGGG - Intergenic
1201961548 Y:19686072-19686094 TTTTATAAGGTGTAAGAAAGGGG + Intergenic
1201970418 Y:19787327-19787349 TTGTGTAAGGTGTAAGGAAGGGG + Intergenic
1202351741 Y:23999932-23999954 TTGTGTAAGGTGTAAGGAAGTGG - Intergenic
1202519038 Y:25670187-25670209 TTGTGTAAGGTGTAAGGAAGTGG + Intergenic