ID: 1091656250

View in Genome Browser
Species Human (GRCh38)
Location 12:2348716-2348738
Sequence AGGAGCTGGGAATGTCTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091656240_1091656250 2 Left 1091656240 12:2348691-2348713 CCCAGAGTGTGGGGCGCCCTGGA 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1091656250 12:2348716-2348738 AGGAGCTGGGAATGTCTCGGGGG 0: 1
1: 0
2: 1
3: 9
4: 166
1091656235_1091656250 12 Left 1091656235 12:2348681-2348703 CCCAGAGGGACCCAGAGTGTGGG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1091656250 12:2348716-2348738 AGGAGCTGGGAATGTCTCGGGGG 0: 1
1: 0
2: 1
3: 9
4: 166
1091656241_1091656250 1 Left 1091656241 12:2348692-2348714 CCAGAGTGTGGGGCGCCCTGGAG 0: 1
1: 0
2: 1
3: 14
4: 172
Right 1091656250 12:2348716-2348738 AGGAGCTGGGAATGTCTCGGGGG 0: 1
1: 0
2: 1
3: 9
4: 166
1091656231_1091656250 30 Left 1091656231 12:2348663-2348685 CCACACTTTAAGATTTCTCCCAG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1091656250 12:2348716-2348738 AGGAGCTGGGAATGTCTCGGGGG 0: 1
1: 0
2: 1
3: 9
4: 166
1091656237_1091656250 11 Left 1091656237 12:2348682-2348704 CCAGAGGGACCCAGAGTGTGGGG 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1091656250 12:2348716-2348738 AGGAGCTGGGAATGTCTCGGGGG 0: 1
1: 0
2: 1
3: 9
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091656250 Original CRISPR AGGAGCTGGGAATGTCTCGG GGG Intronic