ID: 1091656230

View in Genome Browser
Species Human (GRCh38)
Location 12:2348653-2348675
Sequence TCTTAAAGTGTGGCAGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 174}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091656230_1091656242 20 Left 1091656230 12:2348653-2348675 CCGTCTGCTGCCACACTTTAAGA 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1091656242 12:2348696-2348718 AGTGTGGGGCGCCCTGGAGAAGG 0: 1
1: 0
2: 2
3: 17
4: 228
1091656230_1091656243 26 Left 1091656230 12:2348653-2348675 CCGTCTGCTGCCACACTTTAAGA 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1091656243 12:2348702-2348724 GGGCGCCCTGGAGAAGGAGCTGG 0: 1
1: 0
2: 11
3: 156
4: 1004
1091656230_1091656232 -10 Left 1091656230 12:2348653-2348675 CCGTCTGCTGCCACACTTTAAGA 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1091656232 12:2348666-2348688 CACTTTAAGATTTCTCCCAGAGG 0: 1
1: 0
2: 0
3: 17
4: 172
1091656230_1091656233 -9 Left 1091656230 12:2348653-2348675 CCGTCTGCTGCCACACTTTAAGA 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1091656233 12:2348667-2348689 ACTTTAAGATTTCTCCCAGAGGG 0: 1
1: 0
2: 3
3: 16
4: 225
1091656230_1091656234 4 Left 1091656230 12:2348653-2348675 CCGTCTGCTGCCACACTTTAAGA 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1091656234 12:2348680-2348702 TCCCAGAGGGACCCAGAGTGTGG 0: 1
1: 0
2: 2
3: 34
4: 290
1091656230_1091656236 5 Left 1091656230 12:2348653-2348675 CCGTCTGCTGCCACACTTTAAGA 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1091656236 12:2348681-2348703 CCCAGAGGGACCCAGAGTGTGGG 0: 1
1: 0
2: 4
3: 12
4: 247
1091656230_1091656244 27 Left 1091656230 12:2348653-2348675 CCGTCTGCTGCCACACTTTAAGA 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1091656244 12:2348703-2348725 GGCGCCCTGGAGAAGGAGCTGGG 0: 1
1: 0
2: 2
3: 58
4: 292
1091656230_1091656238 6 Left 1091656230 12:2348653-2348675 CCGTCTGCTGCCACACTTTAAGA 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1091656238 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 6
3: 25
4: 315
1091656230_1091656239 14 Left 1091656230 12:2348653-2348675 CCGTCTGCTGCCACACTTTAAGA 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1091656239 12:2348690-2348712 ACCCAGAGTGTGGGGCGCCCTGG 0: 1
1: 0
2: 2
3: 21
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091656230 Original CRISPR TCTTAAAGTGTGGCAGCAGA CGG (reversed) Intronic