ID: 1091649510

View in Genome Browser
Species Human (GRCh38)
Location 12:2299407-2299429
Sequence AGCAGGAAATGGTACACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091649510_1091649517 19 Left 1091649510 12:2299407-2299429 CCAGCTGTGTACCATTTCCTGCT 0: 1
1: 0
2: 2
3: 21
4: 250
Right 1091649517 12:2299449-2299471 GTTTGCCAGAGAGCTCTCATCGG 0: 1
1: 0
2: 0
3: 4
4: 90
1091649510_1091649519 27 Left 1091649510 12:2299407-2299429 CCAGCTGTGTACCATTTCCTGCT 0: 1
1: 0
2: 2
3: 21
4: 250
Right 1091649519 12:2299457-2299479 GAGAGCTCTCATCGGATGCTTGG 0: 1
1: 0
2: 0
3: 3
4: 64
1091649510_1091649514 -8 Left 1091649510 12:2299407-2299429 CCAGCTGTGTACCATTTCCTGCT 0: 1
1: 0
2: 2
3: 21
4: 250
Right 1091649514 12:2299422-2299444 TTCCTGCTTGGTGGATGCTCAGG 0: 1
1: 0
2: 1
3: 20
4: 180
1091649510_1091649515 -7 Left 1091649510 12:2299407-2299429 CCAGCTGTGTACCATTTCCTGCT 0: 1
1: 0
2: 2
3: 21
4: 250
Right 1091649515 12:2299423-2299445 TCCTGCTTGGTGGATGCTCAGGG 0: 1
1: 0
2: 0
3: 12
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091649510 Original CRISPR AGCAGGAAATGGTACACAGC TGG (reversed) Intronic
900859828 1:5220427-5220449 AGCAGGCATTGGTTCACATCTGG - Intergenic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
901530504 1:9849665-9849687 CTCAGGAAGTGGTACACAGAAGG + Exonic
902136278 1:14308839-14308861 ACCAGGAAATCATACACAACAGG - Intergenic
902628638 1:17691444-17691466 AGCAGGAAATGGTCTCCTGCCGG + Intronic
903363721 1:22793250-22793272 CCTAGGAACTGGTACACAGCAGG - Intronic
903464873 1:23545138-23545160 ACCACCAAATGGGACACAGCTGG - Intergenic
905218283 1:36425863-36425885 AGCAGGACATGCTACATAGCAGG + Intronic
909395373 1:75165872-75165894 AGCATGGAATGGGAGACAGCTGG + Intergenic
909686788 1:78357970-78357992 AGGAGAAAATGGTACCCAGTGGG + Intronic
910249731 1:85184198-85184220 AACAGTAACTGGTACATAGCAGG + Intronic
910449223 1:87329446-87329468 AGCAGGAACCGCTACAAAGCTGG - Intronic
912995060 1:114524696-114524718 AGCTGTAAATAGTTCACAGCTGG - Intergenic
916104018 1:161417674-161417696 AACAGCAAATTGGACACAGCAGG + Intergenic
917653903 1:177106878-177106900 AGCAGGAAATCATATACAGAAGG + Intronic
919064077 1:192670864-192670886 AGTAGGAAATGTTACACATATGG + Intergenic
920726000 1:208435805-208435827 AGCAGGCAGTGGGACCCAGCAGG + Intergenic
924303910 1:242667328-242667350 AGAAGGAAATGGTATGAAGCAGG - Intergenic
924352644 1:243132753-243132775 GGAAGAGAATGGTACACAGCAGG + Intronic
924558987 1:245142190-245142212 AGCAGGACCTAGTGCACAGCAGG + Intergenic
1062955793 10:1539524-1539546 AACAGGAAATGAAACACAACTGG + Intronic
1063503974 10:6580056-6580078 AGTAGGAAATGGAACCAAGCGGG - Intronic
1063932794 10:11046104-11046126 AGCAGCAAATAGAACAGAGCTGG - Intronic
1065664529 10:28043382-28043404 GGCAGGAAATGGCAGCCAGCTGG + Intergenic
1067035606 10:42914133-42914155 AGAAGGAAATTGAACACAGAAGG + Intergenic
1067234775 10:44438287-44438309 AGCATGAAAGGCCACACAGCAGG - Intergenic
1069782544 10:70965858-70965880 AACAGGGCCTGGTACACAGCAGG - Intergenic
1070263727 10:74882176-74882198 AGCAGGGAAGGGGAGACAGCAGG - Intronic
1071611734 10:87038282-87038304 AGCAGCAAAGGGAACACAGCTGG + Intergenic
1072189904 10:93070591-93070613 AGAAGGAAGGGGGACACAGCAGG + Intergenic
1072505855 10:96065874-96065896 AGAAGGAAATGGTGCAGACCTGG + Intergenic
1072934507 10:99699465-99699487 AGCAGAAAATGATAGAAAGCTGG - Intronic
1073625281 10:105090409-105090431 AGCTGAACAAGGTACACAGCGGG - Intronic
1073753641 10:106558040-106558062 TCCAGCAAATGGTACACATCAGG + Intergenic
1075545552 10:123351939-123351961 AGCGGGAGGTGGCACACAGCGGG - Intergenic
1075638111 10:124044216-124044238 AGCAGGGAATAGCACAGAGCTGG + Intronic
1076338785 10:129728565-129728587 AGCAGCACATGCCACACAGCGGG - Intronic
1076344016 10:129768365-129768387 AGCAGGATAAGTCACACAGCGGG + Intergenic
1076618465 10:131771889-131771911 GGCTGGAAATGGTGCCCAGCAGG + Intergenic
1077483609 11:2828089-2828111 AGCAGGGAAGGGGCCACAGCCGG + Intronic
1081669519 11:44935215-44935237 GGCAGGAACTGGGGCACAGCAGG + Intronic
1084043263 11:66554957-66554979 AGCAGGAGATGGTCCAGATCTGG + Intronic
1084749484 11:71194776-71194798 AGCAGGGACTGGTGGACAGCAGG + Intronic
1086584152 11:88432607-88432629 AATAGGGCATGGTACACAGCTGG - Intergenic
1089343177 11:117773303-117773325 AGCAGGAGCTGGAACACAGAAGG - Intronic
1090032524 11:123219481-123219503 AGAAGGAAATGGGTCACACCAGG - Intergenic
1090436083 11:126687420-126687442 AGCAGGAAATCTCACCCAGCTGG + Intronic
1091179392 11:133589744-133589766 GACGGGAAATGGTACACAGTAGG - Intergenic
1091649510 12:2299407-2299429 AGCAGGAAATGGTACACAGCTGG - Intronic
1094093728 12:26679450-26679472 AGCAGGAAATGGGACCCTGCAGG + Intronic
1095221592 12:39622482-39622504 GGCAGAACATGGTACACAGAAGG + Intergenic
1096994892 12:55832284-55832306 AGCAGCAAAGGGCACACACCAGG - Intergenic
1098071366 12:66679183-66679205 AGCACCAAATTGTACAAAGCAGG + Intronic
1100713388 12:97280839-97280861 AATAGCAAAAGGTACACAGCAGG - Intergenic
1102527825 12:113524563-113524585 AGCAGGACATGGGACATAGTGGG + Intergenic
1102585081 12:113917129-113917151 AGGAGGATGTGGTACACAGTGGG + Intronic
1103105437 12:118220300-118220322 AACAGTACCTGGTACACAGCAGG + Intronic
1104239562 12:126974839-126974861 AGCGGGAAATGGAAGAGAGCTGG + Intergenic
1106304259 13:28495614-28495636 AGCAGGCAAGGGGAGACAGCCGG - Intergenic
1106455636 13:29924366-29924388 AGCAGGACAGGGTGCCCAGCAGG - Intergenic
1107410233 13:40151504-40151526 AGCTGGGAATGGTCCACAGATGG - Intergenic
1108338461 13:49471720-49471742 AACAGAAAATGTAACACAGCAGG + Intronic
1109561116 13:64051995-64052017 AGGAGGAAATATTACAAAGCTGG + Intergenic
1110058949 13:71016383-71016405 AGGAAGAAATGGTTAACAGCTGG + Intergenic
1110374780 13:74780652-74780674 GGCAGGAAATGTCACACAGTCGG + Intergenic
1110472059 13:75871411-75871433 ATCAGTAACTGGCACACAGCAGG - Intronic
1111093829 13:83483284-83483306 TGCATGAATTGGTACACAGGAGG + Intergenic
1112297082 13:98197592-98197614 AGCAGAAAATGGTAGAGGGCAGG + Intronic
1112504348 13:99966855-99966877 AGCAAGAAAAGGAAGACAGCAGG + Intronic
1112979161 13:105359924-105359946 CGCAGGACATGACACACAGCAGG + Intergenic
1113050620 13:106207526-106207548 AGCAGGAAATAGTTCACCACTGG + Intergenic
1113424182 13:110194305-110194327 AGGCAGAAATGGTACACAGTGGG + Intronic
1114208486 14:20595909-20595931 AGAAGGAAAGGATGCACAGCTGG + Intronic
1115162937 14:30416214-30416236 AGCATGAAATTGTACAGAGAGGG - Intergenic
1116826442 14:49677550-49677572 AGTAGGAGATGGTGCACTGCTGG - Intronic
1116898784 14:50341873-50341895 AGCAAGAAATGGTAGAAATCAGG + Intronic
1118191123 14:63581248-63581270 AGCAGGAAGTGGAACACAGATGG - Intergenic
1118880284 14:69819857-69819879 AGCAGCAACTGGAAGACAGCTGG - Intergenic
1119651984 14:76390538-76390560 AGCAGAAACTAGTACACAGTAGG + Intronic
1119804579 14:77474652-77474674 AGCATGACATGGGACACTGCTGG + Exonic
1119890027 14:78175512-78175534 AGCAGGAACCGGACCACAGCAGG - Intergenic
1119890031 14:78175529-78175551 AGCAGGAACCGGACCACAGCAGG - Intergenic
1122188927 14:100024514-100024536 AGCAGTGATTGGCACACAGCAGG - Intronic
1122673701 14:103392276-103392298 AGCAGGAAATCCTAAAGAGCAGG - Intronic
1124379773 15:29155671-29155693 TGCTGGAAAGGGAACACAGCAGG - Intronic
1124699075 15:31895399-31895421 CACAGGACATGGCACACAGCAGG - Intergenic
1125466223 15:39955724-39955746 TGTAGGAAATGGTAAACATCGGG + Exonic
1126133433 15:45367043-45367065 AGAAAAAAATGGTACACACCAGG + Intronic
1128568455 15:68716449-68716471 CGCAGGGTCTGGTACACAGCTGG - Intronic
1128726028 15:69989213-69989235 AGCAGGGAATGCTCCCCAGCAGG + Intergenic
1130956103 15:88628531-88628553 AGGAGGAGTTGGTACACAGCAGG + Intronic
1131069283 15:89455112-89455134 TGGAGGAAACGCTACACAGCAGG - Intergenic
1131614944 15:94006257-94006279 AGCATGGAATGGGACCCAGCGGG - Intergenic
1132307314 15:100825822-100825844 AGGAGGGAAAGGTTCACAGCAGG + Intergenic
1132478701 16:154802-154824 ATCAGGAAATAGTACACATTCGG - Intronic
1132993724 16:2811803-2811825 AGCTGGAGATGGCCCACAGCAGG + Intergenic
1133327917 16:4953348-4953370 AGGAGAGAATGGAACACAGCGGG - Intronic
1133517991 16:6528492-6528514 AGGAGCAAATGGTGAACAGCTGG + Intronic
1134193486 16:12140374-12140396 GGCAGGAAAAGTAACACAGCTGG - Intronic
1134807938 16:17141479-17141501 AGCAGTACCTGGCACACAGCAGG - Intronic
1135907110 16:26522552-26522574 GGCAGGGATTGGTGCACAGCTGG - Intergenic
1136476207 16:30515261-30515283 AGCAGGCAGTGGGACAAAGCAGG - Intronic
1137644278 16:50060556-50060578 AGCAGGAAATGGAGGACAGTAGG + Intergenic
1138647933 16:58438789-58438811 TGCAGGGACTGGTAAACAGCAGG - Intergenic
1140132652 16:72177368-72177390 AGGGGGAAAGGGTACACACCTGG - Intergenic
1140899334 16:79353584-79353606 AGCAGGACATGATATACAACAGG - Intergenic
1141735274 16:85847987-85848009 AGCAGGAAATGGCAGGAAGCAGG + Intergenic
1143896515 17:10140942-10140964 AGCAGGGAGTGGGACACAGAGGG + Intronic
1148761143 17:50001254-50001276 AGCTGGAAGCGGTTCACAGCTGG + Intergenic
1149455375 17:56783709-56783731 AGCAGTACAAGGTACACAGTAGG + Intergenic
1150170282 17:62986985-62987007 TGCAGGGAATGGTGCACTGCCGG + Intergenic
1151439421 17:74118632-74118654 AGCAGCAAATGGCAGACAGGGGG + Intergenic
1151652824 17:75480747-75480769 ACCAGGCAACTGTACACAGCTGG - Intronic
1155944185 18:31829015-31829037 ACCAGCAAATGCTACACACCAGG - Intergenic
1156095782 18:33530509-33530531 AGCAGGGAATGGTATAAAGAGGG + Intergenic
1158924906 18:62245978-62246000 AGCAGCAAATTGTACATACCTGG + Intronic
1158951384 18:62498649-62498671 AGGAGGAAATAGGACATAGCAGG - Intergenic
1161465882 19:4430066-4430088 AGGAGGAAATGGTGTGCAGCAGG - Intronic
1161482018 19:4515879-4515901 AGCAGGAGAGGGTAAAAAGCTGG - Intronic
1163351782 19:16781137-16781159 AACAGGACCTGGTACTCAGCAGG - Intronic
1163538398 19:17891862-17891884 AGCAGGACTGGGTACACAGCAGG - Intronic
1165481208 19:36065603-36065625 TGCAGGAAATGGTACAGGCCTGG - Intronic
1166137865 19:40788092-40788114 AGCAGGGCCTGGCACACAGCAGG - Intronic
1166798686 19:45443297-45443319 GGCAGTAACTGGGACACAGCCGG + Intronic
1167791418 19:51685114-51685136 AACAGGAACTGGTAGACAGGAGG - Intergenic
1168281252 19:55306542-55306564 AGGAGGAAATGGTGTTCAGCTGG + Intronic
927205823 2:20609691-20609713 AGCTGGAAATCGTACAGAGGAGG + Intronic
928277324 2:29914887-29914909 AGCACAAAATGGTATACACCTGG - Intronic
928364526 2:30691076-30691098 GGCAGCACATTGTACACAGCTGG + Intergenic
928828330 2:35447206-35447228 AGCTGAAAATGGATCACAGCTGG - Intergenic
930158346 2:48128062-48128084 AGAAGGAAGGGGTACCCAGCAGG + Intergenic
932737339 2:74263665-74263687 AGCAGAAAATGGAACACATCAGG - Intronic
933457759 2:82538468-82538490 AACAGGACATGGGACAAAGCAGG + Intergenic
934553993 2:95277933-95277955 TGCAGGACATGGTCCACAGAGGG - Exonic
937825485 2:126364456-126364478 AGCAGGAAATGGTACAGAGGAGG - Intergenic
938971567 2:136437788-136437810 AGCTGGAAAGAGCACACAGCTGG - Intergenic
940567688 2:155388817-155388839 AGCAGGACACGGGACAGAGCTGG + Intergenic
941191499 2:162389473-162389495 AGCAGGAAAAGGTATAGAGAAGG + Intronic
941245210 2:163087534-163087556 AGAAGGAAATGCTACAGAGGTGG - Intergenic
941476422 2:165956162-165956184 AGCAGGACGGGGTACACAGCAGG - Intergenic
941476426 2:165956179-165956201 AGCAGGATGGGGTATACAGCAGG - Intergenic
944136629 2:196406655-196406677 AGGTGGAAATGGGACACAGTGGG - Intronic
945684333 2:212951309-212951331 AGCAGTACCTGGTACACAGCAGG - Intergenic
945748818 2:213753606-213753628 AGCAGGAAACTGTAAACAGGTGG + Intronic
946320868 2:218953729-218953751 AGCAGGACATGGCACGCAGCTGG - Intergenic
947182544 2:227424538-227424560 ATCAGCAAATGCTACAAAGCAGG + Intergenic
947945350 2:234097108-234097130 AGCAGGAAAATGTACCCAGCAGG - Intergenic
1173248275 20:41350799-41350821 AGCAAGAAATGGAAGACGGCCGG + Intronic
1174509784 20:51042363-51042385 ATCAGGAAATGCTCCACGGCAGG - Intergenic
1178774834 21:35539929-35539951 GGCTGGAAATGCCACACAGCAGG - Intronic
1179160855 21:38897117-38897139 AAAATGAAATGCTACACAGCCGG + Intergenic
1179991347 21:44949654-44949676 AGCAGCAGGTCGTACACAGCCGG - Intronic
1180599618 22:17007657-17007679 GGCGGGAAAGGGGACACAGCAGG - Intronic
1182907263 22:33949109-33949131 GGCAGGAAATGATGCAGAGCAGG + Intergenic
1183781255 22:40000357-40000379 AGGAGGATATGGTGAACAGCTGG + Intronic
1184189432 22:42885138-42885160 GGCAGGAAATGTTAAAAAGCAGG + Intronic
1184861338 22:47174732-47174754 AGCGGGAACTGGTCCACGGCGGG - Exonic
1185084858 22:48735328-48735350 AGCAGGAGGTGGATCACAGCTGG + Intronic
950433595 3:12965932-12965954 AGCAGGGACTGGTACATAGCAGG + Intronic
950953716 3:17028855-17028877 AGCAGAACCTGGCACACAGCAGG + Intronic
952651039 3:35726932-35726954 AGCATCAAATTATACACAGCAGG + Intronic
953455003 3:43034044-43034066 AGCAGCAAATGCTACAAATCAGG + Intronic
954597693 3:51840846-51840868 AGCAGGAAATGTTCTGCAGCAGG + Intergenic
955010149 3:55006004-55006026 AGCAAGAAATGATTCAGAGCTGG + Intronic
955158713 3:56443605-56443627 ATCGGGAAATGAAACACAGCTGG - Intronic
958052489 3:88366126-88366148 AGGAGCAAATGCTACAGAGCAGG - Intergenic
958659116 3:97042689-97042711 AGCAGGCAAGGTTACTCAGCAGG + Intronic
958861589 3:99451148-99451170 ACCAGCAAATGGAACAAAGCTGG + Intergenic
960002330 3:112745960-112745982 AACAGTGAGTGGTACACAGCTGG - Intronic
960966823 3:123111284-123111306 AGCAGGAAATGGGACATGGTGGG - Intronic
961825949 3:129599168-129599190 ACCAGGACATGGAACCCAGCTGG + Intronic
964499175 3:157329742-157329764 AGCAGTAAATTGGAAACAGCTGG + Intronic
964588964 3:158339878-158339900 AGCAGGAAATTGTAATCATCAGG + Intronic
966301664 3:178485868-178485890 AGCTGGCAATGTTACACAGGGGG - Intronic
966342890 3:178945215-178945237 AGAAGGAAATGCAACACAGGTGG - Intergenic
967156369 3:186696217-186696239 TGCAGGAAATGCTGCACAGAGGG - Intergenic
967753481 3:193141551-193141573 AGAAGGAAATGATAGACACCGGG + Intergenic
971766030 4:30833239-30833261 AGCAGGAAATGGGTCTCAGTGGG + Intronic
976287371 4:83383779-83383801 AGCAAGAAATGATACAGAGAAGG - Intergenic
977267990 4:94879154-94879176 TGCTGGAAATGGTACTCATCTGG - Intronic
977710030 4:100114183-100114205 AGAAAGAAATGCTACACAGAGGG + Intergenic
977978438 4:103294604-103294626 TGGAGGAAATGGTATTCAGCGGG - Intergenic
979314408 4:119244534-119244556 AGCAGGGTATGGTACTCAACTGG - Intronic
982678977 4:158407553-158407575 AGCAGGCAATGGCACTCAGAAGG - Intronic
983208431 4:164934148-164934170 ATCAGGAAATGGTAAATAACTGG - Intergenic
983247144 4:165300433-165300455 ACCATCAAATGGTATACAGCAGG - Intronic
987846923 5:23298972-23298994 AGGACAAAATGGTACACTGCTGG - Intergenic
991527483 5:67577445-67577467 AATTGGAAATGGCACACAGCAGG + Intergenic
993955650 5:94229107-94229129 AGCAGGAAATCTAACACAGGAGG - Intronic
995653379 5:114396897-114396919 AGAAGGAAATGATAGACACCAGG - Intronic
996153838 5:120073904-120073926 AGGAGAAAAGTGTACACAGCTGG - Intergenic
998962741 5:147506124-147506146 ATCAACAAATGGTACAAAGCTGG + Intronic
1000383680 5:160652149-160652171 AGCAGGAAAGGAGACACAGCAGG - Intronic
1001297124 5:170505889-170505911 AGCAGGACATGTAACTCAGCTGG - Intronic
1001913169 5:175537718-175537740 CACAGGAAATTGTACCCAGCAGG - Intergenic
1003860595 6:10319019-10319041 AGGAGGAAAATGTCCACAGCTGG + Intergenic
1004020103 6:11769430-11769452 GGCAGGAAATGATACAGAGGTGG + Intronic
1006981215 6:38149788-38149810 AGCAGGAAATGGATTACTGCTGG - Intronic
1007251502 6:40498204-40498226 AGCAGGAGATGGGACACAGCTGG + Intronic
1007864589 6:44955084-44955106 AGAAGAAAATGGCACATAGCAGG + Intronic
1009306181 6:62092150-62092172 TGCTGGAAATGGTAGAGAGCTGG - Intronic
1009468931 6:64008297-64008319 AACAGAAAATGGAAAACAGCAGG - Intronic
1010751430 6:79620112-79620134 AACGGTAAATGGAACACAGCAGG - Intergenic
1011335461 6:86254777-86254799 GGGAGGAAATGGTACAGGGCAGG + Intergenic
1011448575 6:87469487-87469509 AGCAGGAAATGGAAGAGAGCAGG + Intronic
1013628377 6:111959998-111960020 ATGAGGAAATGGGACCCAGCTGG + Intergenic
1013713942 6:112935114-112935136 AGTAGGAAATGGGAGAAAGCAGG - Intergenic
1014070983 6:117181466-117181488 AGCAGGAAATGGGAGAAAGGAGG + Intergenic
1015733031 6:136367673-136367695 AGCTGGAAATGATGCAGAGCTGG - Intronic
1016096963 6:140050043-140050065 GGCAGGTAATGGTACAAAGCAGG - Intergenic
1016842527 6:148538669-148538691 AGCAGGAAGTGGTGGACAGCCGG + Intronic
1017299914 6:152844934-152844956 AGCAGGAATAGGTGCATAGCAGG - Intergenic
1018330556 6:162723199-162723221 AGCAGTTAAGGGTACATAGCAGG + Intronic
1021098818 7:16564652-16564674 AGCAGGCAATGGAAGACACCTGG - Intronic
1022636722 7:32143090-32143112 AGCAGGGCATGGTCAACAGCAGG + Intronic
1024187333 7:46964156-46964178 AGAAAGAAATGGCACACAGTGGG + Intergenic
1024662814 7:51515018-51515040 AACAGGAAATTCTTCACAGCAGG - Intergenic
1025721718 7:64021913-64021935 AGGAGAAAATGATACACAGCAGG - Intergenic
1025749262 7:64278455-64278477 AGGAGAAAAGGATACACAGCAGG - Intergenic
1027532462 7:79353481-79353503 AGCAGCAAAGGGCACACACCAGG - Intronic
1027727131 7:81821625-81821647 AGAAGGAATTGGTACTCAGGAGG - Intergenic
1032349142 7:131144128-131144150 AACAGTAACTGGTACACAGAAGG + Intronic
1032727681 7:134606201-134606223 AGCAGGAAATGTTTCAAAGCAGG + Intergenic
1033450864 7:141461374-141461396 AGCAGAAAATGTCACACAGATGG + Intronic
1033467748 7:141611263-141611285 AGGAGGAGATGGGACACTGCAGG + Exonic
1034379361 7:150676908-150676930 AGCAGCAACTGGCAAACAGCTGG - Intergenic
1035202269 7:157275326-157275348 AATAGGAAACTGTACACAGCTGG + Intergenic
1035671648 8:1422675-1422697 ACCAGGGGGTGGTACACAGCAGG + Intergenic
1036664182 8:10728416-10728438 AGAAGGAAATGTCACACAGGTGG + Intronic
1037750717 8:21680378-21680400 AGCTGGAAATTTTACTCAGCTGG + Intergenic
1037940229 8:22945723-22945745 AGGAGGAAATGGAACAGTGCTGG - Intronic
1039460365 8:37738453-37738475 ATCAAGAACTGGTACTCAGCTGG - Intronic
1040105799 8:43541088-43541110 AGCAGGGACTGGTACCCACCCGG + Intergenic
1041783640 8:61607031-61607053 AGGAGGAAATGACACACTGCTGG - Intronic
1045029081 8:98117718-98117740 AGCAGGAAAGGGAACACGGGAGG - Intronic
1045653784 8:104366861-104366883 AACAGGAAATGGGAAAAAGCAGG - Intronic
1046049119 8:109000247-109000269 AGCAGAAACTTGTACACAGATGG - Intergenic
1047512674 8:125527801-125527823 AGCAGGAACTGGAACACAGGCGG - Intergenic
1047833271 8:128659209-128659231 AGCAGGAATTGTTCCAAAGCAGG - Intergenic
1047878825 8:129170238-129170260 AGCTGGAAAGGGTCCAGAGCGGG - Intergenic
1049719767 8:144110399-144110421 AGCAGGAGAAGGTGCGCAGCAGG - Exonic
1049924564 9:396184-396206 AGCAGGAAATGTTGGCCAGCTGG - Intronic
1050846071 9:10220969-10220991 AAAACGAAATGGTACACAGAAGG + Intronic
1051810790 9:21047609-21047631 AGCAGGAAGTGGTTAACAACTGG - Intergenic
1053031946 9:34787881-34787903 GGGAGGAAATGGTAAACAGGTGG - Intergenic
1053124822 9:35572136-35572158 AGCAGGAAAAGGTACTAAGAAGG + Intergenic
1053278766 9:36802901-36802923 AGCAGGAACTGGTTCACGGTGGG + Intergenic
1055584450 9:77743306-77743328 AGCAGGAGAGGGTCCACAGTCGG + Intronic
1056160203 9:83882721-83882743 AGCAGAAAAGGATATACAGCAGG + Intronic
1056360023 9:85847111-85847133 AGCAGAAAAGGATATACAGCAGG - Intergenic
1058132901 9:101273521-101273543 AGCAGGCAATGCTACCCTGCCGG + Intronic
1058167763 9:101639498-101639520 TGCAGGGTATAGTACACAGCTGG - Intronic
1059023712 9:110602512-110602534 GGCAGCCAATGGGACACAGCTGG + Intergenic
1059338704 9:113585080-113585102 CGCAGGGCCTGGTACACAGCAGG - Intronic
1059567419 9:115396866-115396888 AGCAAGCAGTGGTAGACAGCAGG + Intronic
1060054161 9:120399589-120399611 AGCAGGACATGGGACACTCCAGG + Intronic
1060986858 9:127825061-127825083 AGCAGGAGTGGGGACACAGCAGG - Intronic
1061203832 9:129151924-129151946 AGCAGAGACTGGCACACAGCAGG + Intergenic
1061788377 9:133044623-133044645 ACCAGGAAAGGGTAAACAGCTGG - Intronic
1062217517 9:135397292-135397314 TGCAGGAAGTGGCACACTGCTGG + Intergenic
1062488393 9:136792222-136792244 AGCAGGAAATGGAAGAGGGCTGG - Intronic
1187993326 X:24899113-24899135 AGTAGGAAAAGGTCCGCAGCAGG - Intronic
1188013943 X:25086994-25087016 AGCATCAAATGGTACAAAACAGG + Intergenic
1188119582 X:26287485-26287507 AGATGGAAATGGTACACACTGGG - Intergenic
1189680988 X:43515692-43515714 ATCAGCAAATGCTACACAGCAGG + Intergenic
1192537621 X:71941808-71941830 ACCAGAAAATGGTAAAGAGCTGG - Intergenic
1193435845 X:81474491-81474513 AGCCAGCAATGGTACAAAGCTGG - Intergenic
1195721290 X:107871670-107871692 AGCTGGAAAGGGGACAGAGCAGG + Intronic
1196311599 X:114174191-114174213 AGCAAAATATAGTACACAGCAGG - Intergenic
1197930375 X:131688867-131688889 CACAGGAAATGGTAAATAGCTGG - Intergenic
1197972618 X:132130964-132130986 AGGAGGAGATGGGACACTGCAGG - Intergenic
1199752039 X:150829085-150829107 AACAGTAACTGATACACAGCTGG + Intronic
1201417350 Y:13760682-13760704 AGCAAGAAATAAAACACAGCAGG - Intergenic
1201964377 Y:19715752-19715774 AGCCGGGAAGGGTACACATCTGG + Intronic