ID: 1091644498

View in Genome Browser
Species Human (GRCh38)
Location 12:2263532-2263554
Sequence CGGTGTTGGTAGAAGTGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091644498 Original CRISPR CGGTGTTGGTAGAAGTGTGA CGG Intronic
900802340 1:4745260-4745282 CGGTGCTGGCAGAGGTGGGAGGG - Intronic
901441056 1:9278763-9278785 TGGTGTTGGGGGAAGTGAGAAGG - Intergenic
901917996 1:12514880-12514902 CAGTGCTGGTAGGAATGTGAAGG + Intergenic
905264499 1:36741993-36742015 TGCTGTTAGTAGAAGTGGGATGG - Intergenic
906784149 1:48599564-48599586 AGGTGGTGGTAGAGGTGAGAAGG + Intronic
915617063 1:157046542-157046564 CGGTGGTATTAGAAGTGGGAAGG - Intergenic
922013887 1:221623013-221623035 AGTTGTTGGTCGAAGAGTGAAGG + Intergenic
922365594 1:224860530-224860552 CTTTGTTAGTATAAGTGTGATGG - Intergenic
1063191232 10:3696766-3696788 AGGTGTTGGCAGAAGTTTTATGG + Intergenic
1065348622 10:24774221-24774243 TGGGGTTGTTAGAAGTGTGAGGG - Intergenic
1067924772 10:50497040-50497062 CAGTGTTGGAAGAAGGGTGGAGG - Intronic
1068015538 10:51512121-51512143 GGGTGGTGGTAGGACTGTGAGGG + Intronic
1068876900 10:62006584-62006606 CAGTGCTGGTAGAGGTGTAATGG + Intronic
1070271016 10:74955024-74955046 CAGTGGTGGTAGAGGGGTGAGGG - Intronic
1082636899 11:55607259-55607281 AGCTGTTGGTAGAAGTGGGTAGG - Intergenic
1084694317 11:70744650-70744672 CCGTGGTGGTGGAATTGTGATGG + Intronic
1084711306 11:70845547-70845569 CGGTGTTGGAAGAAATGGGTGGG + Intronic
1085184051 11:74560266-74560288 AGCTGTTGGGAGAAGTGTGATGG - Intronic
1086932217 11:92705519-92705541 TGGTGTTGGTGGTGGTGTGATGG + Intronic
1086932272 11:92705801-92705823 TGGTGTTGGTGGTGGTGTGATGG + Intronic
1088102460 11:106170352-106170374 TGGAGTTGGCCGAAGTGTGAAGG - Intergenic
1088801082 11:113307942-113307964 CAGTGTTGGGAGAAGTGAAATGG - Intergenic
1091644498 12:2263532-2263554 CGGTGTTGGTAGAAGTGTGACGG + Intronic
1098596603 12:72279653-72279675 TGGTGGTGGTGGCAGTGTGAGGG + Intronic
1101675828 12:106915305-106915327 AGGTGTTTGCAGAAGTGTGGGGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1108013641 13:46049960-46049982 TGATGTGGGTGGAAGTGTGATGG - Intronic
1109083972 13:57946370-57946392 AGGTGGTGGTAGAAGAGGGAAGG + Intergenic
1109112909 13:58345921-58345943 CTGTCTTGTTAGAAGTGAGAGGG - Intergenic
1110575839 13:77054035-77054057 TGGTGTTGATGGAAGTGAGATGG + Intronic
1116853640 14:49932563-49932585 CAGTGTTGGTAGAACTGGCATGG - Intergenic
1121302831 14:92885586-92885608 AGGTGAGGGTTGAAGTGTGAAGG + Intergenic
1122587724 14:102821260-102821282 CGGTGTTACTAAAAGTGTCACGG - Intronic
1125516700 15:40324630-40324652 CGGCGATGGTGGGAGTGTGAGGG - Intergenic
1126800235 15:52291555-52291577 CTGTTTGGGTAGAACTGTGAAGG - Intronic
1128675935 15:69608409-69608431 CTGTGTGGGTAGAGGAGTGAAGG + Intergenic
1128887573 15:71302802-71302824 TGGTGTTGGAAGAAGGGGGAAGG - Intronic
1130032188 15:80326333-80326355 TGCTGTTTGTGGAAGTGTGAGGG + Intergenic
1135424370 16:22325001-22325023 GGGTGTTGGCAGAAGACTGATGG + Intronic
1140687260 16:77445432-77445454 CGGTGTTGGTGGAGGATTGAAGG - Intergenic
1140942211 16:79732828-79732850 CAATGTTGGTAGAGGGGTGAGGG - Intergenic
1143261997 17:5606425-5606447 CTGTGTTGGAAGAAGTGTTTGGG + Intronic
1149995150 17:61402337-61402359 GGGTCTTGGCAGAAGGGTGATGG - Intronic
1151035569 17:70794847-70794869 AGGTTTTGGCAGAAGTGTGAAGG + Intergenic
1152076900 17:78165334-78165356 CAGACTTGGTAGAAGTGAGATGG - Intronic
1153132816 18:1876938-1876960 GGGTGTAGGTAGATGTGTTAGGG - Intergenic
1154485905 18:14871148-14871170 CGGTGTGGGTAGGGGTGTGTGGG - Intergenic
1155596364 18:27492720-27492742 TGATTTTGGTAGCAGTGTGAAGG + Intergenic
1161261458 19:3340098-3340120 GGGTGTTGGTGGAGGTGTCAGGG + Intergenic
1163855337 19:19697345-19697367 AGATGTTGGTGGAAGTGGGAGGG - Intergenic
925957121 2:8977826-8977848 AGGTTTTGGTTGAAGTGTGATGG - Intronic
932258073 2:70303812-70303834 CAGTGTTGGAAGAGGTGTGCTGG + Intergenic
936908328 2:117563472-117563494 CAGCTTTGGTAGAGGTGTGAGGG - Intergenic
937472586 2:122186824-122186846 CGGTGTGGGTGGAAGAGAGATGG - Intergenic
941892200 2:170594247-170594269 CGGTGGTGGTAGAAATGACAGGG - Intronic
946423243 2:219576959-219576981 GGGTGTTGGTGTAACTGTGACGG - Intergenic
1169417921 20:5433311-5433333 CGGAGTGGTTAGAAGGGTGAAGG - Intergenic
1171769876 20:29314092-29314114 ATGTGTTGGGAGAAGTGTCAAGG + Intergenic
1174100495 20:48123065-48123087 CTGTGTTAGTTGAAGTTTGAGGG - Intergenic
1176795398 21:13368230-13368252 CGGTGTGGGTAGGGGTGTGTGGG + Intergenic
1179841379 21:44077004-44077026 CGGCGTAGGCAGAAGTGTGGTGG + Intronic
1183164955 22:36140619-36140641 AGGTGGTGGTTGTAGTGTGATGG - Exonic
949743557 3:7263711-7263733 TCGTGCTGGTAGCAGTGTGACGG + Intronic
950159272 3:10747349-10747371 AGGTGTTGGTGGTGGTGTGAGGG - Intergenic
955493885 3:59510990-59511012 GGGTGTTGGTGGGAGTGGGAGGG + Intergenic
957906237 3:86559956-86559978 TGCTGTAGGTATAAGTGTGAAGG + Intergenic
967886647 3:194337900-194337922 TGGTGTTGGGAGATGTGAGAGGG + Intergenic
968590078 4:1453660-1453682 TGGTGATGGTAAAAATGTGATGG - Intergenic
968664171 4:1811613-1811635 CGGTGCTGGCAGGAGTGTGCTGG - Exonic
970907116 4:21228859-21228881 CGGGCTTGGAAGAAGTCTGAAGG - Intronic
977339694 4:95743163-95743185 TGGTGATGGTAGAAGTGATATGG + Intergenic
978880005 4:113690259-113690281 AGATGTTGGTAAAATTGTGATGG + Intronic
982494565 4:156074619-156074641 TGGTGATGGTAGAAGGGTAAAGG - Intergenic
983530263 4:168803226-168803248 CAGTCGTGGTGGAAGTGTGAAGG + Intronic
987191786 5:15486199-15486221 CAGTGTTGGTGGAAGAGTGGAGG + Intergenic
989832362 5:45936352-45936374 CTGTTTTGGTGGAACTGTGAAGG + Intergenic
990289539 5:54334352-54334374 CTGTGTTGGTAGCAGTGGGCAGG - Intergenic
993002822 5:82399403-82399425 CAGTGTTGCTAGAGGAGTGATGG + Intergenic
995246899 5:109945095-109945117 CGGTGTTGCTGGAAGGCTGAGGG + Intergenic
997121419 5:131176964-131176986 AGGTGCTAGTAGAACTGTGAGGG - Intronic
997147838 5:131456728-131456750 TGGTGTTGGTAAAAGTCAGATGG - Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
999646414 5:153721512-153721534 CTGTCATGGGAGAAGTGTGAAGG - Intronic
1000720925 5:164705601-164705623 CTGTGTTGGTAGAGGTAGGATGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004995974 6:21193510-21193532 AGAGGTTGGTAGAAGTGGGACGG - Intronic
1005024306 6:21448054-21448076 GGGTGTTGGTGAAAGTGGGAAGG + Intergenic
1005242309 6:23845587-23845609 GTGTGTTGGCACAAGTGTGAAGG + Intergenic
1005334912 6:24786425-24786447 AGGAGTGGGTAGAAGTTTGACGG + Intergenic
1007758410 6:44116329-44116351 TGTTGCTGTTAGAAGTGTGATGG - Intronic
1007943865 6:45807741-45807763 CGGTGGTGTCAGAAATGTGAGGG + Intergenic
1008439980 6:51521514-51521536 AGGTTGGGGTAGAAGTGTGAAGG - Intergenic
1011717760 6:90124893-90124915 CAGTGTTGGCAAGAGTGTGAGGG - Intronic
1017047393 6:150360047-150360069 TGGTGTTGGTGGAAGTGACATGG - Intergenic
1017753326 6:157509145-157509167 GGGTGTTGGAAGAAGTGTGTTGG - Intronic
1018910609 6:168099224-168099246 CGGTGTTGGGAGAGGTGGCAGGG - Intergenic
1019433669 7:1011128-1011150 CGGTGTGGGTACATGGGTGAGGG - Intronic
1022763359 7:33381290-33381312 CAGTGATGGCAGAAGAGTGATGG + Intronic
1026383473 7:69822249-69822271 CTGTGTTGCTAAAATTGTGATGG - Intronic
1027697655 7:81431926-81431948 TAGGGTTGGTAGAAGGGTGAGGG - Intergenic
1028019132 7:85749408-85749430 CAGTTTGGGTAGAAGTGGGATGG - Intergenic
1028311064 7:89336585-89336607 TGGTGGTGATAGAAGTGTGCTGG - Exonic
1029717679 7:102341278-102341300 AGGTGTTGGCAGAAGGGTGGGGG - Intergenic
1031844990 7:126794702-126794724 CGGTGTTTGTCAAAGTGTGGTGG + Intronic
1034030986 7:147763371-147763393 TGGTGTTGGGAGAAATGAGAGGG + Intronic
1037689573 8:21170791-21170813 CAGTGGTGGTAGCAGTGAGAAGG + Intergenic
1039372694 8:37002710-37002732 GGGTGTAGTTAGAACTGTGAGGG - Intergenic
1045908849 8:107381516-107381538 GGGTCTTGGCAGCAGTGTGAGGG + Intronic
1046454733 8:114442870-114442892 GGGTGTTGTTAGAAGTGAGCTGG - Intergenic
1047321135 8:123784176-123784198 TGGACTTGGTAGAAGGGTGAGGG - Intronic
1050931533 9:11334266-11334288 GGGTATAGGTAGAAGTGGGATGG + Intergenic
1054177915 9:61888916-61888938 TGGTGTTGGAAGAACTGTGTTGG + Intergenic
1054659614 9:67691908-67691930 TGGTGTTGGAAGAACTGTGTTGG - Intergenic
1057698762 9:97347934-97347956 AGGGGTTGATAGAAGTGTTAAGG + Intronic
1191587365 X:62843333-62843355 GGGTGTTAGTAGAAGTGTTTTGG - Intergenic
1196192730 X:112811418-112811440 TGGTGATGGTAGGAGGGTGATGG + Intronic
1198542764 X:137657675-137657697 TGGTGTGGGTAGAAGTTTCAAGG - Intergenic