ID: 1091644831

View in Genome Browser
Species Human (GRCh38)
Location 12:2265530-2265552
Sequence CTATCTGTAATGAAGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091644831_1091644839 21 Left 1091644831 12:2265530-2265552 CCCTGTCCCTTCATTACAGATAG 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1091644839 12:2265574-2265596 TTGCTGAATAGCATCCCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 122
1091644831_1091644840 22 Left 1091644831 12:2265530-2265552 CCCTGTCCCTTCATTACAGATAG 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1091644840 12:2265575-2265597 TGCTGAATAGCATCCCCCAGGGG 0: 1
1: 0
2: 1
3: 11
4: 104
1091644831_1091644838 20 Left 1091644831 12:2265530-2265552 CCCTGTCCCTTCATTACAGATAG 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1091644838 12:2265573-2265595 GTTGCTGAATAGCATCCCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 71
1091644831_1091644835 -2 Left 1091644831 12:2265530-2265552 CCCTGTCCCTTCATTACAGATAG 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1091644835 12:2265551-2265573 AGTCCAACCTCTTTGTTCTGTGG 0: 1
1: 0
2: 0
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091644831 Original CRISPR CTATCTGTAATGAAGGGACA GGG (reversed) Intronic
900724235 1:4204682-4204704 GTATCTGGAATTAAGGGGCAAGG + Intergenic
900842833 1:5069016-5069038 TTCTCTGTAAAGCAGGGACAGGG + Intergenic
904324600 1:29720174-29720196 CCATCTGTAAGTCAGGGACAGGG - Intergenic
904597147 1:31654040-31654062 CTCTCTGTAAAAAAAGGACAAGG + Exonic
908181324 1:61609214-61609236 ATATCTGTTATGCAGGGTCAGGG + Intergenic
909226141 1:73025513-73025535 CTATATCTAATGAAGGAGCAAGG - Intergenic
910335847 1:86130532-86130554 ATATGTGTAATGAAAGGACTGGG - Intronic
912671447 1:111631379-111631401 CTATCTGTAATGGACCTACAGGG + Intronic
912728219 1:112077763-112077785 CTATCTGGAAAGATGGGAGAGGG + Intergenic
913297001 1:117331678-117331700 CTTTCTGTAATAAAGCAACATGG - Intergenic
914825196 1:151134442-151134464 CCATCTATGAAGAAGGGACAGGG + Exonic
915151590 1:153836673-153836695 CTATGTGTACTTAAGAGACAGGG - Intronic
915724339 1:158007148-158007170 CTAACTATAATGGGGGGACATGG + Intronic
917437730 1:175038122-175038144 GTTTCAGTAATGAAGGGAAATGG + Intergenic
917603114 1:176597139-176597161 CAATTTGGAATCAAGGGACATGG + Intronic
918647950 1:186923875-186923897 CTATCTGTCATGAGGGGAACAGG - Intronic
921417691 1:214909807-214909829 CTTTCTGTAATTAAGGGAGTTGG - Intergenic
921506747 1:215980578-215980600 TTATCTGTGAGGAAGGGAAAGGG - Intronic
924093392 1:240525371-240525393 TTTTCTGGAATGAAGGGAAATGG + Intronic
924291664 1:242542869-242542891 CCATTTGTAATGAAGTGCCAAGG - Intergenic
924294018 1:242567264-242567286 ATATCTATAATGAAGGGTGAGGG + Intergenic
1067940050 10:50647676-50647698 AGATATGTAATGAAGGGAGATGG + Intergenic
1071728140 10:88220041-88220063 CCATCTGCAGTGAAGGGCCAAGG + Intergenic
1073167172 10:101466020-101466042 CTATCTGCAATCAAGGGCAAAGG + Intronic
1074594933 10:114854115-114854137 CTATCTGTAGTGAAAGACCAGGG + Intronic
1077482391 11:2821905-2821927 CACTCTGCCATGAAGGGACAGGG - Intronic
1079022611 11:16922353-16922375 CTATTTGTTAAGTAGGGACAAGG - Intronic
1081881498 11:46456758-46456780 AAATCTGCAATGAAGGGAAATGG + Intronic
1082621170 11:55424090-55424112 CTATGTGTCATGGAGGGACCAGG + Intergenic
1083591678 11:63899033-63899055 CTATCTGAAAGGAAGGAAGAAGG - Exonic
1085176323 11:74491639-74491661 CTTTCTGCAATAAAGGGAAAAGG - Intergenic
1085846596 11:80073067-80073089 CTATCTATCTTGAAGGGAGAAGG + Intergenic
1088291944 11:108248526-108248548 CTTTCTGAAATGAAGATACAGGG - Intronic
1089605799 11:119640525-119640547 CTATCTGTACTGAAGAGGCTTGG - Intronic
1091345619 11:134851600-134851622 CTATCTGAAATAAAAGGGCAAGG + Intergenic
1091644831 12:2265530-2265552 CTATCTGTAATGAAGGGACAGGG - Intronic
1092905025 12:13093360-13093382 GAATCTGTAATGCAGGGAAAAGG - Intronic
1097613575 12:61857536-61857558 CTCTCTGTATTGAAGGGAGCTGG + Intronic
1099022893 12:77428284-77428306 ATAACTGTAATGAAAGAACATGG - Intergenic
1103722356 12:122981576-122981598 CTCTCTGTGATGCAGGGAGAAGG - Exonic
1103906568 12:124330758-124330780 CCAGCTGTCATGAAGGGACGAGG - Intronic
1104092173 12:125526310-125526332 CTATCAGGAAGGAAGGGGCAGGG + Intronic
1106879247 13:34111468-34111490 TTAGCTCTAATGAAGGGGCATGG - Intergenic
1112049573 13:95632343-95632365 CTTTCTGTGATGGAGGGCCAGGG - Intronic
1112579964 13:100669989-100670011 CTGGCTGTAATGAAGGCTCAGGG + Intronic
1113574638 13:111385947-111385969 CTATTGGAAATGAAGGAACAGGG + Intergenic
1114834147 14:26183528-26183550 GTATCTGTCATTAATGGACAGGG - Intergenic
1116133597 14:40891742-40891764 CTGTGTGTAGTGTAGGGACATGG - Intergenic
1118550049 14:66940197-66940219 CTATCTGTGAAGAGAGGACAGGG + Intronic
1120694774 14:87632514-87632536 CTATCTGTTAAGAAGGAAAATGG + Intergenic
1122064282 14:99160627-99160649 TTATCTGTAAAAAGGGGACAAGG - Intergenic
1122198852 14:100109680-100109702 CTATCTGTGATTGAGGGACATGG + Intronic
1125059339 15:35400385-35400407 ATATATGTAATGGAGGGAAAGGG + Intronic
1125761731 15:42100732-42100754 CTTGCTGTAAGCAAGGGACAGGG + Intergenic
1127537695 15:59905510-59905532 CTGACAGTAATGAGGGGACATGG + Intergenic
1135971661 16:27076365-27076387 CTATCTGGGGGGAAGGGACATGG - Intergenic
1136396406 16:29994889-29994911 CTATCCGAAGTGAAGGGAGAAGG - Intronic
1136604513 16:31324385-31324407 GGATCTGTCCTGAAGGGACAGGG - Exonic
1137475902 16:48810478-48810500 CTCTCTGTAATTCAGGGACAGGG - Intergenic
1138337445 16:56264237-56264259 ATATCTGTAATCTAGGGCCAGGG + Intronic
1138703280 16:58887651-58887673 CAATCTGTGATGAAGGCAAATGG - Intergenic
1139033392 16:62912574-62912596 CTATGTGTCATGGAGGGACCTGG - Intergenic
1139993626 16:70960315-70960337 CAATATGTAATCAAAGGACATGG - Intronic
1141062609 16:80887951-80887973 CTAGATGTAATGAAAGTACAAGG - Intergenic
1141376379 16:83534516-83534538 CTATGTGAAATGAATGTACATGG + Intronic
1145270754 17:21403695-21403717 ATAGCTGTGATGAAGGGAGAGGG + Intronic
1145308961 17:21691082-21691104 ATAGCTGTGATGAAGGGAGAGGG + Intergenic
1149044061 17:52224057-52224079 CTATAGGCAATGAAGAGACATGG - Intergenic
1149045737 17:52243190-52243212 CTATGGGTAATGAAGAGTCACGG - Intergenic
1150271737 17:63871262-63871284 CCATCAGGACTGAAGGGACACGG - Intergenic
1151383109 17:73739070-73739092 TCATCTGTAATGAAGGGATCGGG + Intergenic
1155770478 18:29691907-29691929 CTAACTGTAAACAAGGGAGAGGG + Intergenic
1155987391 18:32244754-32244776 CTGTCTAAAAGGAAGGGACAGGG - Intronic
1157286568 18:46381085-46381107 CTATCTGTAAAATAGGGACAAGG + Intronic
1157963085 18:52178703-52178725 CTATTTGGAAGGAACGGACAAGG - Intergenic
1158351713 18:56571134-56571156 TCATCTGTAATGTAGGAACAAGG + Intergenic
1159192811 18:65070017-65070039 CTATTTGTAATGAAGTAAAAAGG - Intergenic
1160595730 18:79972781-79972803 CTATATGAACTGAAGGGCCATGG + Exonic
1160677217 19:397856-397878 CTGTCTGGAAGGAAGGGGCATGG - Intergenic
1162283899 19:9723455-9723477 GTATCTGTGAAGAAGGGTCATGG - Intergenic
1166728300 19:45042255-45042277 CTCTGAGCAATGAAGGGACAGGG + Intronic
1167188984 19:47969661-47969683 CTACCTGTAAGGCAGGGAGAGGG + Intronic
926981247 2:18572158-18572180 ATATCTGTATTAAAGGAACAAGG + Intronic
928973537 2:37058534-37058556 CCATCTGTAATGAAAGCCCATGG - Exonic
935623938 2:105152913-105152935 CTTTTCGTAATGAAGGCACATGG - Intergenic
937490949 2:122366668-122366690 CTATCTGTAAAGAAAGGGAATGG + Intergenic
939565713 2:143784428-143784450 ATTTCTGTAATGAAGGCAAATGG - Intergenic
941438194 2:165498083-165498105 CTTTCTGTAAGTAAGTGACAGGG + Intronic
943946735 2:194074634-194074656 CTCTCTGCAAAGAAGGGACATGG - Intergenic
945420672 2:209632272-209632294 CTATTTGGAGTGAAGGGCCATGG + Intronic
945436484 2:209824516-209824538 CTACCTCTAATGACTGGACAGGG - Intronic
946785025 2:223234746-223234768 CTATACGTAAAGGAGGGACAAGG - Intergenic
947013196 2:225588991-225589013 CTATCTGAAAGAAAGGGAGAAGG - Intronic
1169895355 20:10500041-10500063 CAATGTCTAATAAAGGGACAGGG - Intronic
1177698016 21:24598728-24598750 CAATGTGCAATGATGGGACAGGG - Intergenic
1183283742 22:36949547-36949569 CTATCAGCCATGAAAGGACACGG - Intergenic
1184324366 22:43771867-43771889 CTATCGGAAGTGAAGGGATATGG - Intronic
950706944 3:14788675-14788697 CTATCTGCAATGAGGGGGCTGGG + Intergenic
955264938 3:57433742-57433764 CTAACTTTAATGAATGAACATGG - Intronic
961993878 3:131220479-131220501 CAATTTGTAATGAATGAACATGG + Intronic
965090200 3:164151618-164151640 CTCTCTGTAATGTGAGGACACGG + Intergenic
966090909 3:176134838-176134860 GTATATGTAAAGAAGGGAGAAGG - Intergenic
968170942 3:196509887-196509909 ATATATGGAATGAAAGGACAAGG - Intronic
969442106 4:7223567-7223589 CTCTCTGAAATGAAGTCACAAGG + Intronic
971327721 4:25657763-25657785 TTAGCAGTAATGTAGGGACAGGG + Intronic
973613475 4:52658499-52658521 CCATCTGTGAAAAAGGGACAAGG - Intronic
974022448 4:56703996-56704018 CTATCTAGAATCAAGTGACAGGG + Intergenic
976405787 4:84659450-84659472 GAATCTGTAATGATGGGGCAGGG + Intergenic
976617823 4:87096112-87096134 CTTTGTGAAATGAAGGGAAAAGG + Intronic
979361142 4:119766065-119766087 CTATCTGGAAGGTAGGGAAAGGG + Intergenic
980502398 4:133673302-133673324 TTATTTGTAATGTAGGGACTGGG + Intergenic
981882947 4:149637447-149637469 ATATATGAATTGAAGGGACATGG - Intergenic
982636715 4:157905872-157905894 CTATCTGGAAAGAAGGGCAAAGG + Intergenic
982778019 4:159461887-159461909 CTATCTGTCATGGAGTAACAAGG + Intergenic
984513349 4:180707134-180707156 CTAACACTAATGAAAGGACATGG - Intergenic
985325844 4:188769225-188769247 ATATCTGTAATGAGGAGAAAAGG + Intergenic
985339127 4:188929874-188929896 AGATCTGTAGGGAAGGGACAAGG - Intergenic
990168614 5:53021969-53021991 CTATATATACTGAAGGGCCAGGG - Intronic
990316209 5:54585515-54585537 CGATCTTGAATGAAGGGACATGG + Intergenic
991098298 5:62762809-62762831 CTATCAGGAATGAAGAGACTGGG - Intergenic
992230739 5:74661052-74661074 CTGTCTGGAATGAAGGGTGAAGG - Intronic
994313211 5:98301030-98301052 CTTTCTGTAATGAATGGTTATGG - Intergenic
995882311 5:116856895-116856917 GTATCTGTAATTCAGAGACATGG - Intergenic
996891505 5:128426694-128426716 CCCTCAGTAATGAAGGGGCATGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
998923697 5:147099281-147099303 TTATCTCTAATGAAGGGACCAGG - Intergenic
1001941010 5:175739354-175739376 GTGTCTGTAATGAAGGGGAAGGG + Intergenic
1002809270 6:611096-611118 CTCTCTGTAAGGAAAGGAGATGG + Intronic
1002809279 6:611166-611188 CTCTCTGTAAGGAAAGGAGATGG + Intronic
1005764058 6:28993241-28993263 CTATTTTTAATAAAGAGACAGGG + Intergenic
1006433193 6:34010866-34010888 CCAACTGAAATGAAGGGACAGGG + Intergenic
1006835401 6:36995855-36995877 CTACCTCTAATAAAGGGGCAGGG + Intergenic
1013819735 6:114140050-114140072 CTATCAGTAATGCACAGACATGG + Intronic
1014246089 6:119070716-119070738 CTATCTCCAAAAAAGGGACATGG + Intronic
1018619727 6:165718483-165718505 CTGTGTGTAGTGAACGGACAAGG + Intronic
1019927167 7:4200903-4200925 CAATCTGTAATGCATGGGCATGG - Intronic
1021710444 7:23410920-23410942 TTATCTGTAAAGTGGGGACATGG + Intronic
1023710534 7:42987824-42987846 CAGTCTGTAATGAAGTGATATGG + Intergenic
1023754473 7:43403300-43403322 CAATTTGTAGTGAAGTGACAGGG + Intronic
1026063393 7:67046871-67046893 CTTTCTCTAGTGAAGGGACAGGG + Intronic
1027815811 7:82969032-82969054 CTATCTGAGATGTTGGGACAGGG + Intronic
1029857888 7:103537256-103537278 CTATGTGGCATGAAGAGACATGG - Intronic
1029863613 7:103602227-103602249 CCATCTGTAAAGCAGGGATATGG - Intronic
1031061653 7:117058457-117058479 TTATTTTTCATGAAGGGACATGG + Intronic
1031658425 7:124388399-124388421 CCATGTGTGATGAAGGGAGAAGG + Intergenic
1032601392 7:133300005-133300027 CTGGCAGTAATGAAGGGAGAAGG + Intronic
1035251063 7:157597411-157597433 CTATTTGCAAGGAAGAGACAGGG - Intronic
1036612987 8:10366012-10366034 CTATCTGTCCTGAAGGAGCAGGG - Intronic
1037441154 8:18917644-18917666 CTAGCTGTAATAAAAGGATATGG - Intronic
1038493190 8:27984251-27984273 CTCTCTGAAATGAAAGGAAAAGG + Intronic
1039348997 8:36740572-36740594 TTATATGTAATGAAGGCAGAAGG - Intergenic
1042547973 8:69967698-69967720 ATATGTGTATTGTAGGGACAGGG + Intergenic
1042991443 8:74644972-74644994 GCATCTAAAATGAAGGGACAGGG - Intronic
1043258174 8:78161280-78161302 CTATTTCTAATGTAGGGACATGG + Intergenic
1043335808 8:79175534-79175556 CTTTCAGTAATGAGGGGTCAGGG - Intergenic
1044011498 8:86999463-86999485 CTATCTGGAATGGATGGGCAAGG - Intronic
1045180661 8:99777898-99777920 CTACATGTAATGAAGGGAAGAGG + Intronic
1050965841 9:11801460-11801482 CAATCGGTAGTGAATGGACAAGG - Intergenic
1052440502 9:28490555-28490577 AAATCTGTAATGAAGGAACCTGG - Intronic
1053025440 9:34725084-34725106 CTTTCTGGAATGCAGGGAAAAGG + Exonic
1053036969 9:34834146-34834168 CTTTCTGGAATGCAGGGAAAAGG + Intergenic
1061009331 9:127945928-127945950 CTCTGTGGAATGAAGGGACCTGG - Intronic
1062406068 9:136397295-136397317 CTATCTTTACTGGAGAGACAGGG + Intronic
1188828232 X:34863546-34863568 ATATCAGAAATGAAGGGCCAAGG + Intergenic
1188843419 X:35043952-35043974 CTATCTTTAATGAATTGTCAGGG + Intergenic
1197495041 X:127169447-127169469 CCATGTATAATGAAGGAACAAGG - Intergenic
1202136509 Y:21670949-21670971 CTGTCTCAAATAAAGGGACAAGG - Intergenic