ID: 1091660073

View in Genome Browser
Species Human (GRCh38)
Location 12:2376824-2376846
Sequence CCTCCCTGCTTCACAGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091660073 Original CRISPR CCTCCCTGCTTCACAGAGAT GGG Intronic