ID: 1091656234

View in Genome Browser
Species Human (GRCh38)
Location 12:2348680-2348702
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091656231_1091656234 -6 Left 1091656231 12:2348663-2348685 CCACACTTTAAGATTTCTCCCAG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1091656234 12:2348680-2348702 TCCCAGAGGGACCCAGAGTGTGG 0: 1
1: 0
2: 2
3: 34
4: 290
1091656230_1091656234 4 Left 1091656230 12:2348653-2348675 CCGTCTGCTGCCACACTTTAAGA 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1091656234 12:2348680-2348702 TCCCAGAGGGACCCAGAGTGTGG 0: 1
1: 0
2: 2
3: 34
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type