ID: 1091650704

View in Genome Browser
Species Human (GRCh38)
Location 12:2307038-2307060
Sequence TGGTCTCAGCTGAAGCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 248}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091650698_1091650704 -2 Left 1091650698 12:2307017-2307039 CCCACTCTTAGCCACCTGCCATG 0: 1
1: 0
2: 0
3: 20
4: 291
Right 1091650704 12:2307038-2307060 TGGTCTCAGCTGAAGCCATGAGG 0: 1
1: 0
2: 3
3: 26
4: 248
1091650691_1091650704 19 Left 1091650691 12:2306996-2307018 CCCCCCTCACCAAAACCAGAGCC 0: 1
1: 0
2: 3
3: 19
4: 363
Right 1091650704 12:2307038-2307060 TGGTCTCAGCTGAAGCCATGAGG 0: 1
1: 0
2: 3
3: 26
4: 248
1091650692_1091650704 18 Left 1091650692 12:2306997-2307019 CCCCCTCACCAAAACCAGAGCCC 0: 1
1: 0
2: 1
3: 19
4: 276
Right 1091650704 12:2307038-2307060 TGGTCTCAGCTGAAGCCATGAGG 0: 1
1: 0
2: 3
3: 26
4: 248
1091650696_1091650704 10 Left 1091650696 12:2307005-2307027 CCAAAACCAGAGCCCACTCTTAG 0: 1
1: 0
2: 1
3: 7
4: 152
Right 1091650704 12:2307038-2307060 TGGTCTCAGCTGAAGCCATGAGG 0: 1
1: 0
2: 3
3: 26
4: 248
1091650693_1091650704 17 Left 1091650693 12:2306998-2307020 CCCCTCACCAAAACCAGAGCCCA 0: 1
1: 0
2: 4
3: 28
4: 233
Right 1091650704 12:2307038-2307060 TGGTCTCAGCTGAAGCCATGAGG 0: 1
1: 0
2: 3
3: 26
4: 248
1091650699_1091650704 -3 Left 1091650699 12:2307018-2307040 CCACTCTTAGCCACCTGCCATGG 0: 1
1: 0
2: 0
3: 18
4: 208
Right 1091650704 12:2307038-2307060 TGGTCTCAGCTGAAGCCATGAGG 0: 1
1: 0
2: 3
3: 26
4: 248
1091650697_1091650704 4 Left 1091650697 12:2307011-2307033 CCAGAGCCCACTCTTAGCCACCT 0: 1
1: 0
2: 2
3: 26
4: 186
Right 1091650704 12:2307038-2307060 TGGTCTCAGCTGAAGCCATGAGG 0: 1
1: 0
2: 3
3: 26
4: 248
1091650694_1091650704 16 Left 1091650694 12:2306999-2307021 CCCTCACCAAAACCAGAGCCCAC 0: 1
1: 0
2: 1
3: 24
4: 263
Right 1091650704 12:2307038-2307060 TGGTCTCAGCTGAAGCCATGAGG 0: 1
1: 0
2: 3
3: 26
4: 248
1091650695_1091650704 15 Left 1091650695 12:2307000-2307022 CCTCACCAAAACCAGAGCCCACT 0: 1
1: 0
2: 0
3: 25
4: 229
Right 1091650704 12:2307038-2307060 TGGTCTCAGCTGAAGCCATGAGG 0: 1
1: 0
2: 3
3: 26
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091650704 Original CRISPR TGGTCTCAGCTGAAGCCATG AGG Intronic
901131677 1:6965516-6965538 TGGTAGCAGCTGAAGCAAGGCGG + Intronic
901264477 1:7899856-7899878 TGGTCAGAGCTGAAGTCATCTGG + Intergenic
901514552 1:9736264-9736286 GTGTCTCACCTGAAGCCAAGAGG + Intronic
901651630 1:10746519-10746541 GGCCCTCATCTGAAGCCATGGGG - Intronic
901712227 1:11124674-11124696 TGCTCTCAGCTGAAGAGCTGAGG - Intronic
901939826 1:12653437-12653459 ACGTCACTGCTGAAGCCATGTGG - Intronic
902209616 1:14895203-14895225 GAATCTCAGCTGCAGCCATGGGG + Intronic
902279338 1:15362875-15362897 TGGTCTGGGCTGAAGGAATGGGG - Intronic
902924579 1:19687781-19687803 TGGTATCAGCTGCAGCCAGTGGG - Intronic
903588372 1:24435726-24435748 TGGTCTCCGTTGACACCATGGGG + Intronic
905464384 1:38141650-38141672 AGGCCTCAGCTGACCCCATGGGG + Intergenic
906006007 1:42471072-42471094 AGGACTCAGGTGTAGCCATGAGG + Intronic
906119220 1:43376912-43376934 TGCTCTCAGCTGTAGCCATAAGG - Intergenic
906357857 1:45122913-45122935 TGGTGTCAGATGAAGCCCAGTGG + Intronic
906375300 1:45291965-45291987 ACGTCTCAGCTCAAGCCATTAGG + Intronic
907899076 1:58720981-58721003 TGGTGTGAGATGAAGCCAGGAGG + Intergenic
908784095 1:67718067-67718089 TGGTCATAGCTGAAGTCATAGGG - Intronic
909127608 1:71694133-71694155 TGTTCTTAGCAGAAGCCTTGTGG - Intronic
910852190 1:91659474-91659496 TGGTCTGGGTAGAAGCCATGAGG - Intergenic
915516046 1:156413307-156413329 CCTTCTCAGCTGAAGCGATGGGG - Intronic
916181069 1:162084355-162084377 TGGTATCAGCTGAGGCCTAGTGG - Intronic
916204080 1:162298367-162298389 TGTTGTCAGCGGATGCCATGTGG + Intronic
918009413 1:180572613-180572635 GAGTCTCAGCTAAAGTCATGGGG - Intergenic
920708614 1:208274181-208274203 TGCTCTCTGTTTAAGCCATGTGG + Intergenic
921648418 1:217647443-217647465 TGATCTCTCCTGAGGCCATGGGG + Intronic
922362019 1:224831717-224831739 TCATCCCAGCTGAAGCCAAGTGG + Intergenic
1063234329 10:4096931-4096953 AGCTCTCAGCTTATGCCATGTGG + Intergenic
1067473147 10:46550258-46550280 AGGGCTCAGCTGCAGCCAGGTGG - Exonic
1067582849 10:47456383-47456405 TGGTCTCTGCAGAAGCCAGGAGG + Intergenic
1068599063 10:58936594-58936616 GAGTCTCAGCTGAAAGCATGAGG - Intergenic
1068860385 10:61841726-61841748 TGGTATGCTCTGAAGCCATGAGG + Intergenic
1070363888 10:75717190-75717212 GGAGCTCAGCTGAAGCCTTGGGG + Intronic
1073561685 10:104502450-104502472 TTGTCTCAGCTGATGCCATGTGG - Intergenic
1075264474 10:120988986-120989008 TGCTCTCAGCAGCAACCATGTGG - Intergenic
1076191444 10:128486199-128486221 TTGTCCCAGCTGGTGCCATGAGG + Intergenic
1076921935 10:133458821-133458843 TGATCTTAGCTGCAGCCTTGGGG - Intergenic
1077227815 11:1445996-1446018 GGGTCTCGGCTGAGGCCATTGGG + Intronic
1077725485 11:4671088-4671110 TGGTGTCAGTGGAAACCATGTGG - Intergenic
1077913328 11:6593346-6593368 TGATCTCAGCTGCAGACATCTGG + Intronic
1080741602 11:35069528-35069550 TGGCCTCCACTGATGCCATGGGG - Intergenic
1081601146 11:44495267-44495289 TGGTATTGGCTGAAGCCCTGTGG - Intergenic
1082285652 11:50315406-50315428 TTTTTTCAGCTGAAGCCTTGGGG + Intergenic
1084540285 11:69782224-69782246 TGGGCTCAGCTCACCCCATGGGG + Intergenic
1084565116 11:69924219-69924241 TGGTCCCAGGGGGAGCCATGAGG - Intergenic
1085978270 11:81688384-81688406 TAGTCTCCACTGAAGCCATCTGG - Intergenic
1090762461 11:129849445-129849467 TGGTATCACCTGGAGCCTTGGGG - Intronic
1090968605 11:131620267-131620289 TGGTTTTAGCTGTAGACATGAGG - Intronic
1091496385 12:976655-976677 TGACCTCAGGTGATGCCATGGGG + Intronic
1091650704 12:2307038-2307060 TGGTCTCAGCTGAAGCCATGAGG + Intronic
1091858864 12:3760819-3760841 TGGACTCAGCTGCAGCCAGTGGG - Intronic
1092593476 12:9974230-9974252 TGGTGACAGGAGAAGCCATGAGG - Intronic
1094183424 12:27615840-27615862 GGGTCTCAGCTGAGGCCACCAGG - Intronic
1094307692 12:29039109-29039131 TGGTTTCAGTAGAACCCATGGGG - Intergenic
1094354971 12:29567116-29567138 AGGCCTCAGCTGATCCCATGGGG - Intronic
1095711654 12:45295434-45295456 TAGACTCAGCTGAAGTGATGTGG + Intronic
1097982704 12:65750858-65750880 TGGTATCAGCTGAAGCAAAGTGG + Intergenic
1100151034 12:91737838-91737860 AGGTCTCAGCTGATCCCATGGGG - Intergenic
1100285866 12:93165756-93165778 TGGTCTCACTTGAGGCCCTGTGG - Intergenic
1100776101 12:97976422-97976444 AGGTCTCACCTGTACCCATGGGG - Intergenic
1103285007 12:119793556-119793578 TGGTCTGAGCTGAGGTCATCAGG - Intronic
1103338834 12:120210392-120210414 TGGTCTCTGCTGGGACCATGAGG + Intergenic
1105844955 13:24286233-24286255 TGGTCTGCGCAGAAGCCCTGTGG + Exonic
1106816440 13:33413251-33413273 GGGTCATAGCTAAAGCCATGAGG + Intergenic
1107396842 13:40026941-40026963 TGTCCTCAGCTGGAGCCATGGGG - Intergenic
1107792017 13:44012208-44012230 TGGTCTGAGCAGAGGGCATGTGG + Intergenic
1110760067 13:79221859-79221881 TGTTCTCATGTGAAGCCTTGAGG - Intergenic
1112893279 13:104265393-104265415 AGGTCTCGCCTGAAGACATGAGG - Intergenic
1113535115 13:111060009-111060031 GGATCTCAGCTGCAGCCCTGTGG - Intergenic
1113541699 13:111114818-111114840 TGGTTCCATCTGAAGCCATATGG - Intronic
1114162517 14:20184572-20184594 AAGTCTCAGCTGATGCCATGTGG - Intergenic
1115756099 14:36527026-36527048 AGGTGGCAGCTGAAGCCACGGGG - Intergenic
1118929485 14:70227691-70227713 AGCTCTCACCTGAAGCCAAGCGG - Intergenic
1119648536 14:76366751-76366773 TGGTGTCATCTAAAGCCAAGCGG - Intronic
1121026654 14:90621160-90621182 TCGTCCCAGCCGAACCCATGTGG - Intronic
1122135995 14:99633307-99633329 TGGTTTCAGCTGCAGCCTCGGGG + Intergenic
1122950798 14:105043444-105043466 GGGTCTCAGCTCAGGCCCTGGGG + Intergenic
1130097911 15:80869980-80870002 TGGTCAGTGCTCAAGCCATGAGG - Intronic
1131013807 15:89041221-89041243 CAGCCTCAGCTGATGCCATGTGG + Intergenic
1131508145 15:93033892-93033914 TGGCCCCAGATGAAGCCAGGGGG - Intergenic
1131728746 15:95256375-95256397 TGATATCAGTGGAAGCCATGTGG - Intergenic
1133420128 16:5638818-5638840 TGGGCTCAGAGAAAGCCATGAGG + Intergenic
1134603629 16:15552648-15552670 TGGTCTCAGTCGAAGCAGTGGGG + Intronic
1137263133 16:46847088-46847110 TGGTCTCAGCTGGAGGGATGGGG - Intergenic
1137577336 16:49608996-49609018 TGGTCTCTACTGACACCATGGGG - Intronic
1137842236 16:51651217-51651239 TGCTCTCAGCTGGAACAATGGGG + Intergenic
1137849388 16:51723720-51723742 TGTTCTCAAGTGAAGCCATAAGG + Intergenic
1138311760 16:56030171-56030193 ATTTCTCAGCTGAAACCATGGGG + Intergenic
1138552958 16:57757310-57757332 TGGCCTCATCTCAAACCATGGGG - Intergenic
1141616250 16:85211277-85211299 TGGTCTCAGCTTCAGGCTTGTGG + Intergenic
1141930056 16:87196287-87196309 AGGTCGCACCTGCAGCCATGAGG + Intronic
1143414162 17:6733963-6733985 TGGGCTTAACTGAAGTCATGGGG + Intergenic
1145260098 17:21349532-21349554 TGGTATCAGCTGACATCATGAGG - Intergenic
1145316520 17:21738406-21738428 TGGTATCAGCTGACATCATGAGG + Intergenic
1148574743 17:48702082-48702104 TGATATCAGCAGAAACCATGTGG - Intergenic
1150154091 17:62836009-62836031 TGGTCTCCACTGATACCATGGGG - Intergenic
1151584243 17:74999041-74999063 TGGTCAGAGAAGAAGCCATGCGG + Intronic
1152201705 17:78951045-78951067 CTGTCCCAGCTGATGCCATGTGG + Intergenic
1152447246 17:80352983-80353005 TGGTCACATCAGAAACCATGAGG - Exonic
1153984762 18:10342394-10342416 GGGTTTCAGCTGGAGTCATGAGG - Intergenic
1154219757 18:12441665-12441687 TGGTCACAGCTGCTGCAATGAGG - Intergenic
1155056141 18:22185432-22185454 TGGTGTGAGCTGCAGCCAGGGGG + Intronic
1155547482 18:26930241-26930263 TGGTATCAGATCATGCCATGGGG + Intronic
1158584795 18:58722506-58722528 TGGTTTCTGCAGTAGCCATGTGG - Intronic
1160278409 18:77461920-77461942 CTCTCTCTGCTGAAGCCATGAGG + Intergenic
1161853551 19:6751298-6751320 AGGTCTCAGCCGAAGCCACGGGG - Exonic
1163221803 19:15927171-15927193 GGGTCCCAGCTGGAGCCTTGGGG - Intronic
1163356240 19:16813137-16813159 TGGGCTCAGGAGTAGCCATGGGG + Intronic
1163362941 19:16859505-16859527 TGGGCTCAGCTTGACCCATGAGG - Intronic
1164011301 19:21205389-21205411 TGGTTTCAGCTGAGGCTTTGGGG + Intergenic
1164015729 19:21254572-21254594 TGGTTTCAGCTGAGGCTTTGGGG - Intronic
1164469022 19:28512977-28512999 TGGTCTGAGGTGATGCTATGTGG - Intergenic
1164788461 19:30956508-30956530 TGATGTCAGATGAGGCCATGTGG + Intergenic
1164943900 19:32274056-32274078 AGGTCTCAGCTGGAGGCTTGGGG - Intergenic
1165351750 19:35279519-35279541 TGGTCTCACCTGGAGGCAAGAGG + Exonic
1165717325 19:38054834-38054856 TGGTCGCTGCTCAGGCCATGGGG + Intronic
1165933725 19:39376538-39376560 GAGTCTCAGGTGAAGCCAAGGGG + Exonic
1168304657 19:55429042-55429064 AGGTCCCAGCTCAAGACATGTGG + Exonic
1168472678 19:56652226-56652248 TGCTCTCAGGTGAAGCCCAGCGG + Intronic
925181884 2:1822741-1822763 TGGACACAGCAGCAGCCATGAGG - Intronic
925789142 2:7465930-7465952 TGGTATCAGCAGAGGCCAAGTGG - Intergenic
925807976 2:7671483-7671505 TGGCCTCATTAGAAGCCATGTGG - Intergenic
926405547 2:12548764-12548786 TGGTATCAGCTGAAGGCCTTGGG + Intergenic
932418343 2:71586910-71586932 TGGACTCAGCTGCAGGCAGGTGG - Intronic
933648133 2:84828586-84828608 TGGTCCCAGGTGAAGCCATGAGG - Intronic
934546356 2:95220011-95220033 TGGTTTCAGTGGAAGCCAAGTGG - Intronic
934991501 2:98924979-98925001 TGGCCTCAGGTGCAGCCTTGGGG - Intronic
935135883 2:100301372-100301394 TGGATGCAGCTGAAGCCATGAGG - Intronic
935355817 2:102198737-102198759 TGACCGCAGCTGAAACCATGGGG - Intronic
935475395 2:103514710-103514732 TGATCTCAGCTGACGCTATAAGG + Intergenic
936920978 2:117687897-117687919 TGGCCTTTGCTGATGCCATGAGG - Intergenic
937343811 2:121110215-121110237 TGGTATCAGCAGGAGCCATAAGG + Intergenic
937650832 2:124317132-124317154 TGGTCTTAGTTGAAGCCACCCGG - Intronic
938869911 2:135464344-135464366 TGGTGGCAGGTGAAGCAATGTGG + Intronic
940849981 2:158678849-158678871 TGGTCTCAGCAGTACCGATGTGG - Intronic
942176125 2:173336140-173336162 TGGTCTCCACTGACACCATGGGG + Intergenic
942373574 2:175312056-175312078 TAGTCTCAACTGATACCATGAGG + Intergenic
942887238 2:180940330-180940352 TGATTTCAGCTGAAGCTATGAGG - Intergenic
945049292 2:205807831-205807853 TGGTCTCCTCTGCATCCATGTGG - Intergenic
945206520 2:207338424-207338446 TGGAGCCAGCTGAAGTCATGGGG - Intergenic
945570815 2:211465262-211465284 TGACCTCAGCTGAATGCATGAGG + Intronic
945766715 2:213989557-213989579 TGGTCTATCCTGAAGCCATGAGG - Intronic
947819793 2:233061782-233061804 TGGTCTCAGCTGCAGCCTCTGGG - Intronic
948648770 2:239425914-239425936 TGGGCACAGCTGATGCCACGGGG + Intergenic
948909883 2:240997838-240997860 TGGTCCCGGCTGAGGCCCTGAGG + Intergenic
1169253883 20:4083048-4083070 TGGTCTCAGAGGAAGCCTGGTGG - Intergenic
1169544795 20:6639262-6639284 TGGTCTCAGGTGATGCCTTGGGG + Intergenic
1170103726 20:12730558-12730580 TGGTATCAGTAGAAACCATGAGG + Intergenic
1170215724 20:13889172-13889194 TGGTCTCAGCTGACCAGATGGGG + Intronic
1171372811 20:24672638-24672660 TGGACTCAGATGAAGCCTTGGGG - Intergenic
1171517880 20:25751911-25751933 TGGACACACCTGAAGACATGGGG + Intergenic
1172489856 20:35327398-35327420 TGTTCCCTGCTGAAGACATGAGG + Intronic
1174981391 20:55399244-55399266 TGGTCTCCTCTGACACCATGGGG - Intergenic
1179078250 21:38144099-38144121 AGCACTCAGCTCAAGCCATGTGG - Intronic
1179442901 21:41407936-41407958 TGGTCTCAGCCCAAGGCCTGTGG - Intronic
1179804649 21:43829536-43829558 TGGACTCATCTGATGCCCTGGGG - Intergenic
1180088176 21:45517480-45517502 TGGTCTCTGCTGACTCCTTGGGG - Intronic
1180088190 21:45517532-45517554 TGGTCTCCACTGACTCCATGAGG - Intronic
1180088201 21:45517581-45517603 TGGTCTCTGCTGACTCCGTGAGG - Intronic
1180836766 22:18933800-18933822 TGGTCTCAGGTAGTGCCATGCGG - Intronic
1182026244 22:27121479-27121501 GGTTTTCAGCTGAAGCCATTGGG - Intergenic
1182109969 22:27716107-27716129 TTGTCTCAGCTGATGCCATGTGG - Intergenic
1182348691 22:29685774-29685796 TGGTTTCAGCAGTACCCATGGGG + Intronic
1183749939 22:39714100-39714122 AGGCCTCAGCTGAACCCCTGTGG - Intergenic
1185179852 22:49353007-49353029 GGGTCTCAACAGAAGCCATGGGG - Intergenic
1203286859 22_KI270734v1_random:159099-159121 TGGTCTCAGGTAGTGCCATGCGG - Intergenic
950123384 3:10496510-10496532 TGGCCTCAGCTGATCCCTTGGGG - Intronic
950136222 3:10582847-10582869 TGGTACCAGCTGGAGCCATGTGG - Intronic
952514696 3:34092004-34092026 TCTTCTCAGCTGAAGTCAGGTGG - Intergenic
953512335 3:43554833-43554855 TGGTCTCAGAGGAAGCCTAGTGG - Intronic
954241156 3:49294653-49294675 AGATCTGAGCTGAAGCTATGTGG + Intronic
954757596 3:52849936-52849958 TGGTCACGGCAGAAGCCACGGGG + Intronic
954829201 3:53404251-53404273 TTTTCTCACCTGAAACCATGGGG + Intergenic
955564168 3:60226088-60226110 TGGTCTCAGGGGAATCCATTTGG + Intronic
956069566 3:65433557-65433579 AGCTCTCAGCTGCAGCCCTGTGG + Intronic
956699719 3:71948281-71948303 TGGTGGGAGCTGGAGCCATGTGG + Intergenic
956803236 3:72782645-72782667 TTATCTCAGCTGAAGCCAACAGG - Intronic
956891839 3:73621637-73621659 TGGCCTCAGCTGAGGCCTTAGGG - Intronic
959323354 3:104906354-104906376 TGGTCTCAGCTGCCTCCCTGTGG + Intergenic
961414933 3:126750311-126750333 GGGTCTCAGTGGAAGCCCTGAGG - Intronic
962338305 3:134558740-134558762 TAGTATGAGCTGAAGCCAAGTGG - Intronic
966153963 3:176896081-176896103 GGGTCTATGATGAAGCCATGGGG + Intergenic
968627021 4:1630315-1630337 TGGTCTCAGCAGACACCATGGGG - Intronic
969574306 4:8027657-8027679 GGGGCTCCGGTGAAGCCATGCGG + Intronic
969576368 4:8038388-8038410 TGGTCTCAGCTCAAACCCTCTGG + Intronic
971027944 4:22606965-22606987 TGGTATCAGATCATGCCATGGGG + Intergenic
971547402 4:27903685-27903707 AGGTCTCAGCTGAATACCTGGGG - Intergenic
972501252 4:39680040-39680062 TGGTCTCCACTGACACCATGGGG + Intergenic
975168146 4:71201221-71201243 AGGCCTCAGCTGAACCCATCAGG + Intronic
975862373 4:78691240-78691262 TGCTCGGAGCTGAAGCCATGGGG + Intergenic
979159009 4:117434912-117434934 TTGTCTCAACTGAAGTCTTGAGG + Intergenic
981119014 4:141026945-141026967 TGGCCACATCTGAAGCCAAGAGG - Intronic
981178822 4:141715024-141715046 TGGACACAGCTGATGCCTTGAGG - Intronic
981586021 4:146303181-146303203 AGGTCTCAGTAGAACCCATGGGG - Intronic
982269376 4:153570831-153570853 TGTTCTCAGCAGATGCCCTGAGG + Intronic
986889641 5:12286024-12286046 TTTTCTCAGCTGAAGCCATTGGG + Intergenic
987785515 5:22493795-22493817 TGGTCTCATCTAAGGCCCTGTGG - Intronic
988978414 5:36538712-36538734 TGGACTTAGATGAGGCCATGAGG + Intergenic
990300750 5:54447110-54447132 TGCTTTCAGCTGAAGCGATATGG + Intergenic
991551592 5:67842911-67842933 TGGGCTCAGATGGAGCCATCTGG - Intergenic
992381575 5:76242564-76242586 ATGTCTCACTTGAAGCCATGAGG - Intronic
992758422 5:79930703-79930725 TGGCCTCAGCTGATACCATGGGG - Intergenic
993049433 5:82909631-82909653 TCCTCTCAGATGAAGCCCTGAGG + Intergenic
993400667 5:87446297-87446319 TGGTCTTAGCTGAAACACTGTGG + Intergenic
995738872 5:115333485-115333507 TGGTGTCAGTTGAGGCCATGTGG - Intergenic
997404457 5:133633973-133633995 TGATGTCAGTGGAAGCCATGTGG - Intergenic
998512122 5:142722349-142722371 TGATGTAATCTGAAGCCATGTGG + Intergenic
998607867 5:143653821-143653843 TGGTCTGAACTAAACCCATGTGG - Intergenic
999482823 5:151964739-151964761 TGGACTCAGATGAAACAATGAGG - Intergenic
1000107161 5:158070998-158071020 AGGGCTCAGCTGATGTCATGAGG + Intergenic
1001972573 5:175968182-175968204 CGGTCCCCGCTGCAGCCATGGGG - Exonic
1002244868 5:177875599-177875621 CGGTCCCCGCTGCAGCCATGGGG + Intergenic
1006214684 6:32430217-32430239 TGGTGTCAGTAGAGGCCATGTGG - Intergenic
1006877096 6:37307090-37307112 TTGTCTCAGCTGCTGCCATCAGG + Intronic
1007230201 6:40342905-40342927 TGGCCTCAGCTTGCGCCATGGGG - Intergenic
1009773776 6:68178623-68178645 AGGTCTCAGCTGATCCCATGAGG - Intergenic
1013116313 6:107106305-107106327 TGGTCTCAGCTGCATCCCTTGGG - Intronic
1014524898 6:122490851-122490873 TAGCCTCAGCTGAATCCATAGGG + Intronic
1015510129 6:134030267-134030289 TGGCCTCTGCTGAACACATGAGG + Intronic
1016505950 6:144779138-144779160 TGTTGTCACCTGATGCCATGTGG + Intronic
1016653059 6:146485080-146485102 TGGTCTCAGCTATGGCCTTGGGG + Intergenic
1018093212 6:160363119-160363141 GGGTCTCAGCCTAAGCCAGGTGG + Intronic
1021229132 7:18064322-18064344 AGGCCTCAGCTGACCCCATGGGG - Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1025139422 7:56449937-56449959 TGGACACATCTGAAGACATGGGG - Intergenic
1025704931 7:63854647-63854669 TGGGGTTATCTGAAGCCATGTGG + Intergenic
1027614811 7:80408887-80408909 TGACCTTAGCTAAAGCCATGTGG - Intronic
1028758777 7:94469942-94469964 TGGTCTCATGTGAAATCATGGGG - Intergenic
1029112165 7:98217982-98218004 TGCTCCCAGCTGGAGCCCTGCGG + Exonic
1029271698 7:99380863-99380885 TGGCCTCAGCTGGAGTCCTGGGG + Intronic
1031732627 7:125317065-125317087 AGGTCTCACCTGAAGCCAGCAGG - Intergenic
1032492063 7:132331211-132331233 TGCTCTCAGCTGAGCCCATTAGG - Intronic
1033817254 7:145088188-145088210 TGGAGTCATCTGAAGCCTTGAGG + Intergenic
1034272063 7:149808175-149808197 TGGTCTCAGCTGCTTCCCTGGGG + Intergenic
1035114417 7:156511119-156511141 TGGGCTCAGCAGCAGCTATGAGG + Intergenic
1036082682 8:5574669-5574691 TGGTCGGAGCTGAAGCCACCGGG + Intergenic
1036099247 8:5759105-5759127 TGAGCTCAGCTGAAGCCATATGG - Intergenic
1039574221 8:38610810-38610832 TGGTCTCCGCTGGAACCCTGGGG + Intergenic
1040548724 8:48422307-48422329 TGGTCTGAGATGGAGCCAGGAGG + Intergenic
1040655254 8:49500379-49500401 TGGTGTCAGAGGAAGCCAAGTGG - Intergenic
1041981313 8:63864514-63864536 TGGTGTCTGTGGAAGCCATGTGG - Intergenic
1042062546 8:64836889-64836911 GGGTATCAGCGGAGGCCATGTGG - Intergenic
1044712074 8:95067824-95067846 TGGTCTCCGCTGACACCATGGGG + Intronic
1045055709 8:98366724-98366746 CAGTCTCAGCTGAAGCCAGGTGG - Intergenic
1047430926 8:124790971-124790993 TGGGCTCAGCTGAAAACAAGAGG + Intergenic
1048384412 8:133898261-133898283 AGATCTCAGCTGATTCCATGGGG - Intergenic
1048536155 8:135296924-135296946 AGGTCTCAGCTGAATACTTGAGG - Intergenic
1048801648 8:138199462-138199484 AGACCTCAGCTGATGCCATGGGG + Intronic
1048896763 8:138999298-138999320 TGTTCTCATCAGAAGGCATGAGG - Intergenic
1053365220 9:37518041-37518063 TGTTCTCAGCAGAGGCCACGAGG + Intronic
1055718168 9:79141590-79141612 TGCTCCCAGCTGAAGCCAGGAGG - Intergenic
1057339029 9:94182791-94182813 TGGTCTCAGGTTATGCCCTGGGG - Intergenic
1058728136 9:107823346-107823368 TGGTCCCAGCTAAAGATATGTGG - Intergenic
1059041724 9:110822356-110822378 TGGTCACACCTGAAGCCAGCAGG - Intergenic
1059927675 9:119227686-119227708 TGGTCTCAGCAGCAGCTTTGGGG - Intronic
1060492777 9:124097213-124097235 TGATCTGTGCTGAAGCTATGGGG + Intergenic
1061647393 9:132016155-132016177 TGGCCTCACCTAAAGCCATAGGG + Intronic
1061683699 9:132258166-132258188 TGGTCTCAGCAGTACCGATGTGG + Intergenic
1062272864 9:135717767-135717789 TGGTCTCAGCAGCAGCCTGGGGG + Intronic
1185735350 X:2491653-2491675 TGGTTTAAAATGAAGCCATGTGG + Intronic
1186691783 X:11985441-11985463 GGGTCTCATCTGAAGCCAGCAGG - Intergenic
1186784879 X:12948027-12948049 TTGTCTAAGAGGAAGCCATGTGG + Intergenic
1186965924 X:14786039-14786061 TGGCCTCAGCTGAGCCCAGGTGG + Intergenic
1187837443 X:23448224-23448246 TGGTGTCAACTGAAGTCATCTGG + Intergenic
1188249564 X:27876218-27876240 TGGTATCAGCTGGAACCATCAGG - Intergenic
1188703382 X:33293970-33293992 TGGTCATAGCTGAAGAGATGTGG - Intronic
1189369898 X:40419389-40419411 TGGTCTCAGCAGATGCCACGAGG - Intergenic
1189994182 X:46623379-46623401 TTGCCTGAGCTGAAGACATGAGG - Intronic
1190176351 X:48153826-48153848 TGGTCTCTGCTGGAGACAGGTGG - Intergenic
1190571485 X:51786815-51786837 TGGCCTCTACTGAAACCATGGGG + Intergenic
1190817759 X:53943801-53943823 TGCTCTCATATGAAGCCCTGAGG - Intronic
1192214030 X:69145515-69145537 TGGCCACAGCTGTAGCCATAAGG - Intergenic
1192806521 X:74514556-74514578 TGGTCTCTACTGACACCATGGGG - Intronic
1193086951 X:77455354-77455376 GGGACTCAGCTGAAGCAATCTGG - Intronic
1194817652 X:98463997-98464019 TAGTTTCAACAGAAGCCATGTGG + Intergenic
1197103568 X:122686150-122686172 TGGTTTCCGCTGACACCATGAGG - Intergenic
1199932457 X:152537545-152537567 TGCTCTCAGCTGCAGCCCTTGGG + Intergenic
1200702520 Y:6414366-6414388 TGGTCTCGCCTGAAGCTGTGTGG + Intergenic
1201031591 Y:9750332-9750354 TGGTCTCGCCTGAAGCTGTGTGG - Intergenic