ID: 1091658354

View in Genome Browser
Species Human (GRCh38)
Location 12:2362422-2362444
Sequence CTGAATCCTACATGTTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091658349_1091658354 15 Left 1091658349 12:2362384-2362406 CCTGTGGCTCGGGATACTTCCCT 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG 0: 1
1: 0
2: 0
3: 19
4: 195
1091658351_1091658354 -5 Left 1091658351 12:2362404-2362426 CCTTCTCCTTTACTCCTTCTGAA 0: 1
1: 0
2: 1
3: 57
4: 485
Right 1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG 0: 1
1: 0
2: 0
3: 19
4: 195
1091658350_1091658354 -4 Left 1091658350 12:2362403-2362425 CCCTTCTCCTTTACTCCTTCTGA 0: 1
1: 1
2: 4
3: 75
4: 776
Right 1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG 0: 1
1: 0
2: 0
3: 19
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091658354 Original CRISPR CTGAATCCTACATGTTTTTG TGG Intronic
906457791 1:46012180-46012202 CTGATTCCTATATGTCTCTGGGG - Intronic
906893153 1:49739938-49739960 TAGAATTCGACATGTTTTTGCGG - Intronic
907265433 1:53257125-53257147 CTGAATACTGCATATCTTTGAGG - Intronic
908298356 1:62736151-62736173 CTGGATCCTGCCTATTTTTGTGG + Intergenic
908890784 1:68845015-68845037 TTGATCCCTACATCTTTTTGAGG - Intergenic
910542567 1:88377407-88377429 CTGTATCCTAGATGTCTCTGGGG + Intergenic
910941220 1:92536272-92536294 CTCATTACTAAATGTTTTTGGGG - Intronic
911201847 1:95052240-95052262 TTGTATCCTACTTGTTTTTTTGG - Intronic
911763900 1:101650122-101650144 CTGAATCCTATTTGATTATGGGG + Intergenic
912254482 1:108045197-108045219 CAGAATTCTACCTGTTTTTCCGG + Intergenic
913112509 1:115669211-115669233 CTGAGTCATACCTGCTTTTGTGG - Intronic
913449940 1:118986410-118986432 ATGAATTCTCCGTGTTTTTGTGG - Intronic
913657149 1:120972056-120972078 CTGATTAGTACATGTATTTGAGG - Intergenic
914008492 1:143755140-143755162 CTGATTAGTACATGTATTTGAGG - Intergenic
914647122 1:149663791-149663813 CTGATTAGTACATGTATTTGAGG - Intergenic
916295272 1:163212305-163212327 CTCCAGCCTACATGTTTTGGGGG - Intronic
916699034 1:167271860-167271882 ATGATTTCTACATTTTTTTGTGG + Intronic
921522390 1:216172692-216172714 CTGATGCCTACATGTCTTTGGGG + Intronic
922299707 1:224286986-224287008 CTGAAACCTATAATTTTTTGTGG + Intronic
923357817 1:233177804-233177826 CTGAATCTTTCATCTTCTTGGGG + Exonic
1063330089 10:5149149-5149171 CTGAATCCTAAATTATTTTCTGG - Intergenic
1063792518 10:9469881-9469903 CTGCTTCCTACATTTTTATGAGG + Intergenic
1065139004 10:22702341-22702363 CTGAATACTACAATTTTTAGAGG + Intronic
1066100336 10:32112072-32112094 CTGGATCATACAGGGTTTTGTGG - Intergenic
1066121123 10:32288750-32288772 CTGAGCCCTACATGATTTTGTGG - Intronic
1067266722 10:44752591-44752613 CTGACTCACAGATGTTTTTGAGG - Intergenic
1069018505 10:63459868-63459890 CTGAATCCTACATACTACTGTGG - Intronic
1072468839 10:95693311-95693333 CTGAATCCTAAAGGGGTTTGGGG - Intronic
1073966102 10:108992130-108992152 CTAAATCCTTCTTGCTTTTGAGG - Intergenic
1075895630 10:125992137-125992159 CTGAATCCTTCAAGACTTTGTGG - Intronic
1077894383 11:6442922-6442944 CTGAATCCTACAGATTTTGCTGG + Intergenic
1078168939 11:8913616-8913638 GTGAGTCCTACATGGTTTTAAGG + Intronic
1082631420 11:55546561-55546583 TTCAATCCTACATTTTTCTGTGG + Intergenic
1084929716 11:72545197-72545219 CTGCATCCTTTATGTTTTTAAGG + Intergenic
1085879248 11:80446142-80446164 CTCCATACTACAAGTTTTTGAGG + Intergenic
1086128253 11:83372328-83372350 CTGAATTCTATATCTTTCTGAGG + Intergenic
1086151734 11:83618965-83618987 ATGAATCAGACATGTCTTTGAGG - Intronic
1086744834 11:90411822-90411844 CTGAATCTTTTTTGTTTTTGAGG - Intergenic
1086972472 11:93098425-93098447 CTGAATCTTAACTGTTTTTAAGG + Intergenic
1089097558 11:115931793-115931815 CTGAATCCTACCATTCTTTGAGG + Intergenic
1090478057 11:127042205-127042227 ATGCATCCTACATTTTTTTTTGG - Intergenic
1091096703 11:132829712-132829734 CAGAATCCTTTCTGTTTTTGGGG + Intronic
1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG + Intronic
1092041365 12:5387816-5387838 CTGAATCCTACCTATTCTTTAGG + Intergenic
1093520298 12:20042234-20042256 CTGCATCCTACATCTCTTGGTGG - Intergenic
1102529906 12:113538569-113538591 AAGATTCCAACATGTTTTTGAGG - Intergenic
1104179179 12:126361445-126361467 CTAAGTCCCACATGTGTTTGTGG - Intergenic
1108407818 13:50123130-50123152 CTGAGACCTACAAGTTTTGGGGG - Intronic
1108672328 13:52704404-52704426 TTGAATTTTACATGTTTTTGTGG - Intronic
1109407099 13:61915980-61916002 CTGATGCCTACATGGTTATGAGG - Intergenic
1109782326 13:67128078-67128100 CTGATTCCCACAAGTCTTTGGGG - Intronic
1110298495 13:73898131-73898153 CTGAATACTTCAGGTTTTGGAGG - Intronic
1110796817 13:79648059-79648081 GAGAACCCTACATGTTATTGAGG + Intergenic
1110951381 13:81496498-81496520 ATCAATCCAACATGTTTTTAAGG - Intergenic
1112574147 13:100620471-100620493 GGGAATCCTATATGTTTTGGGGG - Intronic
1112805522 13:103160476-103160498 CTGAATTCTCCAGTTTTTTGAGG - Intergenic
1115895636 14:38084007-38084029 CTGGATCCTGCATGTTTTTTTGG - Intergenic
1117448356 14:55826768-55826790 CTGAATCCAACTTGAGTTTGAGG - Intergenic
1117593518 14:57301831-57301853 CATAATCCTACATGTTTCTAGGG + Intergenic
1118147433 14:63155807-63155829 CTGTATCCTACATGGTTTCCAGG + Intergenic
1120496138 14:85238546-85238568 CTGAATTCTAAATATTTTAGAGG - Intergenic
1120986346 14:90338838-90338860 CCTAATACTACATGTTTATGAGG - Intergenic
1124011661 15:25844062-25844084 TTGACTCCTTCATGTTCTTGGGG - Intronic
1127530155 15:59835851-59835873 CTGATTGCTTCAAGTTTTTGTGG + Intergenic
1131187257 15:90285512-90285534 CTGAAACCCACATCTTTCTGTGG + Intronic
1131221571 15:90589007-90589029 CCGAATCATATGTGTTTTTGGGG + Intronic
1135048931 16:19176865-19176887 CTGAATCCTACAGGTGTGTGTGG - Intronic
1138130166 16:54472581-54472603 CTGCATACAACATGTCTTTGTGG + Intergenic
1140432662 16:74917867-74917889 CTGAATCTTACACTTTTTGGTGG + Intronic
1140806215 16:78534652-78534674 CTTAAAACTACATGTTTTGGGGG + Intronic
1144096155 17:11902506-11902528 CTAAATCTTGCATGTTATTGGGG + Intronic
1145075905 17:19854549-19854571 CAGACTCTTACCTGTTTTTGAGG - Intronic
1147409340 17:40238177-40238199 CTGAATTTTACATGTATTTTTGG + Intronic
1149032114 17:52095840-52095862 CTACATCCAACATGGTTTTGAGG - Intronic
1150907995 17:69359122-69359144 GTGAAGGCTACATTTTTTTGCGG - Intergenic
1151089955 17:71426980-71427002 TTGAATCCTCTTTGTTTTTGTGG + Intergenic
1151538336 17:74750930-74750952 CAGATTCCTGCATGTTTTGGAGG + Intronic
1153213975 18:2800121-2800143 CTGAATCCAAAGTGTTTCTGGGG - Intronic
1154933177 18:21022157-21022179 CTATAGCCTACATTTTTTTGTGG - Intronic
1156365460 18:36422177-36422199 TTAATTCCCACATGTTTTTGTGG + Intronic
1157753988 18:50202142-50202164 TTTTATCCTACATTTTTTTGTGG - Intergenic
1157937917 18:51893560-51893582 CTGAATCCTAAAGGTTGTAGAGG + Intergenic
1158076810 18:53539856-53539878 CTGAATGCCTGATGTTTTTGAGG + Intergenic
1158142723 18:54272424-54272446 ATGAATGCTCCATGTTTTTGGGG + Intronic
1158674648 18:59507206-59507228 CTGAATCCTGGATGGTTTAGGGG - Intronic
1159256055 18:65947266-65947288 CTGACTCCTACATGCCTTTGAGG + Intergenic
1163250120 19:16121883-16121905 CCGAAGCCTAGATGTTTCTGTGG + Intronic
1166124833 19:40708408-40708430 CAGAATCCTAAGTGTCTTTGTGG + Intronic
1166429015 19:42707765-42707787 CTGAATCCTAAATTTTTTCCTGG + Intronic
1166442666 19:42829130-42829152 CTGAATCCTAAATTTTTTCCTGG + Intronic
1166450463 19:42895584-42895606 CTGAATCCTAAATTTTTTCCTGG + Intronic
1166462356 19:42999900-42999922 CTGAATCCTAAATTTTTTCCTGG + Intronic
1166479633 19:43159846-43159868 CTGAATCCTAAATTTTTTCCTGG + Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
926817568 2:16814961-16814983 CCGAAACCTACATGTTTTCCAGG + Intergenic
926836417 2:17028458-17028480 CTGAATTCTGGATGATTTTGAGG - Intergenic
927839905 2:26434160-26434182 CTGTATCCTTCCTATTTTTGTGG - Intronic
928615289 2:33032032-33032054 CTGAATCCTTCCTGTTTTAAAGG - Intronic
928798287 2:35053155-35053177 CTGAATCGTACATATATTTTTGG + Intergenic
929468182 2:42164859-42164881 CAGCATGCTACATGTTTTTGGGG + Intergenic
930389767 2:50746182-50746204 CTTAATCCTTAATGTTCTTGAGG - Intronic
931729335 2:65139231-65139253 CAGAATCCTACATGTCTTTAAGG + Intergenic
931823072 2:65972002-65972024 TTGAATCCATCATGTGTTTGTGG - Intergenic
935922942 2:108034641-108034663 CTGGATGCTACATGTTTTCCAGG + Intergenic
939209616 2:139157044-139157066 CTGATTACTAGATCTTTTTGTGG + Intergenic
939388740 2:141537954-141537976 TTTTATCCTACAGGTTTTTGTGG - Intronic
939767977 2:146277269-146277291 CTGAGTCCTAACTGCTTTTGAGG + Intergenic
941274781 2:163477765-163477787 CTAAATCCTAGATTTCTTTGGGG - Intergenic
941413960 2:165195323-165195345 CTGAATCCTCCATGTCCTTGAGG - Intronic
942911103 2:181245391-181245413 TTGACTCCTACATGAATTTGTGG + Intergenic
942983253 2:182107073-182107095 ATGAATTCAACATCTTTTTGGGG + Intronic
946507483 2:220317332-220317354 CTGAGTCCTACAGATCTTTGAGG - Intergenic
948174610 2:235933484-235933506 CTGATTCCTACAGCTTTATGGGG + Intronic
1171079201 20:22160939-22160961 CTAAATCTTACATGATTTGGAGG + Intergenic
1174437256 20:50518513-50518535 CTGAGTCATAAATATTTTTGTGG + Intronic
1179118085 21:38513336-38513358 CTGAATATTCCCTGTTTTTGGGG - Intronic
1180730791 22:17980608-17980630 CTGAAGCCTATAAGTATTTGTGG + Intronic
1181322618 22:22019916-22019938 CAGAATTCTAAATATTTTTGGGG + Intergenic
1183684398 22:39353230-39353252 CTGAAGCTTACATGATTTGGGGG - Intronic
952210236 3:31222744-31222766 CTGAAACCTTCTTGTTTGTGGGG + Intergenic
953050528 3:39338173-39338195 CAGAAGCCTACACTTTTTTGAGG - Intergenic
958121550 3:89296190-89296212 CTGAATCACAAATGTTTTTAAGG + Intronic
958433397 3:94068561-94068583 ATTAATCATACATGTATTTGAGG - Intronic
958776542 3:98490007-98490029 CTAATTCCTACGTGTTTGTGTGG - Intergenic
958991224 3:100848010-100848032 CCAAATCCTACATGTATTTTGGG + Intronic
963104139 3:141631220-141631242 TTGAATCATACAGATTTTTGTGG + Intergenic
963746594 3:149130286-149130308 CTTATTCCTACTTGTTTTTTTGG - Intronic
964348218 3:155776618-155776640 CTGATTTTTACATTTTTTTGTGG - Intronic
965576279 3:170221827-170221849 CTGAATTATACATGTCTTTTGGG - Intergenic
965808117 3:172563403-172563425 ATGAATCATACATGTTTGTACGG + Intergenic
969666824 4:8562680-8562702 CTGAATCCTACAATTTTTCCTGG - Intronic
970403392 4:15739375-15739397 CTGCATTCTACATCTTTTAGGGG - Intergenic
970831987 4:20351004-20351026 CTTCATTATACATGTTTTTGAGG + Intronic
971293290 4:25365224-25365246 CTGAATGTTGCATGCTTTTGTGG - Intronic
974534605 4:63157721-63157743 CTGACTCCTAGATTTTTATGTGG + Intergenic
974687559 4:65250118-65250140 CTAATTCCTACATAATTTTGGGG - Intergenic
974786141 4:66621622-66621644 ATTAACCCTACATTTTTTTGAGG + Intergenic
975392130 4:73832868-73832890 TGGAATCCTTCATCTTTTTGGGG - Intergenic
977963869 4:103119746-103119768 CTGAATCTGACCTGTTTTGGGGG - Intronic
981052327 4:140321363-140321385 ATAAATCCAACATGTTTATGAGG - Intronic
983290081 4:165790804-165790826 TTAAATCTTACATCTTTTTGAGG + Intergenic
984453838 4:179939696-179939718 CAGAATCTGACATTTTTTTGAGG - Intergenic
985354895 4:189108309-189108331 CTGAATCTTCCATGATTCTGGGG + Intergenic
986414034 5:7510591-7510613 CTGCATCCTATTTGATTTTGTGG - Intronic
986822433 5:11482366-11482388 CTGAATCCTGAATATTTCTGGGG - Intronic
987101196 5:14592638-14592660 CAGAATTCTACTTGTTTTTTAGG - Intronic
989156044 5:38345972-38345994 CTGAATTCAACACGTTTCTGTGG + Intronic
990073386 5:51812978-51813000 TTGAATCCAACATGTATTTTAGG + Intergenic
990863040 5:60349749-60349771 CTAAATCCTAAATCTTTTTGAGG + Intronic
991762818 5:69938769-69938791 TTGAAACCTAGATGTATTTGTGG + Intergenic
991784509 5:70179358-70179380 TTGAAACCTAGATGTATTTGTGG - Intergenic
991842045 5:70813809-70813831 TTGAAACCTAGATGTATTTGTGG + Intergenic
991876955 5:71179746-71179768 TTGAAACCTAGATGTATTTGTGG - Intergenic
992637546 5:78739363-78739385 CTGGATTCTACTTGTTTTTCTGG - Intronic
993212923 5:84977621-84977643 GTGAATCATACTTGTTTATGTGG + Intergenic
996244596 5:121245728-121245750 CTGAACCATACATGCTATTGGGG + Intergenic
998017399 5:138743432-138743454 ATGAATCTTACATTTTATTGAGG + Intronic
999625404 5:153515782-153515804 CTGAATCCCACATGTCTCTGGGG + Intronic
1001851455 5:174970453-174970475 CAGAAGCCTACATGTTTTCAAGG - Intergenic
1003013714 6:2451147-2451169 CTGAATATTACATTTTTATGTGG - Intergenic
1005357233 6:24996229-24996251 CTGGATCCTACATATTTTTCAGG + Intronic
1006459685 6:34151124-34151146 CTAAATCCTACTTGTCTTTTAGG - Intronic
1007139191 6:39554505-39554527 CTGAGTCCTACATGCATGTGAGG - Intronic
1009005195 6:57776752-57776774 TTGAAACCTAGATGTATTTGTGG - Intergenic
1009466868 6:63981764-63981786 CTGACTGATACATTTTTTTGTGG + Intronic
1015481351 6:133714235-133714257 ATTAAGCCTACATGTTTATGGGG - Intergenic
1016290435 6:142522988-142523010 CCAAATCCTACATGTTCTTTAGG + Intergenic
1018884944 6:167927462-167927484 CTAAATCCTGCATTTCTTTGTGG - Intronic
1020260372 7:6527417-6527439 CTTAATCCTACATGTATTCAGGG + Intronic
1020470678 7:8530890-8530912 TTAAATTATACATGTTTTTGAGG + Intronic
1021114166 7:16729867-16729889 CTGAATCCTACATGTAATGCAGG - Intergenic
1021446665 7:20741350-20741372 TTGAATTCTTCATGTTTCTGCGG + Intronic
1021812326 7:24414985-24415007 CTGACTCCTCCTTGTTTTTCAGG - Intergenic
1022480581 7:30740765-30740787 CTGCCTCCATCATGTTTTTGGGG - Intronic
1024728773 7:52231373-52231395 CTGGATCCTTTCTGTTTTTGAGG + Intergenic
1024804113 7:53116330-53116352 CTGAATCCTACTAATTTTTAGGG - Intergenic
1032197584 7:129798487-129798509 TTGAATCGTCCATGTTTCTGCGG - Intergenic
1032418635 7:131759389-131759411 CTGAATCCCACATTTTTTTCTGG + Intergenic
1036656211 8:10679048-10679070 CTGAGCCCTACATGTTTCTGGGG + Intronic
1036987230 8:13548257-13548279 CTGAATGTTACATGTTTCTATGG + Intergenic
1038272268 8:26084905-26084927 CTTAACCCTTCATGATTTTGAGG + Intergenic
1038380752 8:27091013-27091035 CTGAATGCTACATCTTTTAGAGG + Intergenic
1039394343 8:37210847-37210869 CAGTATCCTACATGTCTCTGAGG - Intergenic
1040357598 8:46634685-46634707 CTGAAGCCTACATGCTTCTTTGG - Intergenic
1040376008 8:46825265-46825287 CTGAGGCCTACATGTTTATATGG - Intergenic
1041695182 8:60728389-60728411 TTGACTCTTCCATGTTTTTGTGG + Intronic
1045297999 8:100889049-100889071 CTGCATTCTACCTGTTTCTGGGG + Intergenic
1045576956 8:103433190-103433212 CTGAACCATACATGTTTTAATGG + Intronic
1046343133 8:112884926-112884948 CTAATTCCTACAAGTATTTGAGG + Intronic
1046812323 8:118546364-118546386 CTGAATCCAACATTTTTTCCTGG + Intronic
1048863977 8:138745815-138745837 CTGAATCCTGAATGTTTTGGCGG - Intronic
1050164690 9:2752403-2752425 CTGCATCCTGCCTGTTTTTCTGG - Intronic
1051186823 9:14469212-14469234 CTGAGTCTTACAGGGTTTTGGGG - Intergenic
1051516317 9:17934087-17934109 CTGAATTTTACATGTTGTTTGGG + Intergenic
1053835724 9:42133077-42133099 CTGAAACCTTCCTGTTTCTGTGG + Intergenic
1054594906 9:67055528-67055550 CTGAAACCTTCCTGTTTCTGTGG - Intergenic
1055221020 9:73931991-73932013 CTGAAACCTAGATGCTTTTAAGG - Intergenic
1056024430 9:82478212-82478234 CTGAATCTTACAGGTATATGTGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1058143140 9:101379701-101379723 CTAAATCCTAAATTATTTTGTGG + Intronic
1061222962 9:129262891-129262913 CTGAAACTTACATGTAGTTGTGG - Intergenic
1186565700 X:10659975-10659997 CTGAATTTTACATGATTTTCTGG + Intronic
1186637440 X:11421688-11421710 CTGAATCCTACATTTTGTAGGGG + Intronic
1190685639 X:52870350-52870372 CAGAGGCCAACATGTTTTTGAGG + Intergenic
1194595152 X:95848177-95848199 CTGAATCCTGCATGTCTCAGAGG - Intergenic
1194993109 X:100566335-100566357 CTGAATCATACATGTTTAAATGG + Intergenic
1196352079 X:114743603-114743625 CTGAATCCCACAGGTTCTTGAGG - Intronic
1196963292 X:121026923-121026945 TGGAATCCTTTATGTTTTTGAGG + Intergenic
1198433120 X:136587813-136587835 CTGAATACTACAGGTGTTGGGGG + Intergenic
1198688753 X:139257305-139257327 CTTAGTCCTACAGGTCTTTGAGG + Intergenic
1200892712 Y:8340707-8340729 CTGAAGCCTACATGCTTATAGGG - Intergenic
1200892719 Y:8340798-8340820 CACAATCTTACATGTTTTTTGGG - Intergenic
1202262789 Y:22987154-22987176 CTGAGGCCTACATGTTTGTATGG - Intronic
1202415779 Y:24620895-24620917 CTGAGGCCTACATGTTTGTATGG - Intronic
1202455008 Y:25049191-25049213 CTGAGGCCTACATGTTTGTATGG + Intronic