ID: 1091656242

View in Genome Browser
Species Human (GRCh38)
Location 12:2348696-2348718
Sequence AGTGTGGGGCGCCCTGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091656237_1091656242 -9 Left 1091656237 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1091656242 12:2348696-2348718 AGTGTGGGGCGCCCTGGAGAAGG 0: 1
1: 0
2: 2
3: 17
4: 228
1091656230_1091656242 20 Left 1091656230 12:2348653-2348675 CCGTCTGCTGCCACACTTTAAGA 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1091656242 12:2348696-2348718 AGTGTGGGGCGCCCTGGAGAAGG 0: 1
1: 0
2: 2
3: 17
4: 228
1091656235_1091656242 -8 Left 1091656235 12:2348681-2348703 CCCAGAGGGACCCAGAGTGTGGG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1091656242 12:2348696-2348718 AGTGTGGGGCGCCCTGGAGAAGG 0: 1
1: 0
2: 2
3: 17
4: 228
1091656231_1091656242 10 Left 1091656231 12:2348663-2348685 CCACACTTTAAGATTTCTCCCAG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1091656242 12:2348696-2348718 AGTGTGGGGCGCCCTGGAGAAGG 0: 1
1: 0
2: 2
3: 17
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091656242 Original CRISPR AGTGTGGGGCGCCCTGGAGA AGG Intronic