ID: 1091646744

View in Genome Browser
Species Human (GRCh38)
Location 12:2277969-2277991
Sequence CTCTTAGCACAGACTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091646737_1091646744 23 Left 1091646737 12:2277923-2277945 CCTCCAGTCTCACTCATCGTGCT 0: 1
1: 0
2: 0
3: 9
4: 179
Right 1091646744 12:2277969-2277991 CTCTTAGCACAGACTGAGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 179
1091646738_1091646744 20 Left 1091646738 12:2277926-2277948 CCAGTCTCACTCATCGTGCTGAG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1091646744 12:2277969-2277991 CTCTTAGCACAGACTGAGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091646744 Original CRISPR CTCTTAGCACAGACTGAGGC TGG Intronic
900457264 1:2783372-2783394 CTATCCACACAGACTGAGGCTGG + Intronic
902492153 1:16790650-16790672 CCCTAAACACAGCCTGAGGCTGG + Intronic
903347318 1:22695040-22695062 ATCTGAGCACATACTGAGGCAGG + Intergenic
904571732 1:31471117-31471139 CTCTGTGCACAGACCGAGGAAGG - Intergenic
907256164 1:53180685-53180707 CTCTGAGCTCTGACTGAGGGTGG + Intergenic
907260037 1:53211184-53211206 CTCTTTGTATAGACGGAGGCCGG - Exonic
910436327 1:87209548-87209570 CTGTTAGAACTGACTCAGGCAGG + Intergenic
915565257 1:156709365-156709387 CACAGAGCACAGACTCAGGCAGG + Intergenic
917662374 1:177189933-177189955 CTCTCAGCCAAGACTGAGGAGGG + Intronic
919430066 1:197481462-197481484 CTCTTATCTGAGACTGAGACAGG + Intergenic
921450564 1:215301131-215301153 CACTTAGCCCAGACTGAGTGAGG + Intergenic
923528294 1:234791887-234791909 CCCTAAACACAGCCTGAGGCTGG - Intergenic
924543789 1:245006421-245006443 CTGTAATCACAGGCTGAGGCAGG - Intronic
924547755 1:245046033-245046055 CTTTTAGGCCAGGCTGAGGCAGG - Intronic
1064293257 10:14054388-14054410 CTCTTAGGACAGAGTCATGCAGG - Intronic
1064526460 10:16261135-16261157 GTCTTAGAACACACTGAGTCTGG - Intergenic
1067715898 10:48691077-48691099 CCCTCATCACAGCCTGAGGCAGG + Intronic
1068322436 10:55437254-55437276 CCCTTAGCAGAGAATCAGGCAGG + Intronic
1069556857 10:69404061-69404083 CTATTAGCTCAAACTGAGGGTGG + Intronic
1078507514 11:11963845-11963867 CTCTCAGCACAGCCTGGGGAGGG - Exonic
1083146543 11:60763970-60763992 CTCTCTGCACAACCTGAGGCAGG + Intronic
1083828923 11:65218688-65218710 CTCTTAACACTTCCTGAGGCTGG + Intergenic
1083922960 11:65790265-65790287 ACCTGAGGACAGACTGAGGCTGG + Intronic
1084459010 11:69285934-69285956 CTGCTAGGCCAGACTGAGGCAGG - Intergenic
1085020767 11:73205466-73205488 ATCTGAGCAAAGACTGCGGCTGG - Intergenic
1085048078 11:73364717-73364739 CTCTGACCACAGAGTGACGCTGG + Intronic
1087659540 11:100970737-100970759 CTCTTGGCACTGGCTGAGGGAGG + Intronic
1088044917 11:105438510-105438532 GTCATAGGACAGACTGAGGAGGG + Intergenic
1088988536 11:114930312-114930334 CTCTTAGCCCCCAGTGAGGCAGG + Intergenic
1089113883 11:116078487-116078509 CAATTAGCACAGACCCAGGCTGG - Intergenic
1089562012 11:119348025-119348047 CTCTTAACACACAGTGTGGCAGG - Intergenic
1089739892 11:120575245-120575267 CACTTAGCTCAGTCTGTGGCGGG + Intronic
1090275241 11:125414203-125414225 AGCTGAGCACAGAGTGAGGCAGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091646744 12:2277969-2277991 CTCTTAGCACAGACTGAGGCTGG + Intronic
1091762864 12:3098578-3098600 CTCTAAGCAAAGAACGAGGCTGG - Intronic
1094216033 12:27943757-27943779 CTCTTATCAAAGATTGAGGCTGG + Intergenic
1094477607 12:30853554-30853576 CACTTACCACAGACAGAGGCAGG - Intergenic
1095908586 12:47403141-47403163 CACTGGGCCCAGACTGAGGCTGG - Intergenic
1095962771 12:47845764-47845786 CCACTAGCACAGGCTGAGGCAGG + Intronic
1096558861 12:52421867-52421889 CTCTTACCTCTGACTGGGGCAGG - Intergenic
1096692697 12:53330832-53330854 CTCTTGGCAGAGACTCCGGCTGG + Intronic
1097033244 12:56104653-56104675 CTCTGACCACAGCCTGTGGCTGG + Exonic
1098384709 12:69906761-69906783 CTCCTAGTCCAGACTGTGGCTGG + Intronic
1099084116 12:78223887-78223909 ATCTGAGCACAGTCTGGGGCTGG - Intergenic
1100548876 12:95628226-95628248 CTCTGAGCAGGGAGTGAGGCAGG + Intergenic
1102953687 12:117046261-117046283 CTGTGAGCACTGACTGAGGCCGG + Intronic
1104329756 12:127833748-127833770 CTCCCAGCCCAGCCTGAGGCAGG + Intergenic
1105528922 13:21200681-21200703 CTCTGAGCTGAGACTGAAGCTGG + Intergenic
1106211347 13:27650268-27650290 CTATTATCACACACTGATGCTGG - Intronic
1106389189 13:29318955-29318977 TTCTGAGACCAGACTGAGGCTGG + Intronic
1107129242 13:36877827-36877849 CACTTAGCTAAGACTGAGGTAGG + Intronic
1111790326 13:92847120-92847142 GTTTTAGCACAGACTTAGGTGGG - Intronic
1112562130 13:100524247-100524269 CTCTTCCCACAGACTGGGGCAGG + Intronic
1115063401 14:29223065-29223087 CTCTTAGGACAAACTGATGTTGG - Intergenic
1116951352 14:50881599-50881621 AGCTTCGCACAGACTGAAGCTGG + Exonic
1118023737 14:61746639-61746661 ATCCTAGCACAGGCTGAGGCAGG - Intronic
1118821468 14:69348935-69348957 CTGCTTGCACCGACTGAGGCAGG - Intronic
1119084309 14:71725936-71725958 CTCTGATCACAGTCTGAAGCTGG - Intronic
1119983515 14:79109579-79109601 ATCTTATCACAGACAGAGCCTGG - Intronic
1121665361 14:95667722-95667744 CTCTGGCCACAGAGTGAGGCAGG - Intergenic
1121910646 14:97789381-97789403 TTTTTAGCACAGTCTCAGGCAGG - Intergenic
1125459943 15:39896326-39896348 ATCCCAGCACAGGCTGAGGCAGG - Intronic
1125495084 15:40185778-40185800 ATCCCAGCACAGGCTGAGGCAGG + Intronic
1129154575 15:73709841-73709863 CTCTTTGCCCAGAGTTAGGCAGG + Intronic
1129240938 15:74251762-74251784 CCCTGGTCACAGACTGAGGCTGG + Intronic
1130901286 15:88208505-88208527 CTCATAGGTCAGAATGAGGCGGG + Intronic
1132600003 16:769097-769119 CCCTGAGCACAGACACAGGCAGG + Intergenic
1133785380 16:8969194-8969216 TTCTAAGAACAGAATGAGGCTGG + Intergenic
1134826843 16:17291552-17291574 GCCTTAGAACAGACAGAGGCTGG - Intronic
1136632954 16:31499795-31499817 CTCCAAGGACAGACAGAGGCTGG - Intronic
1138126432 16:54442643-54442665 CTCTCACTACAGACTGAAGCTGG + Intergenic
1141500832 16:84443111-84443133 CTCTGAGCACAGAATGCAGCAGG - Intronic
1141974831 16:87508710-87508732 ATCTTAGCATACACTGAAGCAGG + Intergenic
1142713875 17:1737674-1737696 CTCCTGGCATAGACTGAGGCAGG + Exonic
1143358199 17:6346710-6346732 TTCCTAGCACAGCCTGGGGCAGG + Intergenic
1146005077 17:29155804-29155826 CTCTGAGGAGAGAATGAGGCTGG - Intronic
1146808962 17:35888378-35888400 CTCTTTGCACAGAGTCAGTCAGG - Intergenic
1148000502 17:44384728-44384750 CTCGTAGCGCAGCCTGGGGCAGG - Intronic
1148450359 17:47773712-47773734 CACCCAACACAGACTGAGGCAGG - Intergenic
1149165668 17:53749252-53749274 CTGTGAGATCAGACTGAGGCTGG - Intergenic
1150250727 17:63703070-63703092 TTTTAAGCACAGACTAAGGCTGG - Exonic
1151001567 17:70382626-70382648 GTCTTAGCATAGACTGAGGAGGG - Intergenic
1154322944 18:13369131-13369153 CTTTTACCCCAGGCTGAGGCCGG + Intronic
1155313287 18:24545595-24545617 CTTTTAGTGCAGACTGGGGCGGG + Intergenic
1156666886 18:39419638-39419660 CTCTTAGCCCACTCTCAGGCAGG - Intergenic
1157706909 18:49814422-49814444 TTCTGAGAACAGACTGAGGCCGG + Intronic
1158547059 18:58405544-58405566 CTCATGGGACAGGCTGAGGCGGG + Intergenic
1160224855 18:77004816-77004838 CTCTTAGCAAACTGTGAGGCTGG + Intronic
1161284128 19:3460040-3460062 TTCTCTGCAGAGACTGAGGCCGG + Intronic
1165003838 19:32788232-32788254 CTGTAATCCCAGACTGAGGCAGG - Intronic
1165535427 19:36440296-36440318 CACTTGGCAGAGACTGAGGTAGG + Intergenic
1167467710 19:49658834-49658856 CACTTAGCACAGTCTCTGGCTGG + Intergenic
925874850 2:8302877-8302899 CTCTCAGCACACAGTGAGGCTGG - Intergenic
926021128 2:9496603-9496625 CTCTTAGAGCAGCCTGGGGCAGG - Intronic
927052209 2:19341528-19341550 CACTTAGCAAAGACTGAGTAGGG + Intergenic
929447100 2:42010383-42010405 CTCTTAGCCCAGACTCAGACAGG - Intergenic
929960669 2:46493990-46494012 CTCTTTGCAAACACTGAGCCTGG - Intronic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
931741523 2:65250000-65250022 CTCTTGGCCCAGATTGAGGGAGG + Intronic
931959424 2:67465730-67465752 ATTTTAGCACAGAGAGAGGCAGG + Intergenic
933168606 2:79100141-79100163 CTATCAGCACAGACTGGGGCAGG + Intergenic
933212400 2:79585893-79585915 CTCTTAGCACTCATTCAGGCTGG + Intronic
934774755 2:96929966-96929988 CACTTTTCAGAGACTGAGGCAGG + Intronic
935797078 2:106653387-106653409 CTCTTTGCTACGACTGAGGCTGG - Intergenic
936083126 2:109448774-109448796 ATTTTTCCACAGACTGAGGCAGG - Intronic
938771327 2:134503708-134503730 CACTCAGCACAGGCGGAGGCAGG + Intronic
940534586 2:154924318-154924340 ATTTTACCACAGACTGGGGCGGG + Intergenic
945330329 2:208531776-208531798 CCCTAAGAACAGCCTGAGGCAGG - Intronic
947074649 2:226329326-226329348 TTCTGAGGACAGACTGCGGCAGG - Intergenic
947502717 2:230683261-230683283 CTCTCAGCACAAACACAGGCTGG - Intergenic
947589119 2:231374944-231374966 CTGATAGCACAGCCTGGGGCTGG + Intergenic
947632061 2:231660365-231660387 CTCTCAGGAGAGGCTGAGGCAGG - Intergenic
948284413 2:236772661-236772683 ACTTTAGCAAAGACTGAGGCAGG - Intergenic
948298805 2:236886433-236886455 CTGTTTGCACTGACTGTGGCTGG + Intergenic
948549460 2:238760139-238760161 CTCTGAGCCCAGAGTGATGCTGG + Intergenic
948561373 2:238855866-238855888 CGCCAAGCACACACTGAGGCGGG - Intronic
948855273 2:240727407-240727429 CTCCTTACTCAGACTGAGGCTGG - Intronic
1168832625 20:855030-855052 CTATTAGCAGACACTGAGGTGGG - Intronic
1171481320 20:25457960-25457982 CTCGGAGCACAGACTGTGGAGGG - Intronic
1171488604 20:25501085-25501107 CTCTGAGCACAGGCTGGGGAGGG - Intronic
1172084032 20:32364648-32364670 GTCTCAGCTGAGACTGAGGCAGG - Intronic
1172120537 20:32596140-32596162 CACTTAGCACAGGCTGGGGACGG + Intronic
1172946020 20:38690174-38690196 TTCTTGGCACATCCTGAGGCTGG - Intergenic
1174492841 20:50914251-50914273 CTCTTATCACAGACTAAGTGTGG - Intronic
1181419501 22:22788257-22788279 CATATGGCACAGACTGAGGCTGG + Intronic
1181450103 22:23014092-23014114 CTCTCAGCAGAAACGGAGGCTGG + Intergenic
1181490116 22:23256343-23256365 CTCGTAGTGCAGACAGAGGCTGG + Intronic
1182676658 22:32044129-32044151 CACTTATGACAGACTGTGGCAGG + Intronic
1183096209 22:35553811-35553833 CTTTGAGCACAGACGCAGGCAGG - Exonic
1183425485 22:37736921-37736943 CTAAAAGCACAGACTTAGGCCGG - Intronic
1184122071 22:42458169-42458191 CCCTTCCCACTGACTGAGGCAGG + Intergenic
949459616 3:4276148-4276170 CTCTTATCAGAGAATGATGCTGG - Intronic
952204513 3:31167001-31167023 CTTTTAGCACTGACTGTTGCTGG + Intergenic
953490464 3:43345959-43345981 CTCTTAGGACTGACTGTGTCCGG + Intronic
953931863 3:47009564-47009586 CTTTTTGCACAGTCTGGGGCGGG + Exonic
954911253 3:54112491-54112513 CTCTCAGCATAGACTGAAGTTGG - Intergenic
955395858 3:58556808-58556830 CTCTTAGAAAAGACAGTGGCTGG - Intergenic
956495143 3:69817300-69817322 CTTATAGCACAGACTGACTCTGG - Intronic
961367131 3:126407095-126407117 CTGTGAACACAGCCTGAGGCGGG - Intronic
962400508 3:135055366-135055388 CTCTCAGCACAGACAGGGGCTGG - Intronic
963183593 3:142388058-142388080 GTCTTAGCCCAGTCTGAGGCTGG - Intronic
966892912 3:184420426-184420448 ACCTCAGCAAAGACTGAGGCTGG + Intronic
967456373 3:189691089-189691111 CACTTTGCAAAGGCTGAGGCTGG + Intronic
970511396 4:16785278-16785300 ATCCTAGCAGAGACTGAAGCAGG + Intronic
972254022 4:37334377-37334399 CTCCAAGCACAGGCTGAGGATGG - Intronic
972368033 4:38394194-38394216 CTCTGAGCACAGGCTAATGCAGG - Intergenic
975412610 4:74071417-74071439 ATCTTAGCACACTCTGAGCCAGG + Intergenic
979400987 4:120249184-120249206 CATTTAGCACTGACAGAGGCAGG - Intergenic
980967669 4:139538573-139538595 ATCCTAGCACAGGCTGAGGCGGG - Intronic
982190254 4:152846984-152847006 CTCTTAGGACAGACTAAGAAAGG - Intronic
984404301 4:179307442-179307464 GTCTTCCCACAGATTGAGGCAGG - Intergenic
985865863 5:2513608-2513630 CTCTTTCCACAGACTCAGACAGG - Intergenic
986199887 5:5570843-5570865 CTCCAAGCACCCACTGAGGCAGG - Intergenic
989590252 5:43105940-43105962 CTCTTAGCACTGTATGAGCCAGG - Intronic
994357479 5:98810257-98810279 ATCTTACCAAAGAGTGAGGCTGG - Intergenic
995750814 5:115451707-115451729 CTCTGGGCACAGACTCAGGTGGG + Intergenic
995891269 5:116954778-116954800 CTCTGACCATACACTGAGGCAGG - Intergenic
997617185 5:135255569-135255591 CTCTTGCTACAGACTTAGGCAGG - Intronic
998904681 5:146892150-146892172 CTCTGAGCTCAGACTCAAGCTGG - Intronic
999208602 5:149868337-149868359 CTCTGATCACTGACAGAGGCAGG - Intronic
999601633 5:153272568-153272590 CTTTTTGCACTGACTGAGGCCGG + Intergenic
1001515762 5:172354238-172354260 CTCGAAGCACAGATTGAAGCAGG - Intronic
1001733696 5:173981090-173981112 CTCTTTGCAGACACTGAGCCTGG - Intronic
1003881892 6:10486625-10486647 CTGCTAGCAGAGGCTGAGGCAGG + Intergenic
1004293763 6:14391718-14391740 TTCTCAGCAAAGACTGAAGCAGG + Intergenic
1004607870 6:17210823-17210845 CTCATATCACAGCCTGAGGCAGG - Intergenic
1013634604 6:112017167-112017189 TTATTATCACAGAGTGAGGCTGG + Intergenic
1024574887 7:50755394-50755416 GTCTCAGTACTGACTGAGGCAGG + Intronic
1026735578 7:72946535-72946557 CGCTTAGCACACCCTTAGGCAGG + Intronic
1026841839 7:73673673-73673695 TTCTCAGCACAGTCTGGGGCAGG + Intergenic
1031003975 7:116451397-116451419 GTATTAGCAAAAACTGAGGCTGG - Intronic
1031918053 7:127581583-127581605 CTCTCATCACAGTCTGAGTCTGG - Exonic
1032945668 7:136849492-136849514 CTCTTTGCACATCCTGAGGTTGG + Intergenic
1032948063 7:136874272-136874294 CTATTAGCAAAGAATGAGGTAGG + Intronic
1034441778 7:151089317-151089339 TTCCGAGCACAGTCTGAGGCTGG + Intronic
1036377434 8:8213075-8213097 CTAAAAGCAGAGACTGAGGCAGG + Intergenic
1036719428 8:11159458-11159480 CTGTTAGCAGAAAGTGAGGCGGG - Intronic
1036852120 8:12210073-12210095 CTAAAAGCAGAGACTGAGGCAGG - Intergenic
1036873487 8:12452595-12452617 CTAAAAGCAGAGACTGAGGCAGG - Intergenic
1038978944 8:32735489-32735511 GTTTTATCACAGAATGAGGCTGG + Intronic
1039017399 8:33167153-33167175 CTCTTAGCTCAGACTCAGGAAGG - Intergenic
1044924132 8:97195449-97195471 CTCTGGACACAGAGTGAGGCTGG + Intergenic
1049830496 8:144698715-144698737 CTCTCAGTACAGACTGTGCCAGG - Intergenic
1050200519 9:3140548-3140570 CTGTTAGCATAGTCTGAGGTGGG - Intergenic
1050413213 9:5387633-5387655 CTTTTAGCACTGAGAGAGGCGGG + Intronic
1050594148 9:7189027-7189049 CTGTTAGCTTAGACTGTGGCAGG + Intergenic
1051541039 9:18217735-18217757 ATCTTAGCCGAGACTGATGCTGG + Intergenic
1056766857 9:89449477-89449499 CTCTGACCACAGCCTGTGGCTGG + Intronic
1057437079 9:95050924-95050946 CTCTTAGCAAATTCTGAAGCAGG - Intronic
1057800588 9:98188897-98188919 CACTTAGGACAGAATTAGGCAGG + Intronic
1059282336 9:113145632-113145654 CTCTGGTCACAGTCTGAGGCTGG - Intergenic
1062447277 9:136600229-136600251 CTCTCAGAGCAGACAGAGGCTGG - Intergenic
1187826924 X:23340830-23340852 CTCTTAGAAAAGATTGAGCCTGG + Intronic
1193381572 X:80821928-80821950 ATCACAGCACAGGCTGAGGCTGG - Intergenic
1196741869 X:119032187-119032209 CCCTTGGCACAGCCTGATGCTGG + Intergenic
1197040402 X:121929769-121929791 CTTTTAGCCAAGACTGAAGCTGG - Intergenic
1197406338 X:126056381-126056403 CTAATAGCACAGACTCAGTCAGG - Intergenic
1198800065 X:140439461-140439483 CTCTCGGCTCAGACTCAGGCCGG + Intergenic