ID: 1091651642

View in Genome Browser
Species Human (GRCh38)
Location 12:2314554-2314576
Sequence AAGTACAACAAGAGGGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 369}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091651642 Original CRISPR AAGTACAACAAGAGGGGAAA TGG (reversed) Intronic
901561157 1:10072007-10072029 ATCTACAACATGAGGGGAAAAGG - Exonic
902296766 1:15472901-15472923 AAGCAAAACGAGAGGGGAAGGGG + Intronic
904360896 1:29971193-29971215 AAGAAGCACAAGAGGGGAAAAGG - Intergenic
904468042 1:30719429-30719451 AAGGACAGCAAGACGGGAGACGG - Intronic
905007808 1:34725001-34725023 AAGAGCAAGAACAGGGGAAAGGG + Intronic
905032444 1:34896263-34896285 AAGAAGAACAAGAAGGGAAGAGG + Intronic
905215545 1:36404862-36404884 GAGGACTACAAGAGGGGATATGG - Intergenic
906965961 1:50456791-50456813 AAGGGCCACAAGAGGGAAAAGGG + Intronic
907352941 1:53848433-53848455 ATCTACAACAAAAGGTGAAAAGG - Intergenic
909112443 1:71496239-71496261 AAGTACAGCAATATGGGAACAGG + Intronic
909144102 1:71907058-71907080 AAGTATAAAGAGAGGGGAAGAGG - Intronic
909308501 1:74114332-74114354 TAGTACAAAAAGTGGGGAAAGGG + Intronic
909312138 1:74165577-74165599 CAGTACAACAAGGTGAGAAAAGG - Intronic
910012270 1:82480161-82480183 AAGTAAGAAGAGAGGGGAAATGG - Intergenic
911085309 1:93972267-93972289 ACTTGCAACAATAGGGGAAAGGG + Intergenic
911909510 1:103615276-103615298 AAGCAAAACTAGATGGGAAAAGG + Intergenic
911911786 1:103646773-103646795 AAGCAAAACTAGATGGGAAAAGG + Intergenic
911916668 1:103705175-103705197 AAGCAAAACTAGATGGGAAAAGG - Intronic
911919201 1:103740911-103740933 AAGCAAAACTAGATGGGAAAAGG + Intronic
912048517 1:105491651-105491673 ATGTTCAACAAGAGGATAAATGG + Intergenic
912513759 1:110205605-110205627 TTGTACAACAATGGGGGAAACGG + Intergenic
913072021 1:115307976-115307998 AAGGACAACATTAGGGGAATTGG + Intronic
915193462 1:154171502-154171524 AAATACCACAGGAGAGGAAAAGG + Intronic
915526117 1:156477210-156477232 AGTGACAACAAGAGGGTAAAAGG + Intronic
916659583 1:166909442-166909464 AAGAACAAGAAAAGGAGAAATGG - Exonic
916683541 1:167125488-167125510 AAATACAAGAACAGGGGGAAGGG - Intronic
916866921 1:168869715-168869737 AAATTCAACACGAGGGGAGAGGG + Intergenic
918155575 1:181842832-181842854 AAGAACAAGAAGAGGGAAAGAGG - Intergenic
918959190 1:191249882-191249904 AATAACTAGAAGAGGGGAAATGG - Intergenic
918996706 1:191771360-191771382 GAGTAAAACAAAAGGGGACAGGG - Intergenic
919217474 1:194578161-194578183 AAGAACAACAAAAAAGGAAAAGG - Intergenic
919262407 1:195213914-195213936 AAGTACTACAAGAAGGGAATGGG - Intergenic
921256831 1:213349284-213349306 TAGGAAAACAAGAAGGGAAAAGG - Intergenic
921514672 1:216075374-216075396 GAGGACAACAAAAGGAGAAAGGG + Intronic
921592462 1:217020641-217020663 AAGAAGAACAAGAAGTGAAATGG + Intronic
922310820 1:224388524-224388546 AACTAAAACAGGAGGGGAGAGGG + Exonic
923440008 1:234008466-234008488 AAGGACAAAAAGAAGAGAAAAGG - Intronic
923577924 1:235177802-235177824 AACAACAAAAAGAAGGGAAAAGG - Exonic
924004905 1:239598743-239598765 AAGAATAAGAAAAGGGGAAAAGG - Intronic
924046597 1:240038288-240038310 AAGTAAAAGAAAAGGGGAATTGG - Intronic
1063755887 10:9007929-9007951 AAAAACAAGAAAAGGGGAAAGGG - Intergenic
1063971233 10:11382563-11382585 AAGTAAATCAAGGGGGAAAAAGG + Intergenic
1064360668 10:14661432-14661454 GAATAGAACAAAAGGGGAAAGGG + Intronic
1064932334 10:20641329-20641351 AAGGACAACGAGAGTAGAAAGGG + Intergenic
1065355824 10:24840517-24840539 AAGTACAGCAAGAAGGAAATCGG - Intergenic
1066153118 10:32645888-32645910 AACTAAAACAAGAGAAGAAAAGG - Intronic
1068917071 10:62444179-62444201 GAGCAGAACAAGATGGGAAATGG - Intronic
1072869664 10:99103866-99103888 AAGAACAAGAAATGGGGAAAGGG + Intronic
1073809007 10:107132143-107132165 AAGAGAAAGAAGAGGGGAAAGGG - Intronic
1073890562 10:108096453-108096475 CAGCACAGCAAGTGGGGAAAGGG + Intergenic
1074056322 10:109925486-109925508 AAAAACTTCAAGAGGGGAAAGGG - Intergenic
1074404453 10:113169083-113169105 TAGTACAGCCAGAGAGGAAAGGG - Intergenic
1074695337 10:116045472-116045494 AAATACAAAAATAGGCGAAAAGG - Intergenic
1074710124 10:116170091-116170113 AAGTCCCACCAGAGGGTAAAGGG + Intronic
1075896098 10:125995887-125995909 ATGTAACACTAGAGGGGAAATGG + Intronic
1076870882 10:133193569-133193591 AAGAACAAGAAGAAGGAAAAAGG + Intronic
1077707565 11:4502665-4502687 AGGCAGAACAAGAGGAGAAAAGG - Intergenic
1078648476 11:13164758-13164780 AAGAAGAGCAAGAGGGGAAAAGG - Intergenic
1081187420 11:40061498-40061520 AAGTAGAAAAAGAGAGCAAAAGG + Intergenic
1082079297 11:47999784-47999806 AAGGAAAACTAGGGGGGAAAAGG + Intronic
1082681791 11:56182156-56182178 AAGTACCACCAGAGTAGAAAGGG - Intergenic
1082794140 11:57368016-57368038 AAGTACTACAAAATGGAAAATGG + Exonic
1085591920 11:77771033-77771055 AAGAATAGAAAGAGGGGAAATGG - Intronic
1085760770 11:79239320-79239342 AAATACAACCAGAAGGAAAAGGG + Intronic
1086244084 11:84730255-84730277 AAGTACAAAAAAAGGGGAGGAGG + Intronic
1087049066 11:93868090-93868112 CAGTTAAACAAGAGAGGAAAAGG + Intergenic
1090522022 11:127489581-127489603 AAGAAAAAAAAGAGAGGAAAAGG - Intergenic
1090677345 11:129011986-129012008 AAAAACAACAGGTGGGGAAAGGG + Intronic
1091651642 12:2314554-2314576 AAGTACAACAAGAGGGGAAATGG - Intronic
1093842210 12:23917860-23917882 AAGTACAACATGTTGGGAAATGG + Intronic
1093875915 12:24349231-24349253 AAGTACAGACAGAGGGGAACTGG - Intergenic
1093966879 12:25337379-25337401 AAGTAAAGCAAGAGGGGGAAGGG + Intergenic
1094047651 12:26184982-26185004 AAGTATCACAAGAGAAGAAAAGG - Intronic
1094342942 12:29432991-29433013 AAGAAAAACGAGAGGGCAAAAGG + Intronic
1094589612 12:31808269-31808291 AAGGAAAACAAAGGGGGAAAGGG - Intergenic
1095511533 12:42955971-42955993 AAATTTAAAAAGAGGGGAAAAGG + Intergenic
1095993648 12:48059018-48059040 AAGTGCAACGAGAAGGAAAAAGG - Intronic
1096237790 12:49941853-49941875 AAGTAGAACCAGAGGAGAATGGG + Intergenic
1096354177 12:50926199-50926221 AAGAAAAACAAAAGGGAAAATGG + Intronic
1096771251 12:53937394-53937416 GAGAAAAATAAGAGGGGAAAGGG - Intergenic
1096884158 12:54699891-54699913 AGGTACAATTAGAGGGAAAAGGG + Intergenic
1098640361 12:72831682-72831704 AAGTTCAACAAGACAGTAAATGG - Intergenic
1100191983 12:92202797-92202819 AAATAAAACAAGAGAGAAAAGGG - Intergenic
1102584480 12:113913545-113913567 TAGAACAAACAGAGGGGAAAAGG + Intronic
1102620647 12:114191914-114191936 AAGAAAAAAAAAAGGGGAAATGG + Intergenic
1102696508 12:114803852-114803874 AGATACAGCAGGAGGGGAAAAGG - Intergenic
1103500947 12:121400867-121400889 AAGTTGAAGAAAAGGGGAAAGGG + Intronic
1105353953 13:19640782-19640804 AAGTACAAAAAAAATGGAAAAGG + Intronic
1105740945 13:23322671-23322693 TAGTACAACAAGAAGGCACATGG + Intronic
1107668663 13:42719386-42719408 ATGTAGAACAGGAAGGGAAATGG + Intergenic
1108197511 13:48009704-48009726 AAGAACAACAATAGCGAAAATGG + Intergenic
1108896836 13:55340308-55340330 AAATAAAACAAGATGTGAAAAGG - Intergenic
1111227247 13:85289807-85289829 GAGTACAACAAGGGGGAAACTGG + Intergenic
1111663409 13:91238744-91238766 AAGTACAAAAGAAGAGGAAATGG - Intergenic
1112099371 13:96170165-96170187 AAATAACACAAGAGGGGAAGAGG + Intronic
1112474804 13:99721760-99721782 AAGTACAACATGCGGGCCAATGG - Intronic
1114721635 14:24888930-24888952 AAGTACAAAAAGAGGAAAAGGGG - Intronic
1114923027 14:27358802-27358824 AAAAACAACAAATGGGGAAATGG - Intergenic
1115041465 14:28934676-28934698 AAAGACAACAAGAGAGGATAAGG - Intergenic
1115301748 14:31892969-31892991 ATGTAGAACAAGACAGGAAATGG - Intergenic
1115456050 14:33603563-33603585 AAGAGCAGCAAGAGGGAAAAAGG + Intronic
1116037611 14:39646603-39646625 GAGGACTACAAGAGGGGGAAGGG - Intergenic
1117309649 14:54509202-54509224 GAGTACAAGAAGAGGAGAAAAGG + Intergenic
1117986583 14:61392149-61392171 AAGTCCACCAAGAGGAGAATGGG - Intronic
1118864647 14:69693341-69693363 AAGAACAAGAGGAGGTGAAAGGG + Intronic
1118976857 14:70685255-70685277 GAGTAAAACAAAAGAGGAAAGGG + Intergenic
1119522500 14:75296217-75296239 AAGAACAACCAGAGGGCAAGGGG - Intergenic
1121027930 14:90630126-90630148 AAGAACTGGAAGAGGGGAAATGG - Intronic
1121939178 14:98053348-98053370 CACTGCAACAGGAGGGGAAAAGG - Intergenic
1122024879 14:98868425-98868447 AACTACTCCAGGAGGGGAAATGG + Intergenic
1122175514 14:99915495-99915517 AAGTAATACACGTGGGGAAAGGG - Intronic
1122319967 14:100849180-100849202 AAGGACAAAAAGAGGAGAGAAGG + Intergenic
1124473809 15:30012864-30012886 AAGAAAAAAAAGAGGGGACACGG - Intergenic
1125152680 15:36551067-36551089 AAGTAAAACAAGAGGTGAAATGG - Intergenic
1125171427 15:36770314-36770336 AAGCAAAAAAAAAGGGGAAAGGG + Intronic
1126729374 15:51666495-51666517 TAGTGCAAAAAGAAGGGAAAGGG + Intergenic
1126979379 15:54224997-54225019 AAGTAAAACCAGAGGTGAAAAGG - Intronic
1127303049 15:57676584-57676606 AAATACAAAAAGGGGGGAAACGG - Intronic
1127357354 15:58213224-58213246 ATGTACAAAATGAGGGGAGAGGG - Intronic
1127552959 15:60059341-60059363 AAGAAACACAAGTGGGGAAAAGG - Intronic
1128842695 15:70863041-70863063 TGGTGCAACTAGAGGGGAAAAGG + Intronic
1129626424 15:77204944-77204966 AAGTTCAAAAAAAGGGAAAAGGG + Intronic
1131255006 15:90856228-90856250 AATTAGCACAAGAGGTGAAATGG - Intergenic
1131258256 15:90875557-90875579 GAGAGGAACAAGAGGGGAAAAGG - Intronic
1132471787 16:108323-108345 CAGTATAACAAGTGGGGAATGGG - Intronic
1135592840 16:23717036-23717058 AAGGAGAACAAGAAGGGACAGGG + Intergenic
1135938204 16:26798744-26798766 CAGAACAACAAGAGGGGCACTGG + Intergenic
1138122506 16:54411840-54411862 AAAGACAACAGGAGGGGAGAGGG - Intergenic
1138847776 16:60587585-60587607 ATATAAAACAAGAGGGAAAAGGG - Intergenic
1139898730 16:70309921-70309943 AAGTCCAAGAACAGGCGAAAGGG - Intronic
1140702047 16:77589781-77589803 GGGTAAATCAAGAGGGGAAAAGG + Intergenic
1140973401 16:80035623-80035645 AAGTCAAACAAGAGGGAAAGAGG + Intergenic
1141022600 16:80511467-80511489 ATGTACATGAACAGGGGAAAGGG + Intergenic
1143977080 17:10837807-10837829 ATGAACAACAAGCGGAGAAAAGG - Intronic
1146253606 17:31374227-31374249 CATTACAACATGGGGGGAAAGGG - Exonic
1146992468 17:37287429-37287451 GAGTATAACAAGAAGGGACAAGG + Intronic
1147807892 17:43145101-43145123 AAGTGCAAAAAAAGGGAAAAGGG + Intergenic
1148663265 17:49354291-49354313 AAAGAGAAAAAGAGGGGAAAAGG + Intronic
1148927857 17:51103319-51103341 AAGTGCTACAAGAGGGCAAGAGG + Intronic
1150659740 17:67064925-67064947 AAGGAAAACAAAGGGGGAAATGG - Intergenic
1151244488 17:72783961-72783983 AAGTAGAAGCAGATGGGAAAGGG + Intronic
1151271549 17:73000228-73000250 AAGGAGAAGAAGAGGGGAATGGG - Intronic
1152669242 17:81592064-81592086 GAGTACAACGAAAGGGGAAAGGG + Intronic
1153016932 18:591314-591336 AAATACAAGAAGAGGGGCCAAGG - Intergenic
1153547796 18:6226575-6226597 AAAGACAACAAGAGGAGAAATGG + Intronic
1153573472 18:6496733-6496755 AAATACAGAAAGAGGGGAAAAGG - Intergenic
1153959236 18:10126666-10126688 AAGCACAAAAAGAAGGGAAAAGG - Intergenic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1154937882 18:21079257-21079279 AAGGAAAAAAAGAGGAGAAAAGG - Intronic
1155982763 18:32197889-32197911 GGGGACTACAAGAGGGGAAAGGG - Intronic
1157651570 18:49337844-49337866 AAGAACAAGAAGAAGGGGAAGGG + Intronic
1157982240 18:52395002-52395024 AAGTAAAATAAACGGGGAAATGG + Intronic
1158031039 18:52965362-52965384 AACTACCACAAAAGGGTAAAAGG + Intronic
1160114353 18:76063805-76063827 AAGGGAAACTAGAGGGGAAAAGG - Intergenic
1164242211 19:23399548-23399570 AAGGAAAACAAAAGGGGAAGGGG + Intergenic
1166387576 19:42390713-42390735 AATAACAAGAAGAGGGGAGATGG + Intergenic
1167940372 19:52941802-52941824 AAGAAAAACAGGAGGAGAAAAGG - Intronic
1168092170 19:54093217-54093239 AAATAAAAAAAGAGGGAAAAAGG + Intergenic
1168477359 19:56686230-56686252 AAGGACAACAGGTGGGGAGAAGG + Intergenic
926834460 2:17002521-17002543 AATTACAAAAAGAGGTGAAAAGG - Intergenic
926858220 2:17280583-17280605 AAGTAGAATAAGAAGGGAAGTGG - Intergenic
927016050 2:18962585-18962607 AGATACAGCAAGAGAGGAAAAGG + Intergenic
927050987 2:19328986-19329008 AAATATAAGAAGAGGGGAATGGG + Intergenic
928299458 2:30112548-30112570 AAGAACACCAAGAGGGCAACTGG + Intergenic
928460716 2:31469900-31469922 AGGCACAATAAGAGGGGATATGG + Intergenic
929163969 2:38862059-38862081 AAGTACACAAAGAGGGGTAGTGG + Intronic
929861242 2:45679672-45679694 ACTTACAAGAAGAGGGGATATGG + Intronic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930678440 2:54230172-54230194 AAGGAAAACAAAAGGGGAAGGGG - Intronic
932128686 2:69168218-69168240 AAATACAACAAGAAAGGGAAAGG + Intronic
932320046 2:70815343-70815365 CAGAACAAAAAGAAGGGAAAAGG - Intronic
932450026 2:71803590-71803612 AAGCAAAACAGCAGGGGAAAGGG - Intergenic
932911608 2:75811949-75811971 AGGTACAAAAAAAGGAGAAAAGG - Intergenic
934558008 2:95297554-95297576 AAGTGGAACAAGAGGGGACAAGG - Intronic
935205341 2:100892000-100892022 AAAATCAGCAAGAGGGGAAAAGG - Intronic
935818391 2:106869255-106869277 AGGTACAACCAATGGGGAAAGGG + Intronic
936363104 2:111825130-111825152 AAGTAGAACAAGAGGAAAACAGG - Exonic
936963446 2:118101096-118101118 AAGTACAAGAAGAGGAAAAGAGG + Intronic
938580103 2:132638052-132638074 ATGTACAGAAAGAGGAGAAATGG + Intronic
939069459 2:137521518-137521540 GAGTCCAACAAGAAGAGAAAGGG - Intronic
939700019 2:145379478-145379500 AAATACAACCAAAAGGGAAAAGG - Intergenic
939708761 2:145488568-145488590 AAAAACAAAAAGTGGGGAAAGGG + Intergenic
939722049 2:145666026-145666048 AAGGAAAACAAAAAGGGAAAGGG - Intergenic
939782882 2:146471306-146471328 AAGTACAAATTGAGGAGAAATGG + Intergenic
939832201 2:147086418-147086440 AAGTACAAAAATATGGAAAAGGG - Intergenic
939940389 2:148342929-148342951 AGGGACTACTAGAGGGGAAAGGG - Intronic
942569118 2:177295478-177295500 AAAGAGAAAAAGAGGGGAAAGGG - Intronic
943702895 2:191005728-191005750 TACTTCAACAAGGGGGGAAATGG + Intronic
945051625 2:205829304-205829326 AACTAGAAAAAGAGAGGAAATGG - Intergenic
945340329 2:208644887-208644909 TAATTCAACAAGTGGGGAAATGG + Intronic
945605382 2:211923595-211923617 AGGTTCAAGTAGAGGGGAAAAGG + Intronic
945886809 2:215384642-215384664 TACTACAACTAGAGGGGGAACGG - Intronic
946739690 2:222789579-222789601 AAGTAGAAGAAGAGAGCAAAAGG + Intergenic
946778827 2:223172044-223172066 AAGTAAAACTAAAGGTGAAATGG - Intronic
946783698 2:223220137-223220159 GAGTACTGCAAGAGGGGAAGTGG + Intergenic
947685030 2:232076144-232076166 ATATACAACAAGAGGGAGAAAGG - Intronic
1169175542 20:3509060-3509082 AGGTAAAACAAGATAGGAAAAGG + Intronic
1169489259 20:6057302-6057324 AAGTGCTAGAAGAGGAGAAAAGG - Intergenic
1169655244 20:7915359-7915381 AAGGAGAAGAAGAAGGGAAAGGG + Intronic
1169660467 20:7973175-7973197 AAAAACAAAAAGAGGGGAAGTGG + Intergenic
1169960808 20:11157935-11157957 AAGTTCAATAAGAAAGGAAAGGG + Intergenic
1171104409 20:22418850-22418872 AGGTATGAAAAGAGGGGAAAAGG + Intergenic
1172647657 20:36481288-36481310 CACTACAATCAGAGGGGAAAAGG - Intronic
1174684338 20:52439086-52439108 AATTGCATAAAGAGGGGAAATGG - Intergenic
1176788531 21:13289796-13289818 AAATTCAAGGAGAGGGGAAATGG - Intergenic
1177537989 21:22454110-22454132 AAGTACATCAAGTAGGGAATAGG + Intergenic
1177958165 21:27626336-27626358 AATTAGAACAAGACGGTAAAGGG - Intergenic
1178040569 21:28636231-28636253 AAGTACAACAAGTAGGCAAAAGG - Intergenic
1179001008 21:37458150-37458172 AAGTACAAAAAGAGGGGGAATGG - Intronic
1179173361 21:38990200-38990222 AAGTAGAAGGAGAAGGGAAAAGG + Intergenic
1179264758 21:39793624-39793646 AAGTCCAAAAAGGGGGAAAATGG - Intronic
1184177236 22:42795267-42795289 AAGAACAAGGAGAGGAGAAAGGG - Intergenic
949210853 3:1499262-1499284 AAATAATAAAAGAGGGGAAAAGG + Intergenic
949750674 3:7349196-7349218 AACTACAACGAGGAGGGAAAAGG - Intronic
950185695 3:10944207-10944229 AAGTACAACAAAAAGGTGAAGGG - Intergenic
950235445 3:11316053-11316075 AAATACATCAGGAGGGAAAACGG - Intronic
950961717 3:17114969-17114991 AAGTCCACCAAGAGGTGAAAGGG + Intergenic
951064288 3:18246407-18246429 AAGCAGAACAAGAGAGGAGATGG - Intronic
951412263 3:22379482-22379504 AAGGACAAAAGGAGGGGAGAGGG + Intergenic
951584093 3:24197520-24197542 GAGTCCAATAAGAGGGAAAAGGG - Intronic
951942708 3:28098060-28098082 TAGCACAAAAAAAGGGGAAAGGG - Intergenic
952038941 3:29238379-29238401 AAGTACAAGATGAGAGAAAATGG + Intergenic
952063669 3:29541617-29541639 AAGAAAAAGAAGAGGGGCAAGGG - Intronic
952179158 3:30899670-30899692 AAGTAAAAGGAAAGGGGAAAGGG + Intergenic
952478726 3:33737594-33737616 AGGGAAAAGAAGAGGGGAAAGGG - Intergenic
952635920 3:35530776-35530798 AAGCACAAGAAGAGAGGAATTGG + Intergenic
953193102 3:40708058-40708080 GGGTACTACTAGAGGGGAAAGGG + Intergenic
953727611 3:45414058-45414080 AAGTGCAACTACAGGGTAAAAGG - Intronic
955055570 3:55452486-55452508 TCGAACAAAAAGAGGGGAAATGG + Intergenic
956301345 3:67775567-67775589 AAGGACAGGGAGAGGGGAAAGGG - Intergenic
957170943 3:76735774-76735796 AAGAAAAAAAAAAGGGGAAAGGG + Intronic
957306301 3:78462664-78462686 AAATAAAAAAAGAGGGGAGAGGG + Intergenic
957633741 3:82754324-82754346 AAGTACAAGAAAAGAGAAAAAGG - Intergenic
957756322 3:84492774-84492796 AAGTAGAAAAAGAGGGAACATGG + Intergenic
958658908 3:97040792-97040814 TAGTAAAAGAAGAGGGCAAATGG - Intronic
958756506 3:98255912-98255934 AAGTACAATCATAGAGGAAAAGG - Intergenic
958925338 3:100151039-100151061 AAGGAGAGCAAGAAGGGAAAGGG - Intronic
959105626 3:102061870-102061892 AAGTACAATATGAGGGTCAAAGG - Intergenic
960254634 3:115499007-115499029 AAGTACAACAAGAGCTGAAAAGG + Intergenic
960462599 3:117954896-117954918 AAGTGAAACTTGAGGGGAAAGGG + Intergenic
960558841 3:119059591-119059613 CAGTACAACTAGAAGGGAAAGGG + Intronic
961419897 3:126794741-126794763 AAGTCCAACAATAGCAGAAAGGG - Intronic
962645548 3:137435390-137435412 AAAAACAAGAAGTGGGGAAAGGG + Intergenic
962979660 3:140476481-140476503 ACGTACTCCAAGAGGGTAAAAGG + Intronic
963182474 3:142373305-142373327 AAGTATAACAATATAGGAAATGG + Intronic
963182854 3:142378587-142378609 AAGTATAACAATATAGGAAATGG + Intronic
963649788 3:147964059-147964081 AAGTACATTAAAAGGGGAGAAGG - Intergenic
964150109 3:153514014-153514036 CAGAAAAACAAGAGGGCAAAAGG + Intergenic
966507286 3:180720382-180720404 AAGTATAAAAGGAGGGGGAAAGG - Intronic
966708576 3:182946656-182946678 AAGTACATCAAGAAGTAAAAAGG + Intronic
966973308 3:185065077-185065099 AAGTGCCACAAGATGGGACAGGG - Intergenic
968138392 3:196236017-196236039 AAGCTCACCAAAAGGGGAAAGGG + Exonic
970910818 4:21273115-21273137 TAGTACATCAAAAGTGGAAAAGG + Intronic
971110302 4:23577721-23577743 ATGTATAAATAGAGGGGAAAAGG - Intergenic
971302837 4:25456124-25456146 AAGGACAACAAGAGTGCAAGGGG - Intergenic
971873031 4:32268999-32269021 AAGTAGAAGTAGAGAGGAAAAGG - Intergenic
973649823 4:52987353-52987375 AACTACAACAAAAGAAGAAAGGG - Intronic
974824225 4:67105794-67105816 ATTTACAACAAGAAGAGAAAAGG - Intergenic
976732217 4:88274502-88274524 GGGTTCAAGAAGAGGGGAAAGGG + Intronic
977191006 4:94000740-94000762 AGGGACTACTAGAGGGGAAAGGG - Intergenic
977929041 4:102731893-102731915 AAGTGTAAAAAGAGTGGAAAGGG - Intronic
977984183 4:103362134-103362156 AAGGACAGAAAGAGGGCAAAAGG - Intergenic
978174511 4:105712826-105712848 AAGTAGAACACGAAGGGAAGGGG + Intronic
979806567 4:124980164-124980186 AAAAATAAAAAGAGGGGAAAGGG + Intergenic
980294245 4:130889783-130889805 AAGTACAATAAGTGTGAAAAGGG - Intergenic
983040577 4:162920787-162920809 AAGACTAATAAGAGGGGAAAAGG + Intergenic
984393247 4:179165919-179165941 AAGGAAAACAAAAGGGGAAGCGG - Intergenic
984519579 4:180785777-180785799 AAGCAGAAAATGAGGGGAAATGG - Intergenic
985374523 4:189321228-189321250 AAATAAAACCAGAGGGAAAAAGG - Intergenic
985531325 5:435390-435412 AAATACAACACGCGGAGAAAGGG + Exonic
985796052 5:1962899-1962921 AAGTAAAACAAACAGGGAAATGG + Intergenic
987173903 5:15287156-15287178 GAGTAGGACAAGAGGGGAAACGG + Intergenic
987704393 5:21444679-21444701 AAGTTGTACTAGAGGGGAAAGGG - Intergenic
988148763 5:27347743-27347765 AAGTTCAACAAAATGGAAAATGG + Intergenic
988196565 5:28012806-28012828 CAGTGCAAAAAGAGGGGAATTGG - Intergenic
990247980 5:53882249-53882271 AAGTACAGCAAGAAAGGGAAGGG + Intergenic
991083704 5:62628309-62628331 CAGTACATAAAAAGGGGAAAAGG + Intronic
991159406 5:63479347-63479369 GAGTCCAAGAAGAAGGGAAAGGG + Intergenic
993041454 5:82819350-82819372 ATGTACAACAAGAAGAGACAAGG - Intergenic
993130168 5:83886838-83886860 AAGTACATAAAGAAGGGAGAAGG + Intergenic
994011283 5:94905904-94905926 AACTACAACATGAGGGGATGAGG + Intronic
994271202 5:97779064-97779086 AAGAACTACTAGAGGGGGAATGG + Intergenic
995150342 5:108836797-108836819 AAGATAAAGAAGAGGGGAAAAGG - Intronic
995269031 5:110199988-110200010 GAGTATAAAAAAAGGGGAAAAGG - Intergenic
996318528 5:122188399-122188421 AAGTAGAAGAAGAAGGCAAAGGG + Intergenic
997083657 5:130770605-130770627 AAGTTAAAAAAGAGTGGAAATGG + Intergenic
997650918 5:135519675-135519697 TGGTAAAAGAAGAGGGGAAAAGG - Intergenic
998230339 5:140357627-140357649 AAGAACAACAGGATGGGGAAGGG - Intergenic
998561917 5:143179915-143179937 AAGTAAAACAAGGCGTGAAAGGG - Intronic
999522072 5:152361053-152361075 TAGAACAAAAAGATGGGAAAAGG + Intergenic
1000316597 5:160098280-160098302 AACTACAATAAGGGGGAAAAAGG + Intronic
1001462204 5:171925917-171925939 AAGAACAATGATAGGGGAAAAGG + Intronic
1001953907 5:175834975-175834997 AGGGACAACAGGAGGGGCAAAGG + Intronic
1003482796 6:6548487-6548509 AAGTACAATAAAAAGGCAAAAGG + Intergenic
1004654299 6:17643617-17643639 ATGCTCAAAAAGAGGGGAAAAGG + Intronic
1005398299 6:25406267-25406289 AGGTAAAGCAAGAGGGGGAAGGG + Intronic
1005568053 6:27116224-27116246 AAATACAACAACATGGGATACGG - Intergenic
1006856430 6:37136988-37137010 AAGGACAACGGGAGGGAAAATGG - Intergenic
1007107396 6:39293216-39293238 AATTAAAACAAGAGAAGAAAAGG - Intergenic
1008757759 6:54818018-54818040 AAGGTGAACAAGAGGGGGAAAGG - Intergenic
1009515051 6:64604795-64604817 AGGTGCAATAAGAAGGGAAATGG + Intronic
1010073309 6:71770215-71770237 AAGTAGAACAAAAGGGCAAAGGG - Intergenic
1010979303 6:82352488-82352510 AAATAACACAATAGGGGAAATGG + Intergenic
1011465713 6:87654670-87654692 AAGTACATAAATAGGGTAAAAGG + Intronic
1011789974 6:90887518-90887540 AAGAGCAACAAGAGTGTAAATGG - Intergenic
1011815039 6:91179529-91179551 AAGTACAACATGATGGTAGAGGG - Intergenic
1012130780 6:95489547-95489569 AAGTAGAGAAAGAAGGGAAAAGG + Intergenic
1012729532 6:102864111-102864133 AAGTACTACTAGAGGGGAGAAGG + Intergenic
1014039288 6:116806301-116806323 AATTAAAACAAGGGAGGAAATGG + Intronic
1014153611 6:118086781-118086803 AAGTACAAAATGAGGAGAGAAGG - Intronic
1014483641 6:121971418-121971440 AGGTAAAACAAGAGGCCAAATGG - Intergenic
1015230117 6:130905283-130905305 AAGTAAAACTATGGGGGAAAGGG + Intronic
1015574091 6:134652394-134652416 AAGTACAAAAAGAGGCTTAAGGG + Intergenic
1017233594 6:152097742-152097764 CAGGAAAACAAGGGGGGAAATGG - Intronic
1017431097 6:154371549-154371571 AACTAGAACAAGAGCAGAAATGG - Intronic
1018360978 6:163067599-163067621 AAATACAACAAGAGGACAAAAGG + Intronic
1018423359 6:163659301-163659323 AAGTACAAAAAAAGGGGAGAGGG - Intergenic
1019267836 7:128748-128770 GAGTGCAGCAAGATGGGAAAGGG + Intergenic
1019369530 7:653753-653775 AAGCACAACAAGAGGCCAAATGG + Intronic
1019624859 7:2010982-2011004 AAGAAAATCAAGAAGGGAAAAGG + Intronic
1020463769 7:8453140-8453162 AAGTAGAAGGAGAGGGGGAAAGG + Intronic
1020514526 7:9100145-9100167 AAGTGCTGGAAGAGGGGAAAAGG - Intergenic
1021328147 7:19300186-19300208 GAGTAGAACAAATGGGGAAAGGG - Intergenic
1023836218 7:44069333-44069355 AACTAGAACATGAGGGGAGAAGG + Intronic
1025802736 7:64802407-64802429 AAGGAAAACAAAAGAGGAAAGGG + Intronic
1026216856 7:68357192-68357214 AAGTGGAACAAGAGGAGAACAGG + Intergenic
1026384834 7:69836139-69836161 AAGTCCAAAAAGAAGGGCAAAGG - Intronic
1026605692 7:71814045-71814067 AAGTACAAGAATAGTGGAAAAGG + Intronic
1026630979 7:72038009-72038031 AACTTCAACCAGAGGGGAAGGGG + Intronic
1027648177 7:80831238-80831260 AAGTACATCTAGAAGTGAAATGG - Intronic
1028041768 7:86062617-86062639 TTGTAAAACAAGAGGCGAAATGG + Intergenic
1028635813 7:92988098-92988120 AAATACAACAGTAAGGGAAAAGG - Intergenic
1029320980 7:99759812-99759834 AAGAACAAAATGAGGAGAAAGGG + Intronic
1030978655 7:116159879-116159901 AAGTAGAAAAAGAGGAGAAGTGG - Intronic
1031235781 7:119174465-119174487 AAGTACAATAAGAAGAGAAAGGG + Intergenic
1032307126 7:130745244-130745266 AAGAAAAGCAAGAGGAGAAAAGG + Intergenic
1032347390 7:131129058-131129080 AAGAACAACAAAAGGCAAAAAGG + Intronic
1033863305 7:145657329-145657351 AAGTAAAATATGAGGTGAAATGG + Intergenic
1034376095 7:150645857-150645879 AAGGAGAAAAAGAGAGGAAAGGG - Intergenic
1034465106 7:151223358-151223380 GAGTACAAAAAGGGTGGAAAGGG + Intronic
1035057811 7:156047946-156047968 ACGGACAGCAGGAGGGGAAAGGG + Intergenic
1035420011 7:158719713-158719735 ATGACCAACAGGAGGGGAAAGGG + Intergenic
1036283934 8:7426809-7426831 TAGTACAAAGAGAGGAGAAAAGG - Intergenic
1036337541 8:7884721-7884743 TAGTACAAAGAGAGGAGAAAAGG + Intergenic
1037400127 8:18487134-18487156 AACAACAACAAAAGGAGAAATGG - Intergenic
1038164643 8:25073604-25073626 AAATAGAACAAGAGGAGCAAAGG + Intergenic
1038493607 8:27986743-27986765 GAGCAAAACAAGAGAGGAAAAGG + Intronic
1038549937 8:28458521-28458543 AAGAAGAAGAAGAGGAGAAAAGG - Intronic
1040581390 8:48701486-48701508 AAGTACGACAATAGGGTAACAGG + Intergenic
1040604596 8:48919321-48919343 TAGTACAGAAAGAGGGAAAAGGG - Intronic
1040909181 8:52501209-52501231 AAGGACAAAGAGAGGGGGAATGG + Intergenic
1041032351 8:53750296-53750318 ATGTAAAACAAGAGTGAAAAGGG + Intronic
1041179978 8:55237003-55237025 AAGCACAACCAGAGGGGACATGG - Intronic
1041873793 8:62664640-62664662 AAATACAGGAAAAGGGGAAATGG - Intronic
1042316114 8:67427723-67427745 AACTACTACAAGGGTGGAAACGG - Intronic
1043099800 8:76028950-76028972 AAGTTCACAAAGAAGGGAAATGG - Intergenic
1044011823 8:87003717-87003739 AATTACAACAAGAAGGACAAAGG + Intronic
1044295614 8:90523734-90523756 AAATAAAGCAAGAGGGAAAAAGG + Intergenic
1044370093 8:91400117-91400139 TAGTAAAATATGAGGGGAAAGGG - Intergenic
1044561196 8:93613831-93613853 TTGAAAAACAAGAGGGGAAAAGG + Intergenic
1047991539 8:130291578-130291600 AGGGAAAAGAAGAGGGGAAAAGG + Intronic
1048413732 8:134203143-134203165 AAGTTCACCAGGAAGGGAAAGGG + Intergenic
1049056313 8:140239971-140239993 GAGTACAATAAGGGGGGAAGGGG + Intronic
1050825428 9:9939585-9939607 AGGTACAACAAGAGGTAAATGGG - Intronic
1051694167 9:19750591-19750613 GAGTACACCAAAAGGGAAAATGG - Intronic
1051904364 9:22078335-22078357 AAGCACAGGAAGAGGGAAAATGG - Intergenic
1052164425 9:25306870-25306892 TAGTACAAAAAAAGAGGAAATGG + Intergenic
1053367554 9:37534233-37534255 AAGTAGAACAAGAGTATAAATGG + Intronic
1055510605 9:76992340-76992362 AAGAACAACAATAGAAGAAAAGG + Intergenic
1056739708 9:89243857-89243879 ATGTACAATAAGAGGCAAAATGG - Intergenic
1058413454 9:104760836-104760858 AATTACAAGAAGTGGGCAAAGGG - Intergenic
1059396255 9:114035817-114035839 AAGGAAAACAAGAAGGAAAAGGG - Intronic
1059760872 9:117336378-117336400 AAGTTCTTCAAGAGGTGAAAAGG + Intronic
1059788350 9:117611805-117611827 AGGTACAAGAAGAGAAGAAATGG - Intergenic
1059839846 9:118201867-118201889 AAGCACAAGAAATGGGGAAATGG - Intergenic
1061794723 9:133079574-133079596 AGTTACAAAAAGAGGAGAAAAGG - Intronic
1062704820 9:137932231-137932253 AAGAACAGCAAGAGTAGAAACGG - Intronic
1185801869 X:3018547-3018569 AAGGAAAAAAAGAGGAGAAAAGG - Exonic
1186163289 X:6800929-6800951 AAGAACTGCCAGAGGGGAAAAGG + Intergenic
1186570713 X:10712344-10712366 ATGTACAATAAGAGGCAAAATGG + Intronic
1186800309 X:13085936-13085958 AAGCCCAAGAAGAGGAGAAAAGG - Intergenic
1187549443 X:20286964-20286986 AAATACAAAAACAGGGAAAATGG - Intergenic
1188080197 X:25829368-25829390 AAATACTCCAAGTGGGGAAAAGG - Intergenic
1188266566 X:28083537-28083559 AATAACTACAAGAGTGGAAATGG + Intergenic
1188390269 X:29611138-29611160 AAGGAAAACAAAGGGGGAAAGGG - Intronic
1190371936 X:49751025-49751047 AAGGAAAACAAAGGGGGAAAGGG + Intergenic
1190725447 X:53187509-53187531 TGGTTCAAAAAGAGGGGAAATGG - Intergenic
1191930730 X:66368452-66368474 TAGTACAACCAGAGAAGAAATGG - Intergenic
1192409411 X:70919809-70919831 AAGAACACAAAAAGGGGAAAGGG - Intergenic
1193142497 X:78042646-78042668 AACTTCAAGAGGAGGGGAAACGG + Exonic
1193429070 X:81377946-81377968 AAGTACAACAAGAGAGGGGATGG - Intergenic
1193928138 X:87516389-87516411 TACAAAAACAAGAGGGGAAAGGG + Intergenic
1194189987 X:90823311-90823333 AACTACTACAAGAGGGAAAAAGG - Intergenic
1194769648 X:97886049-97886071 AAGGAGAAATAGAGGGGAAAAGG + Intergenic
1195081965 X:101379742-101379764 ATGTTCAGCAAGAGAGGAAATGG + Intronic
1196026105 X:111042861-111042883 AATCAGAACATGAGGGGAAAGGG - Intronic
1196295726 X:113994610-113994632 AAGAAAAACAAGCGGAGAAAGGG - Intergenic
1196392388 X:115221836-115221858 ATGTAGAAGATGAGGGGAAAGGG + Intronic
1197021012 X:121688768-121688790 AAATCCAAAAAGAGGGGAATCGG - Intergenic
1200206526 X:154320398-154320420 AAGTAGCACAAGAGGGGAGGAGG + Intronic
1200536586 Y:4405428-4405450 TACTACTACAAGAGGGAAAAAGG - Intergenic
1200879875 Y:8201869-8201891 CATGACAACAAAAGGGGAAAGGG - Intergenic
1201585516 Y:15556149-15556171 AGGTAAACAAAGAGGGGAAAAGG + Intergenic