ID: 1091656238

View in Genome Browser
Species Human (GRCh38)
Location 12:2348682-2348704
Sequence CCAGAGGGACCCAGAGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 6, 3: 25, 4: 315}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091656231_1091656238 -4 Left 1091656231 12:2348663-2348685 CCACACTTTAAGATTTCTCCCAG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1091656238 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 6
3: 25
4: 315
1091656230_1091656238 6 Left 1091656230 12:2348653-2348675 CCGTCTGCTGCCACACTTTAAGA 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1091656238 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 6
3: 25
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091656238 Original CRISPR CCAGAGGGACCCAGAGTGTG GGG Intronic