ID: 1091656237

View in Genome Browser
Species Human (GRCh38)
Location 12:2348682-2348704
Sequence CCCCACACTCTGGGTCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 292}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091656237_1091656243 -3 Left 1091656237 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1091656243 12:2348702-2348724 GGGCGCCCTGGAGAAGGAGCTGG 0: 1
1: 0
2: 11
3: 156
4: 1004
1091656237_1091656251 16 Left 1091656237 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1091656251 12:2348721-2348743 CTGGGAATGTCTCGGGGGAAAGG 0: 1
1: 0
2: 1
3: 16
4: 166
1091656237_1091656242 -9 Left 1091656237 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1091656242 12:2348696-2348718 AGTGTGGGGCGCCCTGGAGAAGG 0: 1
1: 0
2: 2
3: 17
4: 228
1091656237_1091656253 29 Left 1091656237 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1091656253 12:2348734-2348756 GGGGGAAAGGTTCCTTCCTCGGG 0: 1
1: 0
2: 1
3: 12
4: 195
1091656237_1091656249 10 Left 1091656237 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1091656249 12:2348715-2348737 AAGGAGCTGGGAATGTCTCGGGG 0: 1
1: 0
2: 1
3: 16
4: 162
1091656237_1091656247 8 Left 1091656237 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1091656247 12:2348713-2348735 AGAAGGAGCTGGGAATGTCTCGG 0: 1
1: 0
2: 4
3: 34
4: 347
1091656237_1091656244 -2 Left 1091656237 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1091656244 12:2348703-2348725 GGCGCCCTGGAGAAGGAGCTGGG 0: 1
1: 0
2: 2
3: 58
4: 292
1091656237_1091656252 28 Left 1091656237 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1091656252 12:2348733-2348755 CGGGGGAAAGGTTCCTTCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 107
1091656237_1091656250 11 Left 1091656237 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1091656250 12:2348716-2348738 AGGAGCTGGGAATGTCTCGGGGG 0: 1
1: 0
2: 1
3: 9
4: 166
1091656237_1091656248 9 Left 1091656237 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1091656248 12:2348714-2348736 GAAGGAGCTGGGAATGTCTCGGG 0: 1
1: 0
2: 1
3: 25
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091656237 Original CRISPR CCCCACACTCTGGGTCCCTC TGG (reversed) Intronic