ID: 1091656231

View in Genome Browser
Species Human (GRCh38)
Location 12:2348663-2348685
Sequence CTGGGAGAAATCTTAAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 201}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091656231_1091656243 16 Left 1091656231 12:2348663-2348685 CCACACTTTAAGATTTCTCCCAG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1091656243 12:2348702-2348724 GGGCGCCCTGGAGAAGGAGCTGG 0: 1
1: 0
2: 11
3: 156
4: 1004
1091656231_1091656247 27 Left 1091656231 12:2348663-2348685 CCACACTTTAAGATTTCTCCCAG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1091656247 12:2348713-2348735 AGAAGGAGCTGGGAATGTCTCGG 0: 1
1: 0
2: 4
3: 34
4: 347
1091656231_1091656244 17 Left 1091656231 12:2348663-2348685 CCACACTTTAAGATTTCTCCCAG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1091656244 12:2348703-2348725 GGCGCCCTGGAGAAGGAGCTGGG 0: 1
1: 0
2: 2
3: 58
4: 292
1091656231_1091656248 28 Left 1091656231 12:2348663-2348685 CCACACTTTAAGATTTCTCCCAG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1091656248 12:2348714-2348736 GAAGGAGCTGGGAATGTCTCGGG 0: 1
1: 0
2: 1
3: 25
4: 317
1091656231_1091656238 -4 Left 1091656231 12:2348663-2348685 CCACACTTTAAGATTTCTCCCAG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1091656238 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 6
3: 25
4: 315
1091656231_1091656250 30 Left 1091656231 12:2348663-2348685 CCACACTTTAAGATTTCTCCCAG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1091656250 12:2348716-2348738 AGGAGCTGGGAATGTCTCGGGGG 0: 1
1: 0
2: 1
3: 9
4: 166
1091656231_1091656239 4 Left 1091656231 12:2348663-2348685 CCACACTTTAAGATTTCTCCCAG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1091656239 12:2348690-2348712 ACCCAGAGTGTGGGGCGCCCTGG 0: 1
1: 0
2: 2
3: 21
4: 198
1091656231_1091656236 -5 Left 1091656231 12:2348663-2348685 CCACACTTTAAGATTTCTCCCAG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1091656236 12:2348681-2348703 CCCAGAGGGACCCAGAGTGTGGG 0: 1
1: 0
2: 4
3: 12
4: 247
1091656231_1091656249 29 Left 1091656231 12:2348663-2348685 CCACACTTTAAGATTTCTCCCAG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1091656249 12:2348715-2348737 AAGGAGCTGGGAATGTCTCGGGG 0: 1
1: 0
2: 1
3: 16
4: 162
1091656231_1091656242 10 Left 1091656231 12:2348663-2348685 CCACACTTTAAGATTTCTCCCAG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1091656242 12:2348696-2348718 AGTGTGGGGCGCCCTGGAGAAGG 0: 1
1: 0
2: 2
3: 17
4: 228
1091656231_1091656234 -6 Left 1091656231 12:2348663-2348685 CCACACTTTAAGATTTCTCCCAG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1091656234 12:2348680-2348702 TCCCAGAGGGACCCAGAGTGTGG 0: 1
1: 0
2: 2
3: 34
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091656231 Original CRISPR CTGGGAGAAATCTTAAAGTG TGG (reversed) Intronic