ID: 1091650053

View in Genome Browser
Species Human (GRCh38)
Location 12:2303036-2303058
Sequence CCTTCTCCCAGGACGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091650045_1091650053 2 Left 1091650045 12:2303011-2303033 CCCAAGAGCAGGGTGCAGAGCTC 0: 1
1: 0
2: 1
3: 32
4: 334
Right 1091650053 12:2303036-2303058 CCTTCTCCCAGGACGGAGGCGGG 0: 1
1: 0
2: 2
3: 35
4: 314
1091650046_1091650053 1 Left 1091650046 12:2303012-2303034 CCAAGAGCAGGGTGCAGAGCTCC 0: 1
1: 0
2: 2
3: 37
4: 279
Right 1091650053 12:2303036-2303058 CCTTCTCCCAGGACGGAGGCGGG 0: 1
1: 0
2: 2
3: 35
4: 314
1091650040_1091650053 28 Left 1091650040 12:2302985-2303007 CCTGCATCACAGCAACAAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1091650053 12:2303036-2303058 CCTTCTCCCAGGACGGAGGCGGG 0: 1
1: 0
2: 2
3: 35
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091650053 Original CRISPR CCTTCTCCCAGGACGGAGGC GGG Intronic
900098929 1:952756-952778 GCTTCTCCCAGGCCTGAGGCTGG - Intronic
900138441 1:1128705-1128727 CCTGGTCCCAGGACGGCGGAGGG - Intergenic
900395095 1:2450205-2450227 CCTCCTCCCAGGAGGGAGTTTGG + Intronic
900430764 1:2602163-2602185 ACTTCTCCCTGGAGGGAGGCCGG - Intronic
900430775 1:2602193-2602215 TCTTCTCCAGGGAAGGAGGCAGG + Intronic
900649785 1:3725217-3725239 CCTTCTCCCCTGACACAGGCTGG - Intronic
900966827 1:5964613-5964635 CCTTCTCCCTGGACAGTGGGAGG - Intronic
902329685 1:15725226-15725248 CGTTAGCCCAGGAGGGAGGCAGG - Intronic
902640519 1:17763536-17763558 CCTCCTTCCAGGCTGGAGGCAGG - Intronic
903177152 1:21587968-21587990 CCTTCTCACAGGCCGGACCCAGG - Intergenic
903845999 1:26280280-26280302 CCCACCCCCAGGACGGGGGCGGG + Intronic
904310503 1:29626390-29626412 ACTACTCCAAGGAGGGAGGCTGG + Intergenic
904680048 1:32222669-32222691 CCTTCTGCCAGGACGATGGGTGG + Intronic
905440982 1:37996528-37996550 CCCTCTGCCAGCAGGGAGGCAGG + Intergenic
905990685 1:42334977-42334999 GCATCTCCCGGGACGGAGGCAGG - Intronic
906639621 1:47433844-47433866 CCTTAGCCCAGGTGGGAGGCGGG - Intergenic
907188855 1:52632632-52632654 CCTTGTCCCAGGCCAGTGGCAGG + Intergenic
907517318 1:55000823-55000845 CCTTCTCCCAGTGAGGAGGCTGG + Intronic
910374403 1:86552991-86553013 CCGTCTCCCAAGCCAGAGGCAGG + Intronic
910676322 1:89820645-89820667 CCTTCGCCCAGGACGGGTGAAGG + Intronic
911682401 1:100732450-100732472 CCTTCCTCCAGGATGGAGGAAGG - Exonic
913323256 1:117605578-117605600 CCTGCCCCCAGGAGTGAGGCGGG - Intergenic
914994986 1:152535604-152535626 CCTCCTCCCAGGTCTGGGGCAGG + Intronic
915314951 1:155023283-155023305 CCTTCTCCCAGGATGTCTGCAGG - Intronic
916060050 1:161092109-161092131 CCCTCTCCTAGGATGAAGGCTGG + Intergenic
920175967 1:204102172-204102194 CCTTCTCCCAGTACTGGGGTGGG - Intronic
921973642 1:221177737-221177759 CATTCTCCCAGGACCTAGGATGG - Intergenic
922581832 1:226703786-226703808 CTTTCTCCCAAGCCGGAAGCTGG - Intronic
923006976 1:230057950-230057972 CCTTTCCCCAGGACGAAGGGAGG + Intergenic
923191742 1:231626798-231626820 CCTTCCCCGAGGCCAGAGGCGGG - Exonic
1062942902 10:1438174-1438196 GTCTCTCCCAGGATGGAGGCAGG + Intronic
1062943030 10:1438766-1438788 GTCTCTCCCAGGATGGAGGCAGG + Intronic
1062943112 10:1439129-1439151 GTCTCTCCCAGGATGGAGGCAGG + Intronic
1062943148 10:1439311-1439333 GTCTCTCCCAGGATGGAGGCAGG + Intronic
1062943192 10:1439493-1439515 GTCTCTCCCAGGATGGAGGCAGG + Intronic
1062943213 10:1439584-1439606 GTCTCTCCCAGGATGGAGGCAGG + Intronic
1063824770 10:9883228-9883250 CCTTCTGCCAGGACCAAGGCTGG + Intergenic
1066292487 10:34027038-34027060 CCTGCTTCCAGGAGGAAGGCAGG - Intergenic
1066480982 10:35795246-35795268 CCTCCTCCAAGGGCCGAGGCAGG + Intergenic
1067224983 10:44369799-44369821 CATTCTCCCAGGACTGAGAAGGG + Intergenic
1071185837 10:83043618-83043640 CCTTTACCCAGGAGGGAAGCTGG - Intergenic
1071505881 10:86231258-86231280 GTGTCTCCCAGGAGGGAGGCAGG + Intronic
1072067069 10:91881493-91881515 CCTTCTCCAAGCACACAGGCAGG - Intergenic
1072783882 10:98267811-98267833 CCTTCTTCCAGGGAGGAGACAGG - Intronic
1073205415 10:101766845-101766867 CCCTCACCCAGGACAGAGCCTGG + Intergenic
1074052855 10:109895625-109895647 CCTTCTCCCAGGCATGAAGCTGG + Intronic
1075071026 10:119319975-119319997 CCTGCTCCCGGGAAGGAGGCGGG - Intronic
1076647779 10:131965250-131965272 CTTCTTCCCAGCACGGAGGCTGG + Intergenic
1076835934 10:133020930-133020952 CCTTCTCCCCTGAAGGAGTCAGG + Intergenic
1077032262 11:473834-473856 GCTTCTCCCAGGAGGGAGGTGGG - Intronic
1078069297 11:8097834-8097856 CATTCCCCCAGGAAGCAGGCGGG + Intronic
1079161136 11:17995280-17995302 CCTTCTCCCAAAAAGGAAGCAGG - Intronic
1080277382 11:30517791-30517813 CCTTCTCCCATGACAGAAGGAGG - Intronic
1080397250 11:31901675-31901697 CCTTCTCATAGGCCTGAGGCTGG - Intronic
1080496962 11:32829936-32829958 CCGCCTCCCCGGACCGAGGCAGG + Exonic
1081598390 11:44475130-44475152 CCTGCCCCCAGGTCCGAGGCAGG + Intergenic
1083840081 11:65299337-65299359 CCTTCTGCCAGGGCAGAGGCAGG - Intronic
1083967493 11:66051757-66051779 CCTTCCCCCAGGTCGGCAGCTGG + Intronic
1086437974 11:86800452-86800474 GCTTCCCCGAGGCCGGAGGCGGG + Exonic
1087222374 11:95560291-95560313 CCTTCTCCCAGGACCTGAGCTGG + Intergenic
1087761776 11:102110549-102110571 CCAACTCCCTTGACGGAGGCCGG - Exonic
1087840097 11:102911730-102911752 CGTTCTCCCAGTGCGCAGGCTGG - Intergenic
1088425135 11:109693822-109693844 CTTTCTCCCAGGGTGGTGGCAGG + Intergenic
1089100221 11:115956818-115956840 CCTTCTGCCAGTAAGGGGGCTGG - Intergenic
1090083172 11:123627929-123627951 CCTTCTCACGGGAGGGAGGGAGG + Intergenic
1090245583 11:125213913-125213935 CCTTCTGCGAGGACTGAGGTTGG - Intronic
1091235270 11:134017950-134017972 CCTTCCCCCAGGAGGCAGGATGG - Intergenic
1091344450 11:134843528-134843550 CATCCTCCCAGGAGGGAGGATGG + Intergenic
1091457103 12:616212-616234 ACTTCTCCAAGAACAGAGGCTGG + Intronic
1091650053 12:2303036-2303058 CCTTCTCCCAGGACGGAGGCGGG + Intronic
1091918141 12:4283714-4283736 CATTTTGCCAGGAGGGAGGCGGG + Intronic
1091942340 12:4499257-4499279 GCTACTCCCAGGACTGAGGCAGG - Intronic
1092879789 12:12879128-12879150 GCTACTCCCAAGACTGAGGCGGG - Intergenic
1094540158 12:31356730-31356752 CCGTCACCCAGGACTGAGACTGG + Intergenic
1095528666 12:43158429-43158451 GCATCTCCCAGCATGGAGGCTGG + Intergenic
1095921739 12:47538842-47538864 CTTTCGCCCAGGCTGGAGGCTGG - Intergenic
1096648123 12:53049115-53049137 CATGTTCCCAGGAGGGAGGCCGG + Exonic
1097241798 12:57580741-57580763 CCTTCTCCCAGAGCGAAGGGTGG - Intronic
1098450986 12:70617830-70617852 CCTTCTCCCAGGCCGGAGCAAGG + Intronic
1102281857 12:111624770-111624792 CCTCCTCCTAAGAGGGAGGCGGG - Intergenic
1102524984 12:113506034-113506056 CCTTCTGCCATGACCCAGGCAGG - Intergenic
1103464232 12:121129033-121129055 CCTTCTCCCCCAACGGAGGTTGG + Intergenic
1103775718 12:123364974-123364996 CCTTCACCTAGGAGGGAGGCGGG - Intergenic
1103919647 12:124392832-124392854 ACTTCTCACAGGAGCGAGGCAGG - Intronic
1104714079 12:131005199-131005221 CCTGCTCCTAGGGCAGAGGCAGG + Intronic
1105377944 13:19862713-19862735 CCTGCTCCCAGGACGGGAGAGGG + Intronic
1105823886 13:24105017-24105039 TCTTCTCCCTGGAAGCAGGCAGG - Intronic
1106885583 13:34181392-34181414 CCTTCTACCGGGAGGGAGGTAGG + Intergenic
1107753344 13:43593261-43593283 CCTTCTCCCTGAAAGGAGGTAGG - Intronic
1108573093 13:51769282-51769304 CCTTCTCCCAGGTGTGAGGCAGG - Exonic
1113338692 13:109401429-109401451 CATTCTCCCAGGGCGCAGGCCGG - Intergenic
1113572864 13:111370981-111371003 CCTGCTCGGAGGAGGGAGGCGGG - Intergenic
1113681916 13:112250478-112250500 CCTTCTGCCTGGAGGGAGCCTGG - Intergenic
1114889050 14:26893065-26893087 CCTTCTTCCTGGTCGGGGGCAGG + Intergenic
1115530544 14:34323002-34323024 CATTCTCCCAGGACGAAGATGGG + Intronic
1115560682 14:34580147-34580169 CTTTCACCCAGGCCGGAGGCTGG - Intronic
1115729962 14:36258061-36258083 CCTCCTCCCAGAACTGAGGCAGG - Intergenic
1117867567 14:60165421-60165443 CCTGCTCCCTGGGCGGAGCCGGG - Exonic
1118431618 14:65724688-65724710 GTTTCTCCCAGGTCTGAGGCTGG + Intronic
1119176137 14:72568816-72568838 TGTTCTCAGAGGACGGAGGCAGG - Intergenic
1119704874 14:76777203-76777225 CCTTCCCCTAGGGCAGAGGCAGG + Intronic
1120517605 14:85489302-85489324 CCTTCTCTCAGGATGGCGGCAGG - Intergenic
1120994856 14:90409360-90409382 CATTCTCCCAGGACGGAAATAGG + Intergenic
1122013884 14:98777010-98777032 CCAGCTCCCTGGACTGAGGCTGG + Intergenic
1122079315 14:99256114-99256136 CCATCACCCAGGACGCAGTCAGG - Intronic
1122258119 14:100494751-100494773 CCTTCTCCCATGTGGAAGGCGGG + Intronic
1122790615 14:104182761-104182783 GCTGGTCCCAGGAGGGAGGCTGG + Intergenic
1122885326 14:104708030-104708052 GCTTCCCCTAGGACGGGGGCTGG + Intronic
1124038927 15:26082458-26082480 CCTTCTCGAAAGGCGGAGGCAGG + Intergenic
1124238825 15:28013505-28013527 CCTGCTCCCAGGAAGCAAGCAGG - Intronic
1125803720 15:42473940-42473962 GCTTCTCACAGCACGGTGGCTGG - Intronic
1125883786 15:43213793-43213815 CCTGCTCCAAGGGCGCAGGCAGG - Intronic
1127267950 15:57376427-57376449 CCTCCTCCCAGGAGGGCGGGCGG + Intronic
1127309859 15:57743123-57743145 GCTTCACCCAGGAAGAAGGCAGG - Intronic
1127917066 15:63463692-63463714 CCTACTCCCAGGAAGGATGCTGG - Intergenic
1129176212 15:73841507-73841529 CTTTCTCCCAGGTCAGGGGCAGG - Intergenic
1129191036 15:73937725-73937747 CTTGCTCCCAGGAGGGAGACAGG - Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1129483334 15:75844175-75844197 CCTGCTCCCGGGACCGGGGCGGG + Intronic
1130688497 15:86059898-86059920 CCTTCTCCCAGGAGCAGGGCGGG + Intergenic
1131517070 15:93086623-93086645 GCTGCTCCCAGGAAGCAGGCAGG - Intronic
1131620215 15:94060324-94060346 GCTTCTCTCAGCACGGTGGCTGG + Intergenic
1131679911 15:94710498-94710520 CTTTCTCCCAGGCCGGAGTGCGG + Intergenic
1132279620 15:100602084-100602106 CCTGCTGCCAGCACGGCGGCCGG + Intronic
1132759229 16:1500821-1500843 ACTTCTCGCAGGGCTGAGGCTGG + Intronic
1133844970 16:9445055-9445077 CATTCACCCAAGACGAAGGCTGG + Intergenic
1134262821 16:12666401-12666423 CCTTCTTCCAGCAGGGAGCCAGG - Intronic
1136577006 16:31131009-31131031 CCAGCTCCCAGGATGGAGCCCGG + Exonic
1137401317 16:48156315-48156337 CATTCTCTCAGGAAGGAGCCTGG - Intergenic
1137774264 16:51042418-51042440 CTTTCTCCAGGGACTGAGGCTGG + Intergenic
1138309614 16:56012061-56012083 CTTTTTCTCAGGACAGAGGCAGG - Intergenic
1138406553 16:56799561-56799583 GCTTTCCCCAGGAAGGAGGCTGG + Intronic
1141447359 16:84069812-84069834 CCTCCTCCCACCACGGAGGCTGG + Intronic
1141678624 16:85530996-85531018 CCTGCTCCCAGCACAGAGCCAGG - Intergenic
1142247951 16:88978404-88978426 TCTGCCCCCAGGACTGAGGCTGG + Intergenic
1142618859 17:1153125-1153147 CCATCTCCCAGAACAGAGGGCGG - Intronic
1142727799 17:1829528-1829550 TCTTCTCTAAGGACGGGGGCCGG + Intronic
1143582252 17:7834262-7834284 CCTTCTCCCAGGCCGGGGCTGGG - Intergenic
1143683068 17:8492007-8492029 CCTCCTGCCAGGATGCAGGCTGG + Intronic
1144624749 17:16838966-16838988 CCTCTTCCCAGCACGGAAGCGGG + Intergenic
1144871078 17:18371473-18371495 CCTCCTCACAGGATGGTGGCAGG - Intergenic
1144881681 17:18433755-18433777 CCTCTTCCCAGCACGGAAGCGGG - Intergenic
1145150552 17:20510631-20510653 CCTCTTCCCAGCACGGAAGCGGG + Intergenic
1146266141 17:31454095-31454117 CATTCTCCCAGGGCAGAGACTGG + Intronic
1146653820 17:34623469-34623491 CCTTCTCCCAGCCCAGAGGGAGG + Intronic
1146763291 17:35496577-35496599 CCTTCTCCCTGGAAGGAGCGGGG + Intronic
1146936391 17:36814975-36814997 CCTCCTCCCAGGATGCAGGGAGG - Intergenic
1147168212 17:38604511-38604533 CGCTCTCCCAGGGAGGAGGCTGG - Intronic
1147306794 17:39569711-39569733 TCTTCTGCCAGGACAGGGGCAGG + Intergenic
1148542853 17:48493698-48493720 CCTTCTCCCAGTATGGAAACTGG + Intergenic
1148687525 17:49509082-49509104 GCCCCTCCCAGGACGGAGACGGG + Intronic
1149242209 17:54663522-54663544 CCTCCTCCCAGGAACTAGGCAGG + Intergenic
1150623420 17:66824834-66824856 CCTGCTCCCAGGACGGAGCCTGG + Intergenic
1150737804 17:67755107-67755129 CTTTCACCCAGGCTGGAGGCTGG - Intergenic
1152560068 17:81073399-81073421 ACTGCTCCCAGGAAGAAGGCTGG - Intronic
1152567531 17:81106897-81106919 CCTTCTCCCAGGTCAGTGGGCGG + Exonic
1153051767 18:907512-907534 TCTTCTCCCAGGACTGGGGGTGG - Intronic
1153147732 18:2052759-2052781 CCATCTCCCAGTCTGGAGGCAGG + Intergenic
1153812812 18:8766729-8766751 CCCTCTCCCAGGAAGGCGGCTGG - Intronic
1156468458 18:37362559-37362581 CCTTCTGCCAGGACACAGGGAGG + Intronic
1157544764 18:48539696-48539718 CCTCCTCCCAGGTCGGAACCCGG - Intronic
1159021447 18:63146323-63146345 CCTTCTGCCAGGAGGCGGGCTGG - Intronic
1160409972 18:78668570-78668592 GCTTCTCCCAGGCCCGGGGCTGG + Intergenic
1160583380 18:79900131-79900153 CCTCCTCCCTGGCTGGAGGCAGG - Intronic
1160751790 19:737858-737880 GCTTTTCCCGGGAGGGAGGCAGG + Intronic
1161399133 19:4059812-4059834 CCCTCTCCCACCTCGGAGGCAGG - Intronic
1161409902 19:4111410-4111432 GCCTTTCCCAGGAGGGAGGCAGG + Intronic
1162809163 19:13153937-13153959 GCTTCCCCCAGGATGGAGGGGGG - Exonic
1163250180 19:16122229-16122251 CCGTCACCCAGGCCTGAGGCGGG + Intronic
1164855670 19:31518725-31518747 CCTTTTCACATGACTGAGGCTGG - Intergenic
1165410631 19:35658681-35658703 CCTTCTCCCAGGATGGTGAAGGG + Exonic
1165495742 19:36151264-36151286 TCTTGTCCCAGGACGGGGGCTGG - Intronic
1165764884 19:38344123-38344145 CCCTTTCCCAAGACGGGGGCTGG + Intronic
1165866565 19:38942971-38942993 CATTCTGCCAGGAAGGTGGCAGG + Intronic
1166061162 19:40326530-40326552 CGTTCTCCCAGGATGGAAGCTGG + Intronic
1166317664 19:41998120-41998142 CCTTCTCTCAGGACAGAGGGAGG - Intergenic
1166354067 19:42216965-42216987 CCTCCTCCCAGCACGGGGCCGGG + Exonic
1168100478 19:54138483-54138505 GCTTCTCCCTCGACGGTGGCGGG + Intronic
1168103950 19:54155517-54155539 CCCTCTCCCAGGAAGCAGGGAGG + Exonic
925849821 2:8069243-8069265 CCTTCTCCCAGGCTGGAGTGCGG - Intergenic
926091925 2:10056746-10056768 CCGTCTCACAGGACAGAGACAGG + Intergenic
926218975 2:10922702-10922724 CCATCCCCCAGGAGGAAGGCGGG - Intergenic
926566675 2:14483285-14483307 CCTTCTCCCAAGACTGAACCAGG + Intergenic
928099871 2:28430721-28430743 CCCTCTCCCAGGAAGAGGGCAGG - Intergenic
928197020 2:29223311-29223333 TCTCCTCCCAGGACGGCAGCAGG + Intronic
929917113 2:46145262-46145284 CCTGGTGCCAGGACCGAGGCAGG + Intronic
931657773 2:64525040-64525062 CCTTCACCGAGGCCCGAGGCTGG + Intronic
932836142 2:75039492-75039514 TCTTCTACTAGGAAGGAGGCAGG - Intergenic
933541410 2:83647701-83647723 CATTCTCCCAGTGCGCAGGCGGG - Intergenic
933750704 2:85600814-85600836 CATCCTCCCAGGAGTGAGGCAGG - Intronic
937031937 2:118747928-118747950 CCTTCTCCCTGGAAGCAGGTGGG + Intergenic
937885012 2:126893707-126893729 GCTTCTCCCAGCATGGTGGCTGG + Intergenic
937905293 2:127050051-127050073 TCCTGTCCCAGGAGGGAGGCAGG + Intronic
938138743 2:128779923-128779945 CCTCCTCCCAGGCCCCAGGCAGG - Intergenic
941966932 2:171310080-171310102 ACCTCTCCCAGGAAGGAGGAGGG - Intergenic
942220211 2:173761784-173761806 CCATCTCCCAGGCCGGAGTGCGG - Intergenic
945217239 2:207446824-207446846 GCTTCTCCCAGTGCGCAGGCTGG - Intergenic
947950109 2:234139603-234139625 CCTTCTTCCTGGCCTGAGGCTGG + Intergenic
948395734 2:237643610-237643632 CCTTCTCCCAGGGGAGAGCCTGG + Intronic
948466290 2:238153306-238153328 CCTTCTCCCAAGACGGGGTGGGG - Intergenic
948780713 2:240320086-240320108 GGCTCTCCCAGGACGGAGTCTGG - Intergenic
1170639451 20:18138483-18138505 CCTTGGGCCAGGAGGGAGGCTGG - Intronic
1170948074 20:20909861-20909883 CCTCCTCCCAGTACGCAGGTGGG + Intergenic
1172207617 20:33175495-33175517 CATTCTCCCAGGACGGCAACAGG - Exonic
1174290372 20:49504166-49504188 CCTTCTCCAGGGACAGAAGCAGG - Exonic
1174487568 20:50870973-50870995 CCTCCTCCCGGGCCGCAGGCAGG - Intronic
1174886334 20:54339366-54339388 CCAACTCCCAGGCCGCAGGCTGG - Intergenic
1175745500 20:61454183-61454205 CCTTCTCCCAGGCCCTGGGCCGG + Intronic
1175821094 20:61909224-61909246 CTTCCTCCCAGGACGGGCGCTGG - Intronic
1176065073 20:63190245-63190267 CCTTCTCCAAAGATGGTGGCAGG - Intergenic
1176133118 20:63505406-63505428 CCGTCCCCCAGGACAGAGCCTGG - Intergenic
1177655492 21:24011317-24011339 CCTGGTCCAAGGACAGAGGCAGG - Intergenic
1177978956 21:27885933-27885955 CCTACTCCAAAGACAGAGGCAGG + Intergenic
1178498809 21:33109405-33109427 CCTTCCCCCAGGCAGGAGGAAGG + Intergenic
1178797385 21:35757524-35757546 CCTTCTCCCAGAACAGAGAACGG - Intronic
1179882632 21:44299968-44299990 CCTCCTCGCAGGACGGACCCTGG - Intergenic
1181488565 22:23247147-23247169 TCTTCTCCCAGGTCCTAGGCAGG - Intronic
1182053374 22:27330410-27330432 CCTTGTCCCAGGACCAAGGGGGG - Intergenic
1183079489 22:35447394-35447416 CCTTCTCCCAGGAATGAGAGAGG - Intergenic
1183500636 22:38176656-38176678 CCTTGTGAGAGGACGGAGGCCGG - Intronic
1183697897 22:39433535-39433557 CGTTGTCCCAGGACGGGGGCAGG + Intronic
1183934518 22:41254622-41254644 CCTGCTCCCAGGGCAGGGGCAGG + Intronic
1183975650 22:41510585-41510607 CGCTCTCCCATGCCGGAGGCTGG + Intronic
1184171978 22:42765260-42765282 TCTTCTCCCAGGCCGGGGGCTGG - Intergenic
1185373566 22:50471742-50471764 CCGGCTCCCAGGGTGGAGGCTGG + Intronic
950551087 3:13666275-13666297 ACTTCCCCCAGTATGGAGGCTGG + Intergenic
950785277 3:15428698-15428720 CCTTCACCCAGGACATAGGGTGG - Intronic
953465221 3:43113994-43114016 CCTTTTCCCAAGAGGGAGGTGGG + Intergenic
953611413 3:44450520-44450542 CCTTCTCCCAGGACGAGTGGGGG - Exonic
954055192 3:48017380-48017402 TCTTCTGCAAGGAGGGAGGCAGG + Intronic
954215153 3:49120567-49120589 TCCTCTCCCAGGTGGGAGGCTGG + Intronic
955236353 3:57143238-57143260 CCTTACACCAGGATGGAGGCAGG + Intronic
955380350 3:58433563-58433585 CCTTCTCTCGGGAAGGAGGCCGG - Intronic
955420093 3:58727257-58727279 CCTTTCCCCAGGCAGGAGGCAGG - Intronic
956352820 3:68356603-68356625 CCATCTCACAGGATGGTGGCGGG - Intronic
959067857 3:101676416-101676438 ACTTCCCACAGGAAGGAGGCCGG - Intronic
960040845 3:113148561-113148583 CATGCTCCCAGGAAGGAGGAAGG + Intergenic
960564866 3:119122639-119122661 TCTTCTCCCAGGAGGAAGGATGG - Intronic
961035791 3:123640647-123640669 CCTTCTCCCATGTCGGAGGGTGG - Intronic
961518381 3:127452674-127452696 ACTTGTCCCAGGACGGAGCTGGG + Intergenic
962919156 3:139935505-139935527 TCTTCTCCCAGGAGGGAGGCAGG + Intronic
963868226 3:150385686-150385708 CCATCCCCCAGAATGGAGGCAGG + Intergenic
967262602 3:187658375-187658397 CCTTCTCACAGGACATAGGTAGG - Intergenic
967531035 3:190549250-190549272 CATTCTCCCAGTGCGCAGGCTGG + Intronic
968455370 4:695759-695781 CCTTCTCCAGGGACAGAGGTAGG + Intergenic
969570034 4:8002802-8002824 GCATCACCCAGGGCGGAGGCCGG - Intronic
969717019 4:8872663-8872685 CCTTCGCCCAGGGCAGAGGCTGG - Intergenic
973147602 4:46847197-46847219 CCATCTCCCAGAATGTAGGCAGG + Intronic
973650613 4:52993984-52994006 CCTCCTCCCAGCCCTGAGGCTGG + Intronic
973966850 4:56171797-56171819 CTTACCCACAGGACGGAGGCAGG - Intronic
978706752 4:111722323-111722345 CCTTCTCCCATGAGGCAGGTAGG - Intergenic
978885220 4:113760911-113760933 CCTCGCCCCAAGACGGAGGCCGG + Intronic
982361978 4:154528647-154528669 CCTCCTTCCAGCACAGAGGCAGG - Intergenic
985814436 5:2116113-2116135 ACTCTGCCCAGGACGGAGGCTGG - Intergenic
986154535 5:5161411-5161433 CCTTATCCCATGACAGAGCCTGG - Intronic
986288526 5:6378762-6378784 ACTTCTCCCATGACCGAGGCAGG - Intergenic
986332082 5:6724859-6724881 GCCTCTCCCAGGAGGGTGGCAGG - Intronic
987160793 5:15140097-15140119 CTTTCCCCCAGGAGGGAGGGAGG + Intergenic
990922889 5:60987205-60987227 CATTCTCCCAAGACTGAGCCAGG + Intronic
991377287 5:65979075-65979097 ACTTCTCCCAGGATAAAGGCTGG - Intronic
992219554 5:74558270-74558292 CCTTCTTCCAGGACTTAGGAGGG - Intergenic
992872707 5:81022717-81022739 CCCTCTCCCAGGGAGGAGGACGG - Intronic
994269513 5:97760388-97760410 CTTTCTCCCACTACTGAGGCAGG - Intergenic
996870072 5:128180463-128180485 CCTTCTCCATGGACAGAGCCAGG + Intronic
996953904 5:129160761-129160783 CATTCTCCCAAGACTGAGCCAGG - Intergenic
997979222 5:138458731-138458753 CTCTCTCCCAGGCCTGAGGCTGG - Intergenic
998914040 5:146994976-146994998 CCTTGTCCCAAGACTGAGGTGGG + Intronic
999092431 5:148948446-148948468 CCTTCTCCAGGGACAGAAGCAGG + Intronic
1001051695 5:168419172-168419194 CTTTCTCCCAGGCCCCAGGCTGG + Intronic
1002305709 5:178281457-178281479 GCTGCTCCCAGGACTGAGGCCGG + Intronic
1002350234 5:178577804-178577826 ACTTGTCCCAGGACGCTGGCCGG + Intronic
1002527984 5:179825684-179825706 CCTTCTCCCCGCTCTGAGGCAGG - Intronic
1002822335 6:737029-737051 CCTTATCCCAGGAAGTAAGCAGG - Intergenic
1004165273 6:13251301-13251323 CGTTCCCTCAGGATGGAGGCAGG + Intronic
1006021442 6:31120323-31120345 CCTCCTGCCAGGTAGGAGGCTGG - Exonic
1006782732 6:36643226-36643248 CCTGTTCCCTGGACAGAGGCTGG - Intergenic
1006948014 6:37798427-37798449 CCGTGTCCCAGGACGGGGTCAGG - Intergenic
1007718703 6:43872545-43872567 GCTTCTCTCAGGACCCAGGCTGG + Intergenic
1007849708 6:44791508-44791530 GCCTCTCTCAGGAAGGAGGCTGG + Intergenic
1012972703 6:105748781-105748803 CCGACTCACAGGAAGGAGGCAGG - Intergenic
1013196297 6:107848057-107848079 CCCTCCCCCAGGACGGGGGTCGG + Intergenic
1015745613 6:136506554-136506576 CCAACTCCCAGTACTGAGGCTGG - Intronic
1017170443 6:151450458-151450480 CCTTCCTCCCGGACGGGGGCTGG - Intronic
1017581910 6:155874380-155874402 CCTGCTACCCGGAAGGAGGCTGG + Intergenic
1018251241 6:161872713-161872735 CCTAGTCCCAGGACAGAGGCGGG - Intronic
1019261499 7:84395-84417 CCTCCTCACAGGAGCGAGGCAGG + Intergenic
1019450297 7:1094197-1094219 CCTTCTCCCATCACCGGGGCTGG + Intronic
1019486720 7:1292816-1292838 CCTACTCCCAGGACAAAGCCAGG - Intergenic
1019514569 7:1434064-1434086 CGTTCTCCCAGGACTGGGGCTGG - Intronic
1021600880 7:22361995-22362017 GCTTCTCCCTGCAAGGAGGCTGG - Intergenic
1024325363 7:48105287-48105309 GCTTCTCCCAGCACTGGGGCTGG - Intronic
1024587781 7:50856424-50856446 GCTTCTCCCAGGTGAGAGGCAGG + Intergenic
1025998218 7:66541852-66541874 GCTTCCCACAGGACAGAGGCTGG - Intergenic
1026991171 7:74586648-74586670 GCTTCCCACAGGACAGAGGCTGG - Intronic
1027632194 7:80620622-80620644 CCTTCCCCCAGGATGTAGGGTGG + Intronic
1032742621 7:134753986-134754008 CCTTCTCTCTGGCAGGAGGCTGG + Intronic
1033212721 7:139472018-139472040 CCTAATCCCAGGACAGAGCCTGG + Intronic
1034954506 7:155326297-155326319 TCTGCTTCCAGGACGGTGGCTGG + Intergenic
1034980970 7:155476097-155476119 TCTTCTCTCAGGACAGGGGCTGG - Intronic
1035250219 7:157592454-157592476 CCTTCACACAGGATGGAGGGTGG + Intronic
1035250235 7:157592545-157592567 GCTTCACACAGGACGGAGGGTGG + Intronic
1035250251 7:157592636-157592658 CCTTCACACAGGACAGAGGGTGG + Intronic
1035250284 7:157592818-157592840 CCTTCACACAGGACGGAGGGTGG + Intronic
1035250301 7:157592909-157592931 GCTTCACGCAGGACGGAGGGTGG + Intronic
1035250318 7:157593000-157593022 GCTTCACGCAGGACGGAGGGTGG + Intronic
1035250349 7:157593182-157593204 CCTTCACACAGGACGGAGGGTGG + Intronic
1035284709 7:157798933-157798955 CCCTCTCCCAGGAAGGCAGCAGG + Intronic
1036552279 8:9826183-9826205 GCTACTCCCGAGACGGAGGCAGG + Intergenic
1036664221 8:10728657-10728679 CCTGCTCCCAGGAAAGGGGCAGG - Intronic
1037322317 8:17655692-17655714 CTGTCTCCCAGGCTGGAGGCTGG - Intronic
1037930118 8:22874366-22874388 CATTCTCCCTGCATGGAGGCAGG - Intronic
1039867475 8:41517932-41517954 CCGTTTCCCAGGAGGGAGGGAGG + Intergenic
1039997933 8:42550591-42550613 CCTTCTCTCAGAACTTAGGCAGG + Intronic
1041137442 8:54775443-54775465 CTTTCTCACAGGACAGTGGCTGG - Intergenic
1043401621 8:79890883-79890905 CTTTCTCCTAGGAGAGAGGCTGG - Intergenic
1043556705 8:81438938-81438960 CCTTCTCCCAGAACAGGTGCTGG - Intergenic
1043606153 8:82003025-82003047 CTGTCTCCCAGGCTGGAGGCTGG + Intergenic
1044480522 8:92682087-92682109 CCTTCTCCCAGAACAGAGGATGG - Intergenic
1045506591 8:102782866-102782888 CGCTTTCCCAGGAGGGAGGCTGG - Intergenic
1046522356 8:115341909-115341931 CTGTCTCCCAGGCTGGAGGCTGG + Intergenic
1047215005 8:122869180-122869202 CTTTCTCCTGGGAAGGAGGCAGG - Intronic
1048490014 8:134883887-134883909 CCTTCTCCCAGGTGGGAAACAGG - Intergenic
1049277559 8:141727497-141727519 CAGTCTCCCAGGCCGGTGGCCGG - Intergenic
1049420071 8:142512534-142512556 CCTTCTCCCAGCCCGGTGTCAGG + Intronic
1049423044 8:142525261-142525283 CCTTCCTCCAGGCGGGAGGCAGG + Intronic
1049678216 8:143902972-143902994 CCGTCTCTGAGGACAGAGGCTGG - Intergenic
1049685573 8:143938007-143938029 CCTTCTCCCTGGGGGCAGGCTGG - Intronic
1049769787 8:144374529-144374551 CCTCCGCCCAGCCCGGAGGCGGG + Intronic
1051262033 9:15273872-15273894 CTTCCCCCCAGGACTGAGGCAGG + Intronic
1056284924 9:85078100-85078122 CCTTCACCCAGGCTGGAGGGAGG + Intergenic
1056287729 9:85108192-85108214 CCTTCTCCCAGGTGGGAGAAGGG + Intergenic
1056456649 9:86766931-86766953 CTTTCTCCCATGAGGAAGGCAGG - Intergenic
1056623548 9:88235388-88235410 CCTTCTCCCAAGACAGTGTCTGG + Intergenic
1057044138 9:91871772-91871794 CCTTCTCACAGCATGGTGGCTGG - Intronic
1057076414 9:92140534-92140556 CCTGCTCCCAGGACCTCGGCAGG - Intergenic
1057440205 9:95077460-95077482 CATGCTCCCAGGACGGTGCCTGG - Intronic
1057498117 9:95575971-95575993 GCTTCTCCCAGCTCGGGGGCGGG - Intergenic
1058375311 9:104316088-104316110 CCCTCTCCCATTACCGAGGCTGG + Intergenic
1058485771 9:105442205-105442227 CCTTCTCCCAGGAAGAAGTGGGG + Intergenic
1059327429 9:113512696-113512718 CCTGCACCCAGGACCCAGGCTGG + Intronic
1059994940 9:119899585-119899607 CTTTCTCCCAGGATTGAGGGAGG - Intergenic
1059999480 9:119945116-119945138 CCTTCTCCCAGCACTCAGGAAGG + Intergenic
1060584747 9:124778912-124778934 CATTCTACCAGGAAAGAGGCTGG - Intronic
1061884053 9:133582739-133582761 CCATTTCCCAGGAGAGAGGCCGG - Intronic
1062041778 9:134407685-134407707 CCAGTTCCCAGGACGGAGGAGGG - Intronic
1185600398 X:1335221-1335243 GCTTCTCCCAAGGCTGAGGCAGG - Intergenic
1187609002 X:20920015-20920037 CCTCCTCCCCGGACAGAGGCTGG + Intergenic
1189019065 X:37315908-37315930 CCATCTCCCAGGAAGGAGAGAGG - Intergenic
1189101287 X:38192752-38192774 CCTTCCCCTAGGACCAAGGCAGG + Intronic
1192185911 X:68946755-68946777 CTTTCTCCCAACATGGAGGCAGG - Intergenic
1194748969 X:97662873-97662895 CCTTCTCCCATGCCTGAGCCTGG - Intergenic
1201222961 Y:11789484-11789506 CCTTCGCCCAGGACCGAGAGCGG - Intergenic