ID: 1091654217

View in Genome Browser
Species Human (GRCh38)
Location 12:2333503-2333525
Sequence CCTTCCCCTTAGGCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091654217_1091654221 0 Left 1091654217 12:2333503-2333525 CCCACAGTGGCCTAAGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1091654221 12:2333526-2333548 CAAACTGTATGCCTGTGCATAGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091654217 Original CRISPR CCTTCCCCTTAGGCCACTGT GGG (reversed) Intronic
900163801 1:1236787-1236809 CTTTCCCCTCAGCCCACAGTGGG - Intergenic
900868507 1:5285594-5285616 CCTTCCCCTACAGCCACTCTTGG - Intergenic
901377110 1:8847426-8847448 GCTTCCCCTTAGGGCAGAGTAGG + Intergenic
902079163 1:13809357-13809379 CCTTCCTCTTCTACCACTGTCGG - Intronic
902114777 1:14112413-14112435 CACTCCTCTTTGGCCACTGTGGG + Intergenic
902736313 1:18403612-18403634 CCTTCCCCCCAGGCCACACTGGG - Intergenic
903660980 1:24978462-24978484 CCTTCCCCTTCGCCCCCTGAAGG - Intergenic
904080931 1:27872389-27872411 CCTTCCCCATAGGGTACTGCAGG + Intergenic
904757131 1:32774123-32774145 GCTTCCCCATTGGCCCCTGTGGG + Exonic
905377673 1:37534787-37534809 CCCTCCCCTAAGTCCTCTGTGGG - Exonic
905888505 1:41504845-41504867 CCCTCCTTTTAGGCCACTGTGGG + Intergenic
906815307 1:48872838-48872860 CCTTCCTGTTAGGCCCCTGGGGG - Intronic
907857004 1:58313417-58313439 CCATCCCTTTAGGCCATTGTGGG - Intronic
911674518 1:100644211-100644233 CCTTTTCCATTGGCCACTGTAGG - Intergenic
918026390 1:180753082-180753104 TCTGCCCCTTAGTCAACTGTTGG + Intronic
918050484 1:180968798-180968820 CATTCCCCTGAAGCCACAGTTGG - Intergenic
919424863 1:197417450-197417472 TCTTCCCAATAGGCCTCTGTTGG + Intronic
920682160 1:208081506-208081528 TCTACTACTTAGGCCACTGTAGG - Intronic
920961292 1:210666362-210666384 TCTTCCCCTGAGGCCTCTGTGGG - Intronic
921682456 1:218050586-218050608 CCATCCCTAGAGGCCACTGTGGG - Intergenic
922168331 1:223134295-223134317 CCTTCCCTTTAGAACACTGAAGG + Intronic
923338240 1:232987770-232987792 CCTTCAGCCTAGGCCACGGTGGG - Intronic
924442393 1:244096967-244096989 CCTCCTCCTTGTGCCACTGTTGG - Intergenic
924849762 1:247815226-247815248 CCTTCTCCTTATCCTACTGTGGG - Exonic
1066787428 10:39020715-39020737 TTTTCCCCTTAGGCCTCAGTGGG + Intergenic
1066796734 10:39130376-39130398 TCTTCCCCTTAGGCCTCAATGGG - Intergenic
1068529310 10:58166687-58166709 GCTTTTCCTTAGGCCTCTGTAGG - Intergenic
1068887380 10:62111360-62111382 TTTTCTCCTTTGGCCACTGTGGG - Intergenic
1070427513 10:76304033-76304055 CCTTCCCCTTTGGTCCCTGGAGG + Intronic
1070537058 10:77387031-77387053 CCTTCCCCTCAGCCCACTCCCGG - Intronic
1071857714 10:89643808-89643830 CCTTCCCCACAGGACGCTGTGGG - Intronic
1073043875 10:100624763-100624785 CCTGGGCCTCAGGCCACTGTCGG - Intergenic
1076679407 10:132163886-132163908 CCTTTGCCTCAGGGCACTGTGGG + Intronic
1076995816 11:297062-297084 CCTTGTCCTTGGTCCACTGTGGG + Intergenic
1079391456 11:20025411-20025433 GCTTACCCTTGGGCCACTGCTGG - Intronic
1080081332 11:28221974-28221996 CCTTCCAGTTAGGCTACTGAGGG + Intronic
1080930734 11:36807347-36807369 CCTTCTCCTTTGCCCTCTGTGGG + Intergenic
1081590613 11:44420439-44420461 CCTTCCCCTTACTCCAGTGGAGG + Intergenic
1083096664 11:60257943-60257965 CCATCTCCTTAGGCCCCTCTAGG + Intergenic
1085308280 11:75500697-75500719 AGTTCCCATTTGGCCACTGTGGG - Intronic
1085689296 11:78652417-78652439 CCTTCCACCCAGGCCCCTGTGGG - Intergenic
1088452885 11:110001071-110001093 CCTTATCCCTGGGCCACTGTCGG - Intergenic
1089088745 11:115848107-115848129 CTTTCTCCTTGGCCCACTGTAGG - Intergenic
1091654217 12:2333503-2333525 CCTTCCCCTTAGGCCACTGTGGG - Intronic
1091771026 12:3151482-3151504 CCTTCACATTTGGCCCCTGTCGG + Intronic
1094579916 12:31725088-31725110 CCTTACCCATTCGCCACTGTGGG - Intronic
1096104539 12:48989171-48989193 CCTTCCCTGTATCCCACTGTTGG + Intergenic
1097247196 12:57613053-57613075 CCATCTCCTCAGGCCACTGACGG - Exonic
1097599010 12:61669139-61669161 GCTTCCCCTTAGCCCTCTGAAGG + Intergenic
1098158998 12:67629985-67630007 CCTTCCCCTTCTGCCACGATTGG - Intergenic
1102031774 12:109743905-109743927 CCTTCCCATGAGGCCACAGATGG + Intronic
1103089645 12:118088636-118088658 CCCTCCCCGCTGGCCACTGTCGG + Intronic
1105514274 13:21076207-21076229 GCTTCCCCATAGGCCAGTGCTGG + Intergenic
1107837552 13:44423784-44423806 CCTTGCCCTTACCCCACTGCTGG + Intergenic
1108500588 13:51066463-51066485 ACTTCCCATTATGACACTGTAGG - Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1114063772 14:19042787-19042809 CTTTCCCCTTAGGCCTCAATGGG - Intergenic
1114098486 14:19357209-19357231 CTTTCCCCTTAGGCCTCAATGGG + Intergenic
1118712809 14:68536465-68536487 CCTTCCATTTAGACCAATGTAGG - Intronic
1121087762 14:91159644-91159666 CCTTCCCCTAACCCCACTCTAGG - Intronic
1121954817 14:98204352-98204374 CCTTCCACTCTGGCCCCTGTAGG - Intergenic
1122929629 14:104927387-104927409 CCTTCCCTTTATGCCCCTGCTGG + Intronic
1123060543 14:105592341-105592363 CCTGCCCCATGGGCCACTGGGGG + Intergenic
1126119853 15:45241836-45241858 CCTTCCCCTAAAGGCACAGTAGG + Intergenic
1126405067 15:48315181-48315203 CCTTTCACTCAGCCCACTGTCGG + Intergenic
1127287145 15:57541995-57542017 CCTTCCCCGTTGCCCACTCTGGG + Intronic
1129348729 15:74941123-74941145 CGTTGCCCTTTGGCCAGTGTAGG - Intergenic
1135042874 16:19131299-19131321 CCTTTCCATTAGGCCACTGGGGG + Intronic
1135268662 16:21050008-21050030 TCTTCCCCATAGGACACTGATGG - Exonic
1138147770 16:54627696-54627718 CTTTCCCCTGAGGCCAGTTTTGG - Intergenic
1138559959 16:57795415-57795437 CCTGCCCCAAAAGCCACTGTGGG - Intronic
1139663138 16:68435751-68435773 CCTGTCCCTGAGGCCACTGTTGG - Intronic
1142624105 17:1181091-1181113 CCTTCCTGGTAGGCCTCTGTAGG - Intronic
1143034590 17:3987144-3987166 CCTTCCCCTTCGGCCAGTGGCGG + Intergenic
1144512269 17:15887212-15887234 CCTTCCCTTTACTCCTCTGTGGG - Intergenic
1146915562 17:36676262-36676284 CCTTCCCCGGAGGCCTCAGTGGG - Intergenic
1146953296 17:36921247-36921269 CCTTCCCCATCTCCCACTGTGGG + Intergenic
1147185711 17:38712126-38712148 CCTTCCTCTGAGGCCACTGAGGG + Intronic
1148610130 17:48959635-48959657 CCTTCCTCTGTGGCCACTGCTGG - Intronic
1151178533 17:72309098-72309120 CCTCCTCCCTGGGCCACTGTAGG + Intergenic
1151564949 17:74892829-74892851 GGTTCCCCTCAGGCCACAGTGGG - Intronic
1152366997 17:79862162-79862184 CCTTCCCCTCTGGCCACGGCTGG - Intergenic
1156491304 18:37498094-37498116 CCTTCCCTTAAGGCCACTCTGGG - Intronic
1159269174 18:66127053-66127075 TCTTCCCCTTAGTTCACTGATGG - Intergenic
1161154251 19:2723953-2723975 CTTTCCCACTAGGCCACCGTGGG - Intronic
1162351830 19:10155105-10155127 CCATGCCCTGTGGCCACTGTAGG - Intronic
1162693536 19:12453267-12453289 CCTTCTGCTTAGGCCAATGCCGG - Intronic
1162841664 19:13361173-13361195 CCTTACCCTTAGGCAAGGGTAGG - Intronic
1164355080 19:27416406-27416428 ATTTCCCCTTAGGCCACAATTGG + Intergenic
1165583192 19:36887235-36887257 ATTTCCCCTTAGGTTACTGTTGG - Intronic
1166231873 19:41429215-41429237 CATTAACTTTAGGCCACTGTTGG + Intronic
1167719324 19:51167898-51167920 CCTTCCCCTTGTGCCACTCCTGG - Intergenic
931457681 2:62424949-62424971 CCTTCCCATTTGGCCACTTTTGG + Intergenic
935395995 2:102609762-102609784 TCTTCTCAATAGGCCACTGTGGG - Intergenic
935960230 2:108418610-108418632 CCGTCCCCTAAGCCCAATGTGGG - Intergenic
937390306 2:121480294-121480316 CCTGCTCCTTAAGGCACTGTAGG + Intronic
937410119 2:121667738-121667760 CCTTACCCTTCTGCCACTGGTGG - Intergenic
942679975 2:178467993-178468015 CCTTCTCCTTCTTCCACTGTTGG + Intronic
945046262 2:205784548-205784570 TCATCCTCTTAGGCCACAGTTGG - Intronic
948488738 2:238297807-238297829 CCTTACCCTTTGCCCTCTGTTGG + Intergenic
1171407356 20:24920547-24920569 CCTGCCCTTTTAGCCACTGTGGG - Intergenic
1171423113 20:25032193-25032215 CCTTCCTCTCTGGCCACTCTGGG + Intronic
1175227039 20:57450734-57450756 CCCTCTCCTCAGGCCACTCTGGG - Intergenic
1176004423 20:62852447-62852469 TCTTCCTTTTAGGCCACTGAGGG + Intronic
1181111565 22:20605755-20605777 CCTTCCCCTTTGGACCCTCTGGG - Intergenic
1183580913 22:38726187-38726209 CCACCCCCTGATGCCACTGTAGG - Intronic
1184319227 22:43726641-43726663 CCTTGCCTTCTGGCCACTGTGGG - Intronic
951057598 3:18165442-18165464 TTTTTCCCTTAAGCCACTGTTGG - Intronic
952611898 3:35220120-35220142 CCTTCTCCTTAGCCCACTTGAGG - Intergenic
953636968 3:44672015-44672037 CCTGCCCCAAGGGCCACTGTTGG + Intergenic
954972796 3:54665096-54665118 TCTTCCCCTTGGGGCACTGCTGG - Intronic
961445040 3:126976474-126976496 CCTTTCCCTTTGACCACTCTGGG - Intergenic
964157099 3:153599650-153599672 CCTTACCCCTAGTCCACTGTGGG + Intergenic
970369004 4:15389282-15389304 CCCTGCCTTTAGGCCACTGGGGG - Intronic
971891500 4:32529558-32529580 CCTTCCCTTAAGGCCAGTGGTGG - Intergenic
984570719 4:181389503-181389525 AATTCCCCTGAGGACACTGTGGG + Intergenic
984718947 4:182952548-182952570 CCCTCTACTTAGGCCCCTGTGGG - Intergenic
985341305 4:188957347-188957369 CATTCCCCTTCGGCCACGCTGGG - Intergenic
985851222 5:2390152-2390174 CTTGCCCCTCAGGCCTCTGTGGG + Intergenic
986183904 5:5418785-5418807 CCTTCACCTGAGGCCAGTGGGGG - Intergenic
988813490 5:34807635-34807657 CCTTCCCCATAGGAGACTGTAGG + Intronic
993126821 5:83845614-83845636 CCTTCTCCTTAGGCACCTGCTGG - Intergenic
993511212 5:88773654-88773676 CCTTACCATTAGTCCCCTGTAGG - Intronic
995023075 5:107388163-107388185 CTTTCACCTTGGGCCTCTGTTGG - Intronic
995334000 5:110977615-110977637 CCTTTCCCTTATGTCTCTGTGGG - Intergenic
997164049 5:131639682-131639704 CCTTCCCCTTGAGACAATGTAGG + Intronic
997426180 5:133804235-133804257 CTTTTCCTTTGGGCCACTGTGGG - Intergenic
997725171 5:136114153-136114175 CCTGCCCACAAGGCCACTGTAGG + Intergenic
1001182606 5:169534632-169534654 ACTTACCCCTAGGCCACTGTGGG + Intergenic
1002538971 5:179893690-179893712 CTTTCCCCTTCAGCCACTGGTGG - Intronic
1003225721 6:4203932-4203954 CCTTCCAGTTAGGCTACTCTGGG + Intergenic
1007981313 6:46161964-46161986 CCTGCTGCTTAAGCCACTGTTGG - Intronic
1011792487 6:90913709-90913731 CCTTCACCTTAGACCTCTGTGGG + Intergenic
1016937481 6:149457835-149457857 CCTTTCCCATATGACACTGTTGG + Intronic
1019026365 6:168967461-168967483 CCTTCCACTGGGGCCACAGTGGG - Intergenic
1020323608 7:6957906-6957928 CCTGCCCCCTTAGCCACTGTGGG + Intergenic
1020628833 7:10615844-10615866 CCTTCCCCATAGTGCACTTTTGG - Intergenic
1025535616 7:61944565-61944587 TTTACCCCTTAGGCCACTATGGG - Intergenic
1028041755 7:86062372-86062394 CCTTCCTCTTATGCCCCTTTTGG - Intergenic
1032577114 7:133066800-133066822 CCTTCCACTCAGGCCAATATGGG + Intronic
1032720879 7:134550080-134550102 CCTTCTCCTTAGACCAGTGGTGG + Intronic
1034602157 7:152269754-152269776 GCTTCATCTTATGCCACTGTTGG - Intronic
1035655205 8:1300312-1300334 CCTTCCCCTCAGTCCCCTGGAGG - Intergenic
1037598611 8:20374709-20374731 CAATCCCCTTTGGCCACTGGGGG + Intergenic
1038061545 8:23919413-23919435 CCTCTCCCTTAGACCTCTGTTGG + Intergenic
1040134319 8:43834954-43834976 TTTTCCCCATAGGCCACAGTGGG - Intergenic
1045499050 8:102731166-102731188 CAGGCCCCCTAGGCCACTGTAGG - Intergenic
1045957078 8:107920762-107920784 CCTTCCCCAAATGCCACTATGGG + Intronic
1047751456 8:127883835-127883857 CCTTCCCCAGAGGACACTGAGGG - Intergenic
1049252922 8:141598789-141598811 CCTTGCCCTTAGGTCATGGTTGG + Intergenic
1049423602 8:142527465-142527487 CCTTCCCCTTGGGTGCCTGTGGG + Intronic
1050564507 9:6868205-6868227 CCTCTCCCTTACGCCACTGGTGG + Intronic
1050867608 9:10522625-10522647 CCTTCCCAGTAGGTCACAGTTGG - Intronic
1052095549 9:24379900-24379922 GCTTCCCCTTTGCCCACTGAAGG + Intergenic
1053308402 9:37000117-37000139 CCTCCCCCTAGGGCCACTGCAGG + Intronic
1056756421 9:89384890-89384912 CCTTCTCCTTGGGCCTCAGTAGG - Intronic
1057131987 9:92660611-92660633 CCTTCCTCTGAGGCTACAGTGGG - Intronic
1058158423 9:101540777-101540799 CCTTCCCCTGAGGACACAGGGGG - Exonic
1059741936 9:117160151-117160173 CACTCCCCATTGGCCACTGTGGG - Intronic
1062592590 9:137280881-137280903 CCTTCCCCTAAAGCCCCCGTGGG - Exonic
1187134969 X:16539255-16539277 ACTTCTCCTTAGGCAACTGGTGG + Intergenic
1187868517 X:23745266-23745288 CCTTACCCTGATGCCACAGTTGG - Intronic
1194628960 X:96259433-96259455 CTTACCCATTAGGCCACTGGAGG + Intergenic
1199458288 X:148054070-148054092 CCTACTGCTTTGGCCACTGTTGG - Intergenic
1200246814 X:154530884-154530906 CCCTCCCCTTGGGCCTCTGGCGG + Intergenic
1200961021 Y:8996296-8996318 CCTTCCCCTAAAGGCACAGTAGG - Intergenic
1202124046 Y:21553922-21553944 CCTTCCCATTATCCCACTGCTGG + Intergenic
1202151748 Y:21849982-21850004 CCTTCCCCTAAAGGCACAGTAGG + Intergenic
1202154962 Y:21875458-21875480 CCTTCCCATTATCCCACTGCTGG - Intergenic
1202195938 Y:22298179-22298201 CCTTCCCATTATCCCACTGCTGG - Intergenic