ID: 1091643268

View in Genome Browser
Species Human (GRCh38)
Location 12:2253722-2253744
Sequence GTAGGTTACCAGTGGATGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091643268 Original CRISPR GTAGGTTACCAGTGGATGGA CGG (reversed) Intronic
903309053 1:22438191-22438213 GGTGGTTACCAGTGGCTGGAGGG - Intergenic
905064505 1:35168761-35168783 GGTGGTTACCAGGGGATGGAGGG + Intergenic
905332576 1:37216550-37216572 GGTGGTTACCAGGGGCTGGAGGG + Intergenic
906826733 1:48989532-48989554 GATGGTTACCAGAGGCTGGAAGG - Intronic
914216264 1:145632411-145632433 GATGGTTACCAGAGGCTGGATGG - Intronic
914468835 1:147955070-147955092 GATGGTTACCAGAGGCTGGATGG - Intronic
917250762 1:173058129-173058151 GTGGTTTTCCAGTGGATGGAGGG + Intergenic
917393615 1:174567189-174567211 GTAGGTTACCAGGGGCTGTGGGG - Intronic
918434456 1:184496954-184496976 ATAGGTTACAAATAGATGGAGGG + Intronic
920121558 1:203662474-203662496 GGAGGTTACCACAGGCTGGATGG - Intronic
923235349 1:232027570-232027592 GTGGGTACCCAGTGGATGAAGGG + Intronic
1064646482 10:17464981-17465003 GTTGGTTAGAAGGGGATGGAGGG - Intergenic
1064672508 10:17731177-17731199 GTGGTTTTCCAGTGGATTGAAGG + Intergenic
1067134116 10:43593264-43593286 GTTGGGTACCACTGGATGGATGG + Intergenic
1069058922 10:63873096-63873118 GTAGGGTACCAGGGGAGGGAGGG - Intergenic
1069603644 10:69725974-69725996 GGTGGTTACCAGGGGCTGGAGGG - Intergenic
1070549865 10:77482604-77482626 GAAGGTTACATGTGGCTGGAAGG - Intronic
1070695887 10:78562718-78562740 GCCGGTAAGCAGTGGATGGATGG - Intergenic
1070732700 10:78842275-78842297 GGAGGTGAGAAGTGGATGGAGGG + Intergenic
1070868189 10:79723130-79723152 AGAGGTTACCAGGGGCTGGAAGG + Intergenic
1070949974 10:80423193-80423215 GGAGCTTATCAGTGGAAGGAAGG + Intronic
1071635099 10:87245331-87245353 AGAGGTTACCAGGGGCTGGAAGG + Intergenic
1071660143 10:87492661-87492683 AGAGGTTACCAGAGGCTGGAAGG - Intergenic
1072842523 10:98790465-98790487 GGAGGTTACCAGAGGCTGGGAGG + Intronic
1072986004 10:100141010-100141032 GTAGGTTACTAGGGGCTGGGAGG + Intergenic
1073036194 10:100565627-100565649 GTAGGCTATGAGTGGAGGGAAGG + Intergenic
1075947681 10:126451906-126451928 GTTGGTTACCAGGGGATAGCAGG + Intronic
1077865294 11:6217362-6217384 GTAGCTTACCAGTGAAGGGCTGG + Exonic
1078735042 11:14012034-14012056 GCAGGTAAACAGTGGATGGGTGG + Intronic
1079942750 11:26702235-26702257 GTATATTACCAGTGAATTGATGG + Intronic
1080709537 11:34733828-34733850 CCAAGTTGCCAGTGGATGGAGGG + Intergenic
1081511922 11:43783507-43783529 GTAGATTACGAGTTGATGGGTGG - Intronic
1081516838 11:43840551-43840573 ATAGGTTGCCAGGGGCTGGAGGG - Intronic
1081641348 11:44756579-44756601 GGAGGTTACCAGGGGCTGGGAGG - Intronic
1083036797 11:59645382-59645404 GTAGGTAAAAAGTGGATGGGGGG - Intronic
1084705116 11:70811595-70811617 GTAGATGATGAGTGGATGGATGG - Intronic
1085316509 11:75548325-75548347 GGAGGTGACCAGGGGATGCAAGG + Intergenic
1086147154 11:83564613-83564635 GAATTTTATCAGTGGATGGAGGG - Intronic
1087410768 11:97787710-97787732 GGTGGTTACCAGAGGCTGGAAGG - Intergenic
1090277613 11:125430983-125431005 GTAGCTGACTAGTGAATGGATGG + Intronic
1090515209 11:127417670-127417692 GATGGTTACCAGTGGCTGGGAGG - Intergenic
1091643268 12:2253722-2253744 GTAGGTTACCAGTGGATGGACGG - Intronic
1091798781 12:3311728-3311750 GTAGGTCTCCACTGGATGAACGG + Intergenic
1092070783 12:5629691-5629713 GTAGGATTCCAGTGGATGGGTGG - Intronic
1092838236 12:12512491-12512513 GGTGGTTACCAGGGGCTGGAGGG - Intronic
1093015902 12:14154462-14154484 ATAGGTTACCAGAGGATTGGGGG + Intergenic
1094596800 12:31873408-31873430 GGAGGATACCAGCAGATGGACGG - Intergenic
1095678240 12:44944608-44944630 GTAGATTACTACAGGATGGAAGG + Intergenic
1097430852 12:59504683-59504705 GTAGGTTATAGTTGGATGGATGG + Intergenic
1097971987 12:65643156-65643178 GGTGGTTACCAGAGGCTGGATGG - Intergenic
1100981409 12:100165668-100165690 GTAGGTGACCAGTGGAGCCAAGG + Intergenic
1101584862 12:106076827-106076849 GGAGGTTGCCAGTGGCTGGGAGG + Intronic
1101655264 12:106714774-106714796 GTAGTTTGTTAGTGGATGGAGGG - Intronic
1102939842 12:116929845-116929867 GGCGGTTACCAGTGGCTGGCGGG - Intronic
1104463555 12:128973062-128973084 GTTGGTTACCAGGGGCTGGCAGG - Intronic
1106816039 13:33408320-33408342 GGAGGTTGCCAGGGGCTGGAGGG - Intergenic
1110551953 13:76820518-76820540 GGTGGTTGCCAGGGGATGGAAGG + Intergenic
1112367014 13:98763952-98763974 GTTGGGTACCACTGGATGGATGG - Intergenic
1112851259 13:103709125-103709147 GTAGGCTACCATTTGAGGGAAGG - Intergenic
1115174348 14:30545449-30545471 ATAGGTTAACAGTGAAAGGATGG - Intergenic
1115708550 14:36024732-36024754 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1117412035 14:55458837-55458859 GTATGTTTCCAGTAGAAGGAGGG - Intergenic
1119874470 14:78045732-78045754 GGAGGTTGCCAGGGGCTGGAAGG + Intergenic
1119912604 14:78363718-78363740 GTAAGTTCACAGTGGATGCATGG - Intronic
1120014198 14:79451600-79451622 GTAAGTTACCAGTGGCTTCAAGG + Intronic
1120527000 14:85588777-85588799 GATGGTTACCAGAGGCTGGAAGG - Intronic
1121499770 14:94425459-94425481 GTAGGTTATCAGTAGATGGAGGG + Intergenic
1121537385 14:94700121-94700143 GAGGGATCCCAGTGGATGGAAGG + Intergenic
1121911947 14:97799740-97799762 GATGGTTACCAGAGGCTGGAGGG + Intergenic
1122129990 14:99599339-99599361 GCAGGTTATCAGGGGAGGGAAGG + Intronic
1122425943 14:101605286-101605308 GCTGGTCACCAGTGGGTGGAGGG - Intergenic
1123149540 14:106167541-106167563 GTTGGTTACCAGGGGCTGGAGGG - Intergenic
1123173047 14:106391888-106391910 GTTGGTTACCAGGGGCTGGAGGG - Intergenic
1123582014 15:21724207-21724229 GTTGGTTACCAGGGGCTGGAGGG - Intergenic
1123618661 15:22166803-22166825 GTTGGTTACCAGGGGCTGGAGGG - Intergenic
1123779551 15:23612753-23612775 GGTGGTTACCAGAGGATGAAGGG + Intronic
1124006154 15:25797131-25797153 GGGGGTTACCAGAGGTTGGAAGG - Intronic
1124431638 15:29613584-29613606 GTTCTCTACCAGTGGATGGATGG - Intergenic
1126503587 15:49377038-49377060 GATGGTTACCAGAGGCTGGAAGG - Intronic
1126686477 15:51252684-51252706 GGAGGGTTCCAGTGCATGGAGGG + Intronic
1127192997 15:56552295-56552317 GGTGGTTACCAGGGGCTGGAGGG + Intergenic
1127879620 15:63145245-63145267 GCTGGTTACCAGGGGCTGGAAGG - Intronic
1130024400 15:80259044-80259066 ATAGGTAGCCAGAGGATGGAGGG + Intergenic
1130191686 15:81742876-81742898 GGTGGTTTCCAGGGGATGGAGGG - Intergenic
1130545691 15:84856579-84856601 GGAAGATACAAGTGGATGGAAGG + Exonic
1132130536 15:99273914-99273936 CTAGGGAACCAGTGGGTGGAGGG - Intronic
1136680517 16:31959244-31959266 GTTGGTTACCAGGGGCTGGAGGG + Intergenic
1136780858 16:32900790-32900812 GTTGGTTACCAGGGGCTGGAGGG + Intergenic
1136889556 16:33958879-33958901 GTTGGTTACCAGGGGCTGGAGGG - Intergenic
1137643305 16:50052664-50052686 GATGGTTACCAGGGGCTGGAAGG + Intergenic
1137663204 16:50227883-50227905 CTCGGTTCCCAGTGGACGGACGG - Exonic
1139500406 16:67359455-67359477 GTTGGTTGCCAGAGGATGGAAGG + Intronic
1140177656 16:72679942-72679964 GTAGATTACCAGGGGCTGCAGGG + Intergenic
1140256040 16:73337213-73337235 GGAGGTTAGGAATGGATGGAAGG - Intergenic
1140734612 16:77887246-77887268 GTAGGTTAACAAGGGCTGGATGG + Intronic
1140855714 16:78975935-78975957 GGAGGGTATCAGGGGATGGAGGG - Intronic
1140859391 16:79005934-79005956 GTGGGTAACCAGAGTATGGATGG - Intronic
1141602244 16:85133893-85133915 TTAGGTTCCCAGTGGGTGAAAGG - Intergenic
1203083510 16_KI270728v1_random:1164819-1164841 GTTGGTTACCAGGGGCTGGAGGG + Intergenic
1144444522 17:15314711-15314733 CAAGGTTACCAATGGATGGCAGG - Intronic
1147019574 17:37520785-37520807 GCAGGTTCCCAGTGGATGTGTGG - Intronic
1147770799 17:42866693-42866715 CTAGGATTCTAGTGGATGGATGG + Intergenic
1148994595 17:51698723-51698745 GGTGGTTACCAGGGGTTGGAAGG - Intronic
1150595849 17:66603775-66603797 GGTGGTTACCAGGGGCTGGAGGG - Intronic
1153166754 18:2270241-2270263 GTTGGGTACCAGTGGATGCTAGG - Intergenic
1154321399 18:13356251-13356273 GGAGATTCCCATTGGATGGATGG - Intronic
1157489809 18:48115086-48115108 AGAGGTTACCAGGGGCTGGATGG - Intronic
1157733733 18:50028000-50028022 AGAGGTTACCTGGGGATGGAGGG + Intronic
1158238255 18:55344890-55344912 GAAGGTTAACTGTGGATGAAAGG - Intronic
1158837956 18:61351293-61351315 GGAGCTTACCAGAGGATGGGGGG - Intronic
1160767788 19:816125-816147 GATGGTTCCCAGTGGATGGATGG - Intronic
1161808590 19:6459095-6459117 GTAGGTGCCCAGAGGATGGAGGG + Intronic
1163171355 19:15533419-15533441 CGAGGTTACCAGCGGATGGGAGG - Intronic
1164398417 19:27886361-27886383 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165137978 19:33682565-33682587 GCAGGTTACCAGGGACTGGAAGG - Intronic
1165919822 19:39289174-39289196 GTAGGTTAAAAGTAAATGGATGG - Intergenic
1166422012 19:42644002-42644024 GGAGGCTACCAGAGGGTGGAGGG - Intronic
1168090401 19:54079295-54079317 GGAGGTTACCAGGGGCTGGGAGG + Intronic
925323389 2:2995471-2995493 TTAGGTTCCCAATGGATGGGAGG + Intergenic
925909283 2:8562607-8562629 GGTGGTTACCAGGGGCTGGAAGG + Intergenic
926176120 2:10593812-10593834 GTAGGTCACAAGAGGTTGGAGGG - Intronic
926705861 2:15837039-15837061 GTTGGTTGCCAGGGGCTGGAGGG + Intergenic
926929856 2:18026439-18026461 GGTGGTTACCAGAGGCTGGAGGG - Intronic
927594562 2:24385306-24385328 GATGGTTACCAGAGGCTGGAGGG - Intergenic
928493386 2:31806404-31806426 GTATGGTACAAGTGGATAGATGG - Intergenic
929180436 2:39032290-39032312 GGTGGTTACCAGAGGCTGGAGGG - Intronic
929751370 2:44717461-44717483 GTGGGAAAGCAGTGGATGGAGGG - Intronic
933556092 2:83832435-83832457 GAATGTTACCAGGGGCTGGATGG - Intergenic
933810981 2:86032515-86032537 GTTGGGTGGCAGTGGATGGAGGG - Intronic
935716729 2:105945859-105945881 GGAGGTTGCCAGTGGCTGCAGGG + Intergenic
936156842 2:110052454-110052476 GCAGATGTCCAGTGGATGGATGG + Intergenic
936187852 2:110318990-110319012 GCAGATGTCCAGTGGATGGATGG - Intergenic
936549071 2:113419342-113419364 GATGGTTACCAGAGGCTGGAAGG + Intergenic
936580371 2:113695108-113695130 GATGGTTACCAGAGGCTGGAGGG + Intergenic
937463870 2:122112218-122112240 CTAGCGTTCCAGTGGATGGATGG + Intergenic
938633229 2:133192075-133192097 GTGTGTTATCAGTGGAGGGACGG + Intronic
942079635 2:172387855-172387877 GTAGGTAATAAATGGATGGATGG - Intergenic
942534577 2:176949639-176949661 ATAAATTACCAGTGAATGGATGG + Intergenic
942769633 2:179501562-179501584 GATGGTTACCAGAGGCTGGAAGG + Intronic
943614367 2:190075693-190075715 GTAGGTTGAAAGTGAATGGATGG - Intronic
944344919 2:198651728-198651750 GAATGTTACCAGTGGATCCATGG + Intergenic
945149009 2:206768240-206768262 GAAGGTTAAAATTGGATGGAGGG + Intronic
1169809910 20:9599033-9599055 CGAGGTTACCAGGGGCTGGAGGG - Intronic
1170344656 20:15371036-15371058 CCAGGTAACCTGTGGATGGAAGG - Intronic
1171112465 20:22496505-22496527 CTAGTTTACCATTGTATGGAGGG - Intergenic
1173046104 20:39513825-39513847 GTTGGTTGCCAGGGGCTGGAAGG + Intergenic
1174862874 20:54108522-54108544 GTAGGTTAACAGGGTTTGGAAGG - Intergenic
1175438269 20:58971134-58971156 GTTGGTTACCAGAGGCTGGAAGG + Intergenic
1175701759 20:61143360-61143382 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1175705982 20:61177101-61177123 GTTGGTTACCAGGAGCTGGAGGG + Intergenic
1178368668 21:32009043-32009065 GTAGGTGATGAATGGATGGATGG + Intronic
1178380513 21:32103799-32103821 TCAAGTTTCCAGTGGATGGAAGG - Intergenic
1178666277 21:34549816-34549838 GTAGGTGTTCGGTGGATGGATGG - Intronic
1179357062 21:40670273-40670295 GGTGGTTACCAGGGGCTGGAAGG - Intronic
1180158951 21:45990537-45990559 GAAGGTGACCAGGGGAAGGACGG + Intronic
1182959401 22:34457984-34458006 GCAGGTTCCCAGTGGGTAGAAGG - Intergenic
1184414696 22:44345500-44345522 GTAGGTAATTGGTGGATGGATGG + Intergenic
949579258 3:5370810-5370832 GGTGGTTGCCAGGGGATGGAGGG - Intergenic
951064241 3:18245909-18245931 GGTGGTTGCCAGGGGATGGAGGG - Intronic
952052394 3:29400402-29400424 GTTAGTTACCAGAGGCTGGAAGG + Intronic
952715545 3:36476318-36476340 GTGGGTTCCCTGTGGAGGGAAGG + Intronic
953560064 3:43981545-43981567 GGAGGTTACCAGAGGGTGAAGGG - Intergenic
953731767 3:45455974-45455996 GATGGTTACCAGAGGCTGGAGGG + Intronic
953927502 3:46989854-46989876 GTAGGGTACAAGTGGCTAGAAGG - Intronic
955670821 3:61400669-61400691 AGAGGTTACCAGAGGCTGGAAGG - Intergenic
958516170 3:95118865-95118887 GTAGGTTAGAAGTAAATGGATGG - Intergenic
959559369 3:107761927-107761949 GGGGGTTACCATAGGATGGAAGG - Intronic
962121944 3:132570663-132570685 GTAGCCTACCAGAGGGTGGAAGG - Intronic
962962140 3:140320982-140321004 GTATGGTACCACTGGGTGGAGGG - Intronic
964707176 3:159631649-159631671 AGAGGTTACCAGGGGCTGGAGGG + Intronic
964989056 3:162783942-162783964 GTTGGTTGCCAGGGGATGGGGGG + Intergenic
966217948 3:177521620-177521642 GTAGCTTACCTGGTGATGGAGGG + Intergenic
970944538 4:21675279-21675301 GTCGGTTACCAGAGGCTGGAAGG + Intronic
973737702 4:53888791-53888813 GTTGGGTGCCAGGGGATGGAGGG + Intronic
975227136 4:71886721-71886743 GGTGGTTACCAGAGGATGGGTGG - Intergenic
978334317 4:107649206-107649228 GCAGGCAACCAGAGGATGGACGG + Intronic
979384460 4:120048099-120048121 GGTGGTTACCAGGGGCTGGAGGG + Intergenic
982359677 4:154505990-154506012 GTAGTTTGTCAGTGGAGGGATGG - Intergenic
982915971 4:161209705-161209727 GATAGTTACCAGTGGATGGAGGG - Intergenic
985287558 4:188351868-188351890 GGTGGTTACCAGAGGCTGGAGGG - Intergenic
985703690 5:1388574-1388596 GTAGGTTATGGATGGATGGATGG - Intergenic
986263729 5:6174131-6174153 GGTGGTTACCAGAGGCTGGAGGG + Intergenic
987743805 5:21944822-21944844 TGAGGTTGCCAGTGGGTGGAGGG + Intronic
987987625 5:25169083-25169105 GGAGGTTACCAGAGGCTGGAGGG + Intergenic
991764004 5:69954963-69954985 TGAGGTTGCCAGTGGGTGGAGGG + Intergenic
991783321 5:70163172-70163194 TGAGGTTGCCAGTGGGTGGAGGG - Intergenic
991843236 5:70830033-70830055 TGAGGTTGCCAGTGGGTGGAGGG + Intergenic
991875765 5:71163508-71163530 TGAGGTTGCCAGTGGGTGGAGGG - Intergenic
1001162093 5:169328482-169328504 GTAGTATTCCATTGGATGGATGG - Intergenic
1001241077 5:170070182-170070204 GGAGGTGAGCAGTGGATGCAGGG + Intronic
1002333040 5:178458277-178458299 GTAGCTGAACAGTGGATGCAGGG + Intronic
1002505439 5:179676267-179676289 TTAGGTTACCAAGGGATGGGAGG - Intergenic
1004001013 6:11597349-11597371 GGAGGTTACCAGGGGCTGGGGGG - Intergenic
1004751602 6:18567534-18567556 GGTGGTTACCAGAGGCTGGAAGG - Intergenic
1006392277 6:33765535-33765557 GCAGGTTAGCAGTGAAGGGAGGG - Intergenic
1006448929 6:34094933-34094955 GGTGGTGAGCAGTGGATGGACGG + Intronic
1007466371 6:42054493-42054515 AGAAGTTACCAGGGGATGGAGGG - Intronic
1008601751 6:53102873-53102895 GGTGGTTACCAGGGGCTGGAGGG + Intergenic
1008717213 6:54303485-54303507 GTAGTTTACCAGTGTCTGGTAGG - Intergenic
1011785938 6:90845095-90845117 GTAGGCTCCCTGTGGAGGGATGG + Intergenic
1011946858 6:92915616-92915638 GGTGGTTGCCAGTGGCTGGAGGG + Intergenic
1012823533 6:104120212-104120234 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1014189811 6:118482368-118482390 GTTGGTTACCAGGAAATGGAGGG - Intronic
1016725241 6:147357656-147357678 GTAGATTACCAATGGAAGGAAGG + Intronic
1019175170 6:170155722-170155744 CTAGGTGAGCAGTGGATGCAGGG + Intergenic
1019231730 6:170571202-170571224 GTTGATAACCACTGGATGGAAGG - Intronic
1021080051 7:16353409-16353431 GGTGGTTACCAGAGGCTGGAAGG + Intronic
1021293357 7:18873285-18873307 GTGGTTTACCAGTTGTTGGAAGG + Intronic
1022103406 7:27182429-27182451 GTAGGCTCCCAGTAGAGGGAGGG + Exonic
1023421535 7:39985127-39985149 GACGGTTACCAGAGGCTGGAGGG - Intronic
1024326989 7:48116503-48116525 GCTGGTCACCAGTGGATGTAGGG + Intergenic
1026423487 7:70265634-70265656 GCAGGTTACCAGCAGGTGGAAGG + Intronic
1028264607 7:88706760-88706782 GTTGGTTACTAGGGGCTGGAAGG - Intergenic
1029630923 7:101749592-101749614 GTCCCTTTCCAGTGGATGGAGGG + Intergenic
1030676224 7:112388678-112388700 CATGGTTACCAGGGGATGGAGGG + Intergenic
1031229641 7:119089079-119089101 GTTTGTTACCAGAGGATGAAGGG - Intergenic
1032143694 7:129358569-129358591 CTTGGTTACCAGGGGCTGGAGGG + Intronic
1032938065 7:136756973-136756995 GCAGGTTTCCAGTGAAAGGAAGG - Intergenic
1033364212 7:140659139-140659161 GTTGGGTACCACTGGATGGATGG - Intronic
1033877054 7:145834437-145834459 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1034738523 7:153452033-153452055 TCAGGATACCAGTGGAGGGAGGG + Intergenic
1036083059 8:5579480-5579502 CTCTGTTACCAGTAGATGGAGGG + Intergenic
1037072544 8:14669486-14669508 GGTGGTTACCTATGGATGGAGGG - Intronic
1040697792 8:50023087-50023109 CAAGGTTGGCAGTGGATGGATGG + Intronic
1041723999 8:61001617-61001639 GTAGTTTCCCATTGTATGGATGG + Intergenic
1041896465 8:62930229-62930251 GGAGGTTACTAGAGGCTGGAGGG - Intronic
1042849118 8:73198305-73198327 GTAGGGTCCCAGGGGATGGCAGG + Intergenic
1042955016 8:74240416-74240438 GATGGTTACCAGAGGCTGGATGG - Intronic
1042986682 8:74592116-74592138 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1046433764 8:114161709-114161731 GAAGGTTACCAGAGGCTGGTTGG - Intergenic
1046616463 8:116482995-116483017 GTACATTACCAGAGGCTGGAGGG + Intergenic
1047140293 8:122131209-122131231 GATGGTTACCAGAGGATGTAGGG + Intergenic
1049903871 9:197508-197530 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1053322789 9:37115245-37115267 GTAGGCTTGCAGTGGATGAATGG + Intergenic
1053746877 9:41207807-41207829 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1054480407 9:65657552-65657574 GATGGTTACCAGAGGCTGGAAGG + Intergenic
1054681467 9:68223474-68223496 GATGGTTACCAGAGGCTGGAAGG + Intergenic
1055683769 9:78747033-78747055 GGAGGTTATCAGAGGCTGGAGGG - Intergenic
1057004184 9:91542033-91542055 GGTGGTTACCAGAGGCTGGAAGG + Intergenic
1202783008 9_KI270718v1_random:18587-18609 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1186974190 X:14882318-14882340 GTCAGTTACCAGGGGCTGGAGGG + Intronic
1187512071 X:19928902-19928924 GGTGGTTACCAGAGGCTGGAGGG + Intronic
1188534962 X:31186489-31186511 GTGGCTTATCAGAGGATGGAGGG + Intronic
1188712921 X:33424109-33424131 GGTTGTTACCAGGGGATGGAGGG + Intergenic
1189373983 X:40452018-40452040 ATGGGGTACAAGTGGATGGAAGG + Intergenic
1190158027 X:48009301-48009323 ATAGGATAACAGTGAATGGAGGG - Intronic
1190173798 X:48132185-48132207 ATAGGATAACAGTGAATGGAGGG - Intronic
1192409134 X:70916940-70916962 GGTGGTTACCAGAGGCTGGAGGG - Intergenic
1193397197 X:80999636-80999658 GATGGTTACCAGAGGCTGGAAGG + Intergenic
1194523877 X:94951960-94951982 GATGGTTACCAGAGGCTGGAAGG + Intergenic
1197711086 X:129668360-129668382 ATTGGTTGCCAGGGGATGGAAGG - Intergenic
1199048783 X:143210440-143210462 GATGGTTACCAGAGGCTGGAAGG + Intergenic
1199370026 X:147036411-147036433 GGTGGTTACCAGAGGTTGGAAGG - Intergenic
1199918237 X:152368299-152368321 GGTGGTTACCAGGGGCTGGAAGG - Intronic