ID: 1091647535

View in Genome Browser
Species Human (GRCh38)
Location 12:2285121-2285143
Sequence GTGTTTCTACAGAGGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091647535_1091647540 18 Left 1091647535 12:2285121-2285143 CCTTGCTCCCTCTGTAGAAACAC 0: 1
1: 0
2: 2
3: 16
4: 175
Right 1091647540 12:2285162-2285184 ATCCCTGCGTGTTACCTAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091647535 Original CRISPR GTGTTTCTACAGAGGGAGCA AGG (reversed) Intronic
901130122 1:6957093-6957115 GTGATTCAACAGAGGGATGATGG + Intronic
903337987 1:22637598-22637620 GTGTCTCCACAGAGGCATCATGG + Exonic
905768483 1:40622586-40622608 GTGTTTCTGCAGTGGCTGCAGGG - Exonic
907857462 1:58317865-58317887 ATGTTTATACAGAGGGTGCCAGG - Intronic
910537560 1:88316156-88316178 ATGATTGTACAGAGTGAGCAAGG + Intergenic
910789133 1:91032963-91032985 GTGTTTTTAAAGAGAGAGCATGG + Intergenic
912498923 1:110108960-110108982 GCCTCTCTGCAGAGGGAGCAGGG - Intergenic
912661802 1:111538380-111538402 GTGTTTCTAAACAGTGAGCCTGG - Intronic
916056951 1:161074496-161074518 GTGTTTATTCAGAGGGGGCTGGG - Intronic
917164726 1:172099068-172099090 GTTTTTCTAGGGAGGCAGCATGG + Intronic
918326875 1:183418323-183418345 TTGTGTCTGCAGAGGGAGAAAGG + Exonic
918593255 1:186263314-186263336 GTGGTTCTAAAGAGGGACTAGGG - Intergenic
920445701 1:206014544-206014566 GTGGTTTTACAGAGGGAGTGGGG + Intronic
920770348 1:208878879-208878901 GAATGACTACAGAGGGAGCATGG - Intergenic
920915313 1:210253787-210253809 GCTTTTCTGCAGAGGGGGCAGGG + Intergenic
1063490483 10:6459318-6459340 GGGTTTCTTCAGAGGTAGAATGG - Intronic
1066389066 10:34964304-34964326 GTGTGGCTAAAGAGGGAGCAAGG + Intergenic
1067082280 10:43218491-43218513 GTGCTGCTGCAGAGGGAACAAGG - Intronic
1071405777 10:85329828-85329850 CTGTTTCTTCAGATGGAGCCTGG - Intergenic
1071574973 10:86718579-86718601 GTCTTTCTTCAGAGTGACCAAGG + Intronic
1073942542 10:108714692-108714714 CTGTTGCTTCAGAGGGTGCAAGG - Intergenic
1073963554 10:108962066-108962088 GTGTCTCTACAGTTGTAGCAAGG - Intergenic
1075056565 10:119223103-119223125 GGGTACCTTCAGAGGGAGCACGG - Intronic
1077252299 11:1566058-1566080 GGGTCTCTCCAGAGGGAGAAGGG - Intronic
1077429434 11:2508710-2508732 GAGTTTCTATAGAGGAAGCCAGG - Intronic
1078337158 11:10473644-10473666 GGGTCCCTACAGAGAGAGCAGGG - Intronic
1078959536 11:16248566-16248588 CTGTTGCTTCAGAGGGTGCAAGG - Intronic
1081648716 11:44808484-44808506 GTGTTTCTAGAGTGGGAACATGG + Intronic
1086047963 11:82555154-82555176 GTGTTGCTGCAGAAAGAGCATGG + Intergenic
1088578627 11:111296812-111296834 CTGTTCCTTCAGAGGGGGCAAGG + Intergenic
1089405866 11:118196816-118196838 GTGTTTCTAGAGGGGGAAAATGG + Exonic
1090593643 11:128297230-128297252 GGCTTTCTGCAGAGGGAGGAGGG + Intergenic
1091647535 12:2285121-2285143 GTGTTTCTACAGAGGGAGCAAGG - Intronic
1091816895 12:3445588-3445610 GTGTTACTCCACAGGGATCAGGG + Intronic
1093873809 12:24325620-24325642 CTGTGTCTACAGAGGAAGAAGGG + Intergenic
1098138369 12:67427043-67427065 TTCTTTCTACAGAGAGAGAAGGG - Intergenic
1098633439 12:72752503-72752525 GTGTTTCTACAGAGGTATACAGG + Intergenic
1098790660 12:74817549-74817571 GTGTCTCGACAAAGGGAACACGG - Intergenic
1098910503 12:76203969-76203991 GGGTGTCTCCAGAGGGATCATGG + Intergenic
1100863046 12:98827625-98827647 GTGTTTATACATAGGTAGAAGGG + Intronic
1100877353 12:98975838-98975860 GTGGTTGGGCAGAGGGAGCAGGG + Intronic
1101520740 12:105479762-105479784 TTGTTGTAACAGAGGGAGCAGGG + Intergenic
1102035555 12:109768829-109768851 GCGTGCCTACAGTGGGAGCACGG + Exonic
1103200008 12:119080160-119080182 GTGGTTCTACTCAGGGAGGAAGG + Intronic
1103799256 12:123526722-123526744 GTATTTGCACAGAGGGCGCAAGG + Intronic
1104964276 12:132502020-132502042 CTGTTTGTACAGAGAGTGCATGG + Intronic
1108025279 13:46171009-46171031 GGCTTTCTATAGAGAGAGCATGG - Intronic
1109670650 13:65602407-65602429 GTTTTCCTACAGAGTGAGAATGG + Intergenic
1110328683 13:74246637-74246659 GTGTTTCTGGAGAGGCATCACGG - Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1117497880 14:56323739-56323761 GTTTCTCTAAAGAGGCAGCAGGG - Intergenic
1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG + Intronic
1119617353 14:76107601-76107623 CTTTGTCTACAAAGGGAGCAGGG - Intergenic
1121267880 14:92616068-92616090 GGTTTTCTTCAGAGGCAGCAGGG - Intronic
1122438635 14:101715533-101715555 GTGATACTACAGAGGGAGGCAGG + Intergenic
1122715969 14:103697374-103697396 GTGCTCCTACAGTGGGAGGAAGG - Intergenic
1125130411 15:36278470-36278492 CTCTTCCCACAGAGGGAGCAGGG - Intergenic
1125539309 15:40460598-40460620 GTGTCTCAACAGCCGGAGCATGG - Intronic
1126979547 15:54226806-54226828 GTGTCTGGACAGAGGGATCATGG + Intronic
1128068165 15:64776664-64776686 GGGTTTCTACTGTGGCAGCAGGG - Intergenic
1130614645 15:85393103-85393125 GTGTTTCTGGAGTGGGAGAAGGG + Intronic
1132692495 16:1187865-1187887 ATGTTTCTACAGAGGGACGGAGG - Intronic
1135251818 16:20906828-20906850 GTGTTTCTACAGGAGGACTATGG - Intronic
1135399952 16:22159843-22159865 CAGTGTCTTCAGAGGGAGCATGG - Intergenic
1135507789 16:23053733-23053755 GTGTTTCAAAGGAGGCAGCAAGG - Intergenic
1135827662 16:25743854-25743876 ATGTTGCTACAGAAGGAGCTAGG - Intronic
1136369535 16:29827452-29827474 GTCTTTCTAGAGAGGCATCATGG - Intronic
1138536266 16:57661998-57662020 GGGTGTCTACACATGGAGCAAGG + Intronic
1139799184 16:69507486-69507508 GTGTGTCTGCAGAGGCAACATGG - Intergenic
1140866228 16:79064944-79064966 GTGTTTATAGAGATGGAGCATGG + Intronic
1141165851 16:81660638-81660660 GTGTTTCTAAAGAGGGCACTGGG - Intronic
1141821208 16:86447286-86447308 GGGTTTTTACAGAGGCAACAAGG - Intergenic
1143447528 17:7018212-7018234 GAGTTCCTACAGAGGGAAGATGG - Intergenic
1144296017 17:13875839-13875861 GAGGTTCTTCAGAGGCAGCAAGG + Intergenic
1144464785 17:15488615-15488637 GAGTTTCTACAGGTGGAGGAGGG - Intronic
1145284429 17:21494849-21494871 GTGTTCCTAAAGAGGGAGGCAGG - Intergenic
1146127858 17:30243075-30243097 GTTTTTCAACAAAGGAAGCATGG + Intergenic
1148053165 17:44779205-44779227 ATGTTTCTGCAGGGGGAGGATGG - Exonic
1150375314 17:64676581-64676603 GTGTTTGTACTAAGGGAGCTTGG - Intergenic
1152205946 17:78974469-78974491 GTGTTTCTCCAGAAGGGGCTGGG + Intronic
1152850205 17:82629394-82629416 GAGGTTCCACAGAGAGAGCAGGG - Intronic
1155879904 18:31132276-31132298 CAGTTCCTTCAGAGGGAGCACGG + Intronic
1158674992 18:59510253-59510275 GAGTTCTGACAGAGGGAGCAGGG + Intronic
1160265749 18:77339781-77339803 GTGTCTCTCCTGAGGGAGCCTGG + Intergenic
1160514728 18:79472064-79472086 GTGTTGGTACAGAGGGAGCCGGG + Intronic
1161708300 19:5832735-5832757 GTGTTTGAACAAAGGGAGCTTGG + Intronic
1168431310 19:56283198-56283220 GTGTGTGTGCAGTGGGAGCAGGG - Intronic
925121983 2:1426664-1426686 CTGTCTTTACAGAAGGAGCATGG - Intronic
928023180 2:27719931-27719953 TTGTCACTGCAGAGGGAGCAAGG - Intergenic
928247074 2:29639803-29639825 GTGTCTTTACATAGGGAACAGGG + Intronic
931079434 2:58752811-58752833 CTGTTGCTTCAGAGGGTGCAAGG + Intergenic
931171346 2:59806956-59806978 GTGTTTCTAGAGAGAGACAATGG - Intergenic
931892806 2:66693673-66693695 GTGTCTCCACAGAGAAAGCAAGG + Intergenic
933076606 2:77935810-77935832 GTGTTTCAGAAGAGGGAGGATGG + Intergenic
934688901 2:96342329-96342351 GTGTATCTAGAAAGGCAGCATGG + Intronic
937956336 2:127423498-127423520 GGGTTTCTAGGGAGGGAGCGAGG + Intronic
938049501 2:128155102-128155124 CTGTTCCTACAGAGGAAGCAGGG - Intronic
939145577 2:138410733-138410755 GTGTATCCAAAGAGTGAGCAAGG - Intergenic
939603263 2:144220367-144220389 AAGTTTCTGCAGAGGAAGCACGG + Intronic
941408310 2:165120041-165120063 GTGGGTCTACAGAGGGATGATGG + Intronic
943129546 2:183839151-183839173 GGGTTTCTAGAGAGGGATCATGG + Intergenic
945562991 2:211361295-211361317 GTGATTCTTCAGAGGGCGAAGGG + Intergenic
947021844 2:225686771-225686793 GTGTTTCCACACAGTGGGCAAGG - Intergenic
1168850775 20:975433-975455 GTGTTTTGACTGAGGGAGGATGG - Intronic
1171235456 20:23520779-23520801 GTGTATCTTCAGAGGCAGCAGGG + Intergenic
1175615808 20:60397393-60397415 GTGTTTCCAGACAGGGAGAAGGG + Intergenic
1175787928 20:61723761-61723783 GTGTGTTTACAGAGGGATCTGGG + Intronic
1176276851 20:64277507-64277529 GGGTTTCTGCAGACGGATCAAGG - Intronic
1177414728 21:20779073-20779095 TTGTTGCTACAGAGGGCCCATGG - Intergenic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1178663397 21:34525112-34525134 GTGTCTCTGCAGTGGGAGCGAGG + Intronic
1179163566 21:38917577-38917599 TGGCTTCTACAGAGGGAGAAGGG + Intergenic
1179959150 21:44758583-44758605 GTGTCTCTGCAGGGGGAGCTGGG - Intergenic
1182078207 22:27509578-27509600 GTGTTTCTCCAGGTGGAGAAGGG - Intergenic
1184397022 22:44248380-44248402 GTGTGTCTACACTGGCAGCATGG + Exonic
954157652 3:48695488-48695510 GTCTTTCTGCTGAAGGAGCAGGG - Intronic
954628415 3:52035410-52035432 ATGTTCCCACAGAGGGAGCGAGG - Intergenic
954975728 3:54692429-54692451 CTGTGCCTGCAGAGGGAGCAGGG + Intronic
956239133 3:67109394-67109416 GTGTTTCTGCAGAAGCAACAAGG + Intergenic
956252938 3:67253682-67253704 CTGTTGCTTCAGAGGGTGCAAGG + Intergenic
957651878 3:83017951-83017973 GGTTTTCTACAGAGAGAACAAGG - Intergenic
965468651 3:169063320-169063342 GTGGTGCTGCAGAGGAAGCATGG - Intergenic
967354313 3:188550950-188550972 TTGTTTCTACAGAAGGAGTTTGG + Intronic
967920516 3:194610702-194610724 GTGTTTCATCAGAGGGGACAGGG + Intronic
971675241 4:29618294-29618316 GAGTTTCTAAAGAGTGAGAATGG - Intergenic
975366058 4:73529152-73529174 GTGTTTCAACAAATAGAGCATGG - Intergenic
975726226 4:77294316-77294338 GAGTTTCTACTGAGGAAGAAGGG - Intronic
980501115 4:133655629-133655651 GTTTTTCTACAGATGGGGCATGG + Intergenic
981429275 4:144641587-144641609 GTGATTCCACAGAGGAAGGACGG - Intergenic
984040649 4:174728854-174728876 GTGTTGGGACAGAGGGAGGATGG + Intronic
984705044 4:182841460-182841482 TTGCTCCTCCAGAGGGAGCAGGG + Intergenic
985076233 4:186217996-186218018 AAGTTGCTACAGAGGCAGCATGG - Intronic
988323967 5:29737970-29737992 GTGTTGGTACAGAGGGGGCTGGG - Intergenic
989767076 5:45100046-45100068 GTCTTTCCACAAAGGGAACATGG + Intergenic
990401338 5:55440523-55440545 ATGTTTCTGCAGATGCAGCATGG - Intronic
990948538 5:61274304-61274326 GTGATTCCACAAAGGCAGCAAGG - Intergenic
995383050 5:111556508-111556530 GTCTTTCGACAAAGGGAGCTGGG - Intergenic
995667751 5:114563038-114563060 GTTTTTCTACAAAAGGAGGATGG - Intergenic
995994169 5:118279660-118279682 GTGTCTCTACTGAGAGAGCAGGG + Intergenic
998421277 5:141989090-141989112 GTGTGTGTCCAGAGTGAGCAAGG + Exonic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001868320 5:175125538-175125560 GTGTTTCCAGAGAGGAAGCAGGG + Intergenic
1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG + Intronic
1010943600 6:81948940-81948962 GTGTTTCTATTGAGGGAGTCAGG - Intergenic
1015949496 6:138537445-138537467 GTATTTCTACATAGTGAGAAAGG - Intronic
1016441826 6:144092328-144092350 TTGTTTTTACTGAGGGTGCATGG - Intergenic
1019105925 6:169666817-169666839 GTGTTTCTACAGAGAGCAGAAGG + Intronic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1020646880 7:10825299-10825321 TAGTTTGTACAGAGAGAGCAAGG - Intergenic
1023935703 7:44738299-44738321 GTGTTTATACAGATGGAACTGGG - Intergenic
1024734783 7:52293540-52293562 GTATTTCTACAGAAGTAGCCTGG + Intergenic
1025275539 7:57579035-57579057 GTGTTTCTATAGATGGAGAGGGG - Intergenic
1029264152 7:99325439-99325461 GGCTTTCCACAGAGGGAGCACGG + Intergenic
1032777685 7:135131032-135131054 GTGTGTGTCCAGAGTGAGCAAGG + Intronic
1033261861 7:139850888-139850910 TCGTGTCTTCAGAGGGAGCATGG + Intronic
1033351204 7:140563585-140563607 GCCTTTCTACAGAGGGAGCAAGG + Intronic
1034241958 7:149617606-149617628 GGGTCTCTACAGAGGGAGTGAGG + Intergenic
1034535222 7:151721841-151721863 GTGTTTGTACAGAGTCACCATGG - Intronic
1036196815 8:6724968-6724990 GTTTTTCTACAGATGGCACATGG + Intronic
1038525674 8:28271077-28271099 TTGTCTCTAGAGAGGGAGGAAGG - Intergenic
1039316896 8:36383601-36383623 ATGTCTCTACATAGGAAGCATGG + Intergenic
1040075034 8:43220549-43220571 CTGTTTCCACAGAGTGGGCAGGG - Intergenic
1041389509 8:57336379-57336401 GTGTTTCTTCAGAGGGAACTGGG - Intergenic
1042931153 8:74015355-74015377 TAGCTCCTACAGAGGGAGCATGG - Intronic
1045364627 8:101464316-101464338 GTTTTTCAACAGACGGTGCAGGG + Intergenic
1045842742 8:106598504-106598526 TTGCTTCCACAGAGGAAGCAGGG - Intronic
1047433667 8:124816244-124816266 ATGTTTCTCAAAAGGGAGCATGG + Intergenic
1047483579 8:125308008-125308030 CTGTTTCCACAGGGGAAGCAGGG - Intronic
1047691150 8:127355974-127355996 GGTTTTGTACAGAGTGAGCATGG - Intergenic
1048923007 8:139247578-139247600 GTGTCTGTACAGAGGGAGAAAGG + Intergenic
1049632683 8:143667074-143667096 GTGTTTGCACAGAGGGAGGGAGG - Intergenic
1050569403 9:6921828-6921850 GTGTTGGTACAGAGTGGGCAAGG - Intronic
1052648368 9:31268402-31268424 GTTTTTTTCCAGAGAGAGCAGGG + Intergenic
1056480213 9:86995774-86995796 TTATTTATACAGAGGGAGGAGGG - Intergenic
1057854761 9:98593825-98593847 GAGTCGCTGCAGAGGGAGCATGG - Intronic
1058982894 9:110186637-110186659 GGGTTTCAAGAGAGTGAGCAGGG + Intergenic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1060786838 9:126457738-126457760 GTCGTTCTACTGAGGGAGAACGG + Intronic
1061794846 9:133080428-133080450 GTGGTCCTTCAGAGGGAGAAGGG - Intronic
1062558376 9:137127588-137127610 GTCCTGCTACAGAGGTAGCATGG - Intergenic
1185743521 X:2553180-2553202 GTGTTTCCATGGAGGGTGCATGG - Intergenic
1187340845 X:18420198-18420220 GTGATTCAAGAGAGAGAGCAAGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1189125146 X:38437844-38437866 GTTTTTATACAATGGGAGCATGG + Intronic
1189257075 X:39648636-39648658 GAGTGTCTTCAGAGGGAGCCAGG - Intergenic
1189331127 X:40145717-40145739 GGGTTTCTGCAGAGGGGGCCTGG - Intronic
1190775095 X:53546289-53546311 GTGTTACGACAGAGGGAGCATGG + Intronic
1191673357 X:63769726-63769748 CTGTTGCTTCAGAGGGTGCAAGG + Intronic
1192993544 X:76488145-76488167 TTGAGTCTACAGAGGCAGCATGG + Intergenic
1193812231 X:86065627-86065649 GTATGGCTACAGAGGAAGCAGGG - Intergenic
1194663490 X:96652057-96652079 GAGTTTCTAGACAGTGAGCAAGG - Intergenic
1198227332 X:134657511-134657533 CTGTTACTACAGAGGCAGCAGGG - Intronic
1199353420 X:146831991-146832013 GTGTCTCAACAAAGGGAACATGG - Intergenic
1201939628 Y:19445982-19446004 ATGTTTCTACACAGGGAGATGGG - Intergenic