ID: 1091656235

View in Genome Browser
Species Human (GRCh38)
Location 12:2348681-2348703
Sequence CCCACACTCTGGGTCCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 232}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091656235_1091656250 12 Left 1091656235 12:2348681-2348703 CCCAGAGGGACCCAGAGTGTGGG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1091656250 12:2348716-2348738 AGGAGCTGGGAATGTCTCGGGGG 0: 1
1: 0
2: 1
3: 9
4: 166
1091656235_1091656243 -2 Left 1091656235 12:2348681-2348703 CCCAGAGGGACCCAGAGTGTGGG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1091656243 12:2348702-2348724 GGGCGCCCTGGAGAAGGAGCTGG 0: 1
1: 0
2: 11
3: 156
4: 1004
1091656235_1091656253 30 Left 1091656235 12:2348681-2348703 CCCAGAGGGACCCAGAGTGTGGG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1091656253 12:2348734-2348756 GGGGGAAAGGTTCCTTCCTCGGG 0: 1
1: 0
2: 1
3: 12
4: 195
1091656235_1091656248 10 Left 1091656235 12:2348681-2348703 CCCAGAGGGACCCAGAGTGTGGG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1091656248 12:2348714-2348736 GAAGGAGCTGGGAATGTCTCGGG 0: 1
1: 0
2: 1
3: 25
4: 317
1091656235_1091656247 9 Left 1091656235 12:2348681-2348703 CCCAGAGGGACCCAGAGTGTGGG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1091656247 12:2348713-2348735 AGAAGGAGCTGGGAATGTCTCGG 0: 1
1: 0
2: 4
3: 34
4: 347
1091656235_1091656242 -8 Left 1091656235 12:2348681-2348703 CCCAGAGGGACCCAGAGTGTGGG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1091656242 12:2348696-2348718 AGTGTGGGGCGCCCTGGAGAAGG 0: 1
1: 0
2: 2
3: 17
4: 228
1091656235_1091656252 29 Left 1091656235 12:2348681-2348703 CCCAGAGGGACCCAGAGTGTGGG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1091656252 12:2348733-2348755 CGGGGGAAAGGTTCCTTCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 107
1091656235_1091656244 -1 Left 1091656235 12:2348681-2348703 CCCAGAGGGACCCAGAGTGTGGG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1091656244 12:2348703-2348725 GGCGCCCTGGAGAAGGAGCTGGG 0: 1
1: 0
2: 2
3: 58
4: 292
1091656235_1091656249 11 Left 1091656235 12:2348681-2348703 CCCAGAGGGACCCAGAGTGTGGG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1091656249 12:2348715-2348737 AAGGAGCTGGGAATGTCTCGGGG 0: 1
1: 0
2: 1
3: 16
4: 162
1091656235_1091656251 17 Left 1091656235 12:2348681-2348703 CCCAGAGGGACCCAGAGTGTGGG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1091656251 12:2348721-2348743 CTGGGAATGTCTCGGGGGAAAGG 0: 1
1: 0
2: 1
3: 16
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091656235 Original CRISPR CCCACACTCTGGGTCCCTCT GGG (reversed) Intronic