ID: 1091661432

View in Genome Browser
Species Human (GRCh38)
Location 12:2386763-2386785
Sequence CTGCTGGGATGCAGAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 482}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091661432_1091661439 26 Left 1091661432 12:2386763-2386785 CCTGTTTCTCTGCATCCCAGCAG 0: 1
1: 0
2: 4
3: 50
4: 482
Right 1091661439 12:2386812-2386834 CTCAGTCCGTGTTTACTGGATGG 0: 1
1: 0
2: 2
3: 6
4: 85
1091661432_1091661438 22 Left 1091661432 12:2386763-2386785 CCTGTTTCTCTGCATCCCAGCAG 0: 1
1: 0
2: 4
3: 50
4: 482
Right 1091661438 12:2386808-2386830 GATGCTCAGTCCGTGTTTACTGG 0: 1
1: 0
2: 2
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091661432 Original CRISPR CTGCTGGGATGCAGAGAAAC AGG (reversed) Intronic
901279657 1:8024094-8024116 CTGATGGTATGCAGACAATCAGG + Intronic
902231946 1:15033551-15033573 CTGGTGGGATGTGGAGAAACTGG - Intronic
902730084 1:18363503-18363525 GGGCAGGGATGCAGAGACACAGG + Intronic
902959656 1:19954036-19954058 CTACTGGAATGCAGAGAGAGTGG - Intergenic
903260455 1:22129075-22129097 ATACAGGGATGCACAGAAACAGG - Intronic
903341612 1:22658455-22658477 ATGCTGGGAGGCAGAGTAACTGG - Intronic
904428793 1:30448567-30448589 CTGCTGGCATGGAAAGAACCAGG - Intergenic
905939394 1:41851026-41851048 CTGATGAGATGCAGTGTAACTGG - Intronic
907029929 1:51160986-51161008 CTGCTGAGGTACAGAGAAAAGGG + Intergenic
907348260 1:53802701-53802723 CTGGTGGGAAACAGAGAACCTGG - Intronic
908550947 1:65208166-65208188 CAGCAAGGTTGCAGAGAAACAGG - Intronic
909201339 1:72693508-72693530 TTGCTGGGCTGCAAAGACACGGG - Intergenic
910307927 1:85787864-85787886 TTGCAGGGCTGCAGAGAAATAGG - Intronic
911357310 1:96838266-96838288 CTACTGGAATGCAAAGAAAAGGG - Intergenic
911923979 1:103803340-103803362 CTACAGGGATGCAGAGGAAGAGG - Intergenic
912454885 1:109790789-109790811 CTCCTGGGCTGCAAAGGAACAGG + Intergenic
912566963 1:110594538-110594560 GTGCAGGGATGCAGAAAACCAGG + Intronic
914854217 1:151338640-151338662 CTTGTGGGATGTAGAGAAACAGG + Intergenic
915734837 1:158078175-158078197 CTGCCAGGATACAGAGAGACAGG - Intronic
916705796 1:167348471-167348493 TGGCAGGGATGCAGAGAAATTGG - Intronic
916825077 1:168435244-168435266 CTGGGGGGATGGAGAGCAACAGG - Intergenic
917548029 1:175993112-175993134 CTGCTGGGACCCAGGCAAACAGG + Intronic
918470247 1:184865116-184865138 CTGGTGAGGTGCAGAGAAAAGGG + Intronic
919340409 1:196299608-196299630 TAGCAAGGATGCAGAGAAACGGG + Intronic
919732981 1:200925959-200925981 TGGCAGGGATGCAGAGCAACTGG - Intergenic
919836383 1:201576766-201576788 TTGGTGAGATGCAGAGAAACTGG - Intergenic
919919077 1:202157706-202157728 CTGCTGGGATGAAGGGAGTCGGG - Intronic
920073018 1:203316734-203316756 CTGCTGGGGCCCAGAGAACCAGG - Intergenic
920206032 1:204292713-204292735 CTCCTGGGATGGATGGAAACAGG + Intronic
920241352 1:204553391-204553413 CAGGTGGGATGCAGAAAAATGGG - Exonic
920703241 1:208233530-208233552 GGGCTGGGATCCAGAGAACCTGG - Intronic
921039368 1:211415609-211415631 CTGGTAGAATGCAGAGAAAGGGG + Intergenic
921324080 1:213973448-213973470 CTGCTGGAATTCAGAAAACCAGG - Intergenic
921357900 1:214303814-214303836 CTGCTGGGCTGCAGAGGAGGGGG + Intronic
922549875 1:226486322-226486344 TGGCAGGGATGCAGAGAAAGGGG - Intergenic
922639317 1:227211271-227211293 CTGGGGGGATGCAGATAAAAAGG + Intronic
922720115 1:227896027-227896049 CTGCTGGAATGCAGGAAACCAGG - Intergenic
923189591 1:231607727-231607749 CTGCTAGGCTGCAGAGAAAAGGG - Intronic
923267629 1:232329847-232329869 CTCATGGAATACAGAGAAACGGG + Intergenic
924736529 1:246762025-246762047 CGGTTTGGAAGCAGAGAAACTGG - Intronic
924813149 1:247420877-247420899 CTGCTGAGATTCAGATAAAGAGG - Intronic
1063202689 10:3799856-3799878 TGGCTAGGATGCAGAGAAAAGGG + Intergenic
1063438563 10:6054040-6054062 GTGCTGGGAGGAAGAGGAACGGG - Intronic
1063582199 10:7318135-7318157 ATGCTGGGAAGAAGAGAAAGTGG + Intronic
1066501353 10:35997799-35997821 CTGGATGGATGAAGAGAAACAGG + Intergenic
1067276834 10:44843113-44843135 ATGCATGGATGCAGAGAAATTGG + Intergenic
1067684462 10:48458293-48458315 CTGCTGGGAGGCCGAGAGTCAGG + Intronic
1067748007 10:48950966-48950988 CTGCTGGGTTGCAGAGAGGCAGG + Intronic
1068246719 10:54381297-54381319 CTGCTGGGATAGGGAGAGACAGG - Intronic
1068563906 10:58549430-58549452 TGACTAGGATGCAGAGAAACAGG - Intronic
1069943250 10:71969603-71969625 GTGCTGAGCTGCAAAGAAACTGG + Intronic
1070672295 10:78386534-78386556 CAGCTGGGCCTCAGAGAAACAGG - Intergenic
1071230066 10:83576145-83576167 TAGCTAGGATGCAGAGAAAAGGG - Intergenic
1071372037 10:84961621-84961643 CGGCAAGGATGCAGAGAAACTGG - Intergenic
1071591511 10:86878769-86878791 CTACTGGAAAACAGAGAAACAGG + Intronic
1072743794 10:97926159-97926181 CTTCTGGGCTCCACAGAAACAGG - Intronic
1073332650 10:102680568-102680590 CTTCTGGGATGCAGAGATTTGGG - Intronic
1073460571 10:103663559-103663581 ATGCTGGGCTCCAGAGAGACAGG + Intronic
1073610849 10:104941258-104941280 CTCCTGGGATGCAGCTCAACAGG + Intronic
1073681924 10:105714239-105714261 CTTCTGGGAAGCAGTGAGACTGG - Intergenic
1074506432 10:114075048-114075070 CAGCAAGGACGCAGAGAAACTGG - Intergenic
1074573999 10:114651433-114651455 CTGCTGGGCCTCAGAGAAACTGG + Intronic
1075382449 10:122030447-122030469 CTGCAAGGATGCAGTGACACAGG - Intronic
1076813251 10:132899856-132899878 CTGCAGGGATGCAGGGCAAGGGG + Intronic
1076822565 10:132946731-132946753 GTGCTGGGATGCTGAGATGCTGG - Intergenic
1076822573 10:132946763-132946785 GTGCTGGGATGCTGAGATGCTGG - Intergenic
1076822596 10:132946851-132946873 GTGCTGGGATGCTGAGATGCTGG - Intergenic
1076869027 10:133183691-133183713 CATCTGGGTTGCAGAGAACCAGG - Intronic
1076946904 10:133657829-133657851 CTGTTTGAATGCAGAGAAAGTGG + Intergenic
1077538344 11:3134981-3135003 GGGCTGGGGTGCAGAGAAAGGGG - Intronic
1077726740 11:4682513-4682535 CTGCAAGCATGCAGAGAAAGAGG + Exonic
1077864473 11:6211159-6211181 CTTCTGGGATCCAGAGAAGAGGG + Intergenic
1078237945 11:9503489-9503511 TAGCTGGGATGTGGAGAAACTGG - Intronic
1079982517 11:27166103-27166125 CTCCTGGGTTGGAGAGAAACAGG - Intergenic
1080233919 11:30047004-30047026 TTGCTAAGATGCAGAGACACAGG - Intergenic
1080800033 11:35601889-35601911 GTGCAGGGATGGAGAGAATCTGG - Intergenic
1080929279 11:36791052-36791074 GTGCTGGGATGCGGAGCAAGAGG - Intergenic
1081761825 11:45582025-45582047 CTGCTGGGAAGAAGACAAAGTGG + Intergenic
1081780043 11:45703919-45703941 CTTTTTGGATCCAGAGAAACTGG - Intergenic
1081871773 11:46385975-46385997 CTGCTGGGTTGGACAGGAACTGG + Exonic
1082962897 11:58935621-58935643 CTGATTGGATGCCGTGAAACTGG - Intronic
1083424250 11:62574925-62574947 CTGGTGGGGTGGAGAGCAACAGG + Intronic
1083841767 11:65308856-65308878 CTGCTGGGATGCAGGGTGGCAGG - Intergenic
1084101598 11:66953234-66953256 CTGCGGAGATGCAGAGAAAGCGG - Intronic
1084189156 11:67491172-67491194 CTGTTGGGAGGCAAAGAATCAGG + Intergenic
1084443853 11:69192038-69192060 CTGTTGAGAGGTAGAGAAACAGG - Intergenic
1084493772 11:69492112-69492134 CTGCTGGGATGAGAAGAGACTGG + Intergenic
1085398109 11:76217900-76217922 CTGCTGGCATGAAGAGCAACAGG + Intergenic
1085577070 11:77615262-77615284 CAGATGGGTAGCAGAGAAACTGG + Exonic
1085741876 11:79084225-79084247 TGGCAAGGATGCAGAGAAACTGG + Intronic
1085956785 11:81407785-81407807 CTACTGGGATGCATAAAATCTGG + Intergenic
1087747171 11:101961917-101961939 CTGCTTTGATGAAGATAAACTGG + Exonic
1088447640 11:109949444-109949466 TAGCAAGGATGCAGAGAAACTGG - Intergenic
1089257341 11:117200837-117200859 CTGCTGGGCTCCTGAGGAACAGG - Intronic
1089387261 11:118076612-118076634 CTTCTGGGATCCAGGGAAAGGGG + Intergenic
1089409779 11:118231021-118231043 GTGAAGGGATGCAGAGAGACAGG - Intronic
1089891026 11:121880864-121880886 CTGCTGGGATAAAGGGCAACTGG + Intergenic
1091661432 12:2386763-2386785 CTGCTGGGATGCAGAGAAACAGG - Intronic
1091738846 12:2945479-2945501 CTGCTGGGATACAGGCATACAGG + Intergenic
1091765250 12:3115922-3115944 CTGCAAGGATGTGGAGAAACTGG - Intronic
1092050802 12:5468716-5468738 ATGCTGGGATGTAGTGACACAGG + Intronic
1092731196 12:11536618-11536640 CATCTTGGATGCAGAGAAATAGG + Intergenic
1094155872 12:27336321-27336343 GGGCTGGGATGCTGAGAACCAGG - Intronic
1094677383 12:32634124-32634146 CTGCTTGGTTGCATAGAAAAGGG + Intronic
1095088986 12:38086733-38086755 CTGTTTGGTTGCAGAGAAAGTGG - Intergenic
1095865588 12:46968442-46968464 ATGCAAGGATGCAGAGAAATGGG - Intergenic
1096519818 12:52178573-52178595 ATTCTGGGATGCAAAGAAACCGG - Intronic
1098713655 12:73801258-73801280 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1099206797 12:79737782-79737804 CTGGTGGGAAGCAGAGCAAAAGG + Intergenic
1099307219 12:80972036-80972058 CTTATGGCATGCAGAGAAACAGG - Intronic
1100789579 12:98115741-98115763 CAGCTGGGATCCAAAGAGACAGG - Intergenic
1101008381 12:100425229-100425251 CTGCTGGACTGCAGAGAACCAGG + Intergenic
1101353736 12:103957146-103957168 CTGCAGGGATGCTGGGCAACAGG + Exonic
1101704053 12:107204004-107204026 CTGCAAGGATGTGGAGAAACTGG - Intergenic
1101820958 12:108184039-108184061 AGGCTGGGATGCAGGAAAACTGG + Intronic
1102925920 12:116826306-116826328 CTGCTTGGATTCAGATAAAGGGG - Intronic
1103852328 12:123941230-123941252 CTGTGGGAATGCAGAGGAACAGG - Intronic
1104015725 12:124960420-124960442 CAGCCTGGATGGAGAGAAACCGG + Exonic
1104135985 12:125939463-125939485 CTTTAGGGATTCAGAGAAACAGG - Intergenic
1104474599 12:129061178-129061200 CTGCTGATATGCAGGTAAACAGG - Intergenic
1104937028 12:132370909-132370931 TGGCAGGGATGCAGAGAAAAGGG - Intergenic
1104979593 12:132567870-132567892 CTGCTGAGTTAAAGAGAAACGGG + Intronic
1105062105 12:133162265-133162287 CTCCTGGGATGCAGATATGCAGG - Intronic
1105820317 13:24075153-24075175 GTGCTGTGATGAAGAGTAACTGG - Intronic
1109071396 13:57773350-57773372 TGGCAGGGATGCAGAGAAAATGG - Intergenic
1110233341 13:73190079-73190101 CTCCTGGGAATGAGAGAAACCGG + Intergenic
1113429580 13:110237754-110237776 ATGTTGAGATGCAGAGAGACAGG + Intronic
1113609102 13:111630733-111630755 GCCCTGGGAAGCAGAGAAACTGG - Intronic
1113644089 13:111980110-111980132 CTGCTGTGATGCTGAGAACAGGG + Intergenic
1113799813 13:113080529-113080551 CTTATGTGATGCACAGAAACTGG - Intronic
1114062372 14:19029977-19029999 TAGCAGGGATGCAGAGAAAAGGG - Intergenic
1114099886 14:19370016-19370038 TAGCAGGGATGCAGAGAAAAGGG + Intergenic
1114198598 14:20502038-20502060 CGGCAAGGAGGCAGAGAAACTGG - Intergenic
1114697123 14:24636429-24636451 CAGCAAGGATGCAGAGAAATAGG - Intergenic
1114954842 14:27805114-27805136 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1116918835 14:50550876-50550898 CCGCTGGGATACAGAAAAAATGG + Intronic
1117304312 14:54459121-54459143 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1117660589 14:58000325-58000347 AGGCTGGGATGGAGAGAAAAGGG - Intronic
1119467227 14:74867952-74867974 CCTCTGGGCTGCTGAGAAACAGG + Intronic
1120719655 14:87877167-87877189 CTGATGGGCTCCAGAGAGACAGG + Intronic
1120946024 14:89997741-89997763 CTCCTGGGTTGAAGAGCAACTGG + Intronic
1121008340 14:90504768-90504790 CACCTGGGATGCAGAGATGCGGG - Intergenic
1121821269 14:96969318-96969340 CTGTTAGGATGTAGAGAAAAGGG + Intergenic
1122185619 14:99992089-99992111 TGGCAAGGATGCAGAGAAACTGG - Intronic
1122311904 14:100802784-100802806 CCGCTGGGATGGAGTTAAACAGG + Intergenic
1122431243 14:101647606-101647628 CTTCTGGCATGCAGAGTAACAGG - Intergenic
1122543949 14:102512129-102512151 CTTCTAGGCAGCAGAGAAACAGG - Intergenic
1202920978 14_KI270723v1_random:30385-30407 CTGTTTGAATGCAGAGAAAGTGG + Intergenic
1202923939 14_KI270724v1_random:7196-7218 CTGTTTGAATGCAGAGAAAGTGG - Intergenic
1123459044 15:20451650-20451672 TGGCAGGGAAGCAGAGAAACTGG + Intergenic
1123659017 15:22548768-22548790 TGGCAGGGAAGCAGAGAAACTGG - Intergenic
1124265280 15:28227498-28227520 TGGCAGGGAAGCAGAGAAACTGG + Intronic
1124312882 15:28643260-28643282 TGGCAGGGAAGCAGAGAAACTGG - Intergenic
1125547925 15:40521620-40521642 CTGCGAGGATGTAGAGAAACTGG - Intergenic
1125567869 15:40691427-40691449 CTGCTAGGCTTCTGAGAAACTGG + Intergenic
1125571549 15:40723207-40723229 CTGGGAGGATGTAGAGAAACTGG + Intronic
1126142297 15:45448435-45448457 CTGCTGGGATGTAGAGGAGGGGG + Intronic
1127023561 15:54778112-54778134 TGGCTGGGATGCAGAGAAAAAGG - Intergenic
1127212140 15:56784289-56784311 CTGCTGGGATGCAGTCCAATAGG - Intronic
1127855652 15:62951341-62951363 CTGATGGTTTGCAGAGAAATTGG + Intergenic
1128774099 15:70306388-70306410 TGGCTAGGATGCAGAGAAACTGG - Intergenic
1129234725 15:74217294-74217316 CAGCAGGGATGCAGAGACCCAGG - Intergenic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1129846155 15:78768521-78768543 CAGCTGGGATGCAGAGGGTCTGG - Intronic
1130155422 15:81346069-81346091 CTGATGGGATTCAAAGAAATGGG + Intronic
1131594378 15:93781914-93781936 TTCCTGAGATCCAGAGAAACAGG + Intergenic
1131948349 15:97652491-97652513 TTGCAGGGATGCAGAGGAGCGGG + Intergenic
1132327439 15:100983530-100983552 CTGCCGGGATGCTCAGAAGCTGG - Exonic
1133686455 16:8169822-8169844 CATCTGGGAGGCAGAAAAACAGG + Intergenic
1133984509 16:10658127-10658149 TGACTAGGATGCAGAGAAACTGG + Intronic
1134449644 16:14355314-14355336 CTGCTGGGCTGCAGACCAGCTGG + Intergenic
1134478946 16:14600983-14601005 TTGCAAGGATGTAGAGAAACTGG + Intronic
1134625922 16:15722628-15722650 CTGATGGGAAGAGGAGAAACTGG + Intronic
1135840966 16:25875862-25875884 CTGGTGGGAAGCAGGGAATCAGG - Intronic
1136221815 16:28834206-28834228 GTGCAGGTATGCAGAGAGACTGG + Exonic
1137302093 16:47160715-47160737 CTGCTGGTATGCTGGTAAACTGG + Intronic
1137630784 16:49942706-49942728 CTGGAGGGATGTAGAGAAAAGGG + Intergenic
1137656378 16:50162444-50162466 TAGCAAGGATGCAGAGAAACTGG - Intronic
1139349719 16:66327477-66327499 CTGCGGGGAGGGAGAGGAACGGG + Intergenic
1141248356 16:82331986-82332008 CTGTGGGGATGCACAGAAAAGGG + Intergenic
1141568392 16:84918917-84918939 CCACTGGGATGGAGAGAAGCTGG + Intronic
1141752801 16:85970379-85970401 GTGCTGGGAAGAAGAGAAATGGG - Intergenic
1142160497 16:88554978-88555000 CAGCTGGGAGGCAGGGAGACAGG + Intergenic
1142668752 17:1477667-1477689 GTGCTGGGAGGCACAGACACAGG + Intronic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1143387005 17:6536923-6536945 CTGCTGGGCTGCAGAGGAGTTGG - Intronic
1143473405 17:7190310-7190332 CTGCAGGGATGCAGGGCCACAGG - Exonic
1144286373 17:13778671-13778693 CTGATGGGAAGCAAATAAACAGG + Intergenic
1144460913 17:15457995-15458017 CTGCTGGGAGGCAAAGGAAATGG - Intronic
1144627041 17:16849292-16849314 CTGCTGTGATGCAGAGCACCAGG - Intergenic
1144879400 17:18423420-18423442 CTGCTGTGATGCAGAGCACCAGG + Intergenic
1144939707 17:18929994-18930016 CTGGAGGGATGCAGAGAAACTGG - Intronic
1144950092 17:18989320-18989342 TTGCTGGGATGCGGAGATTCAGG + Intronic
1145152840 17:20520967-20520989 CTGCTGTGATGCAGAGCACCAGG - Intergenic
1145776011 17:27529486-27529508 CTGGAGGGCAGCAGAGAAACAGG - Intronic
1146102659 17:29999415-29999437 CTGATGGGAGGTAGAGAAAAAGG + Intronic
1147847849 17:43417786-43417808 CTGCAGGGAGGCAGAAAAGCGGG + Intergenic
1148784220 17:50137614-50137636 GTGCTGGGAGGCAGGCAAACTGG - Intronic
1151210226 17:72538928-72538950 CTGCTGCGCTGGAGAGAAACTGG + Intergenic
1151629489 17:75300869-75300891 CAGCGGGGATGGCGAGAAACTGG - Intergenic
1152271402 17:79327048-79327070 CTGCTGGGAAGCAGAGAGTGAGG - Intronic
1152687564 17:81702044-81702066 CAGCTGAGAAGCAGAGAAGCTGG - Exonic
1153136884 18:1927409-1927431 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1153362874 18:4217498-4217520 TGGCAAGGATGCAGAGAAACAGG - Intronic
1154337099 18:13474600-13474622 CTGCAGGGGAGCAGAGGAACTGG + Intronic
1155582329 18:27323844-27323866 CTGGGGAGATGCAGAGAAGCTGG - Intergenic
1156382864 18:36579707-36579729 CATCTTGGATGCAGAGAGACTGG + Intronic
1157511598 18:48279313-48279335 CTGCAGGGAGGCAGGGAACCTGG - Intronic
1157714186 18:49871827-49871849 CTGCTGGCATGCAGGGAGACAGG - Intronic
1158178193 18:54681613-54681635 TGGCATGGATGCAGAGAAACGGG - Intergenic
1158910359 18:62055052-62055074 TGGCAAGGATGCAGAGAAACTGG + Intronic
1160152641 18:76406763-76406785 CTGCTGTGATGGTGAGAAAGAGG - Intronic
1160618476 18:80152063-80152085 CGGCAAGGATGCAGAGAAAAGGG + Intronic
1161800001 19:6412257-6412279 CTGCCGGGATCTAGAGAAAGGGG - Intergenic
1162087157 19:8255743-8255765 CTTCTGGGGTGCAGGGAAGCGGG + Intronic
1162397020 19:10423111-10423133 CTGCTGGCATATGGAGAAACTGG + Intronic
1163718042 19:18883845-18883867 CCGCTGGGATGGGGTGAAACAGG - Intronic
1164435144 19:28222328-28222350 CTGCTGGGAAGATGGGAAACTGG - Intergenic
1164493771 19:28738576-28738598 ATGCTGCGATACAGAGAAACTGG + Intergenic
1164999673 19:32750878-32750900 CTGCTGGGATGCACTGAGAAGGG - Intronic
1165318685 19:35073301-35073323 GTGATGAGATGCAGATAAACTGG - Intergenic
1166609038 19:44172318-44172340 TTTGTGGGATGCAGAGACACTGG + Intronic
1166624268 19:44335573-44335595 CTCCTGGGTTGTACAGAAACAGG - Intronic
1167577040 19:50322890-50322912 CTGCCGGGGTTCAGAGAACCTGG - Intronic
1168184699 19:54692094-54692116 TGGCTAGGATGCAGAGAAAAGGG + Intronic
1168723745 19:58569659-58569681 GTGCTGGGATGCAGAGAGGTGGG + Intronic
925357951 2:3255673-3255695 CTGCTGGGATGTGCAGAGACAGG - Intronic
926320372 2:11745112-11745134 CTGCTGAGATGCAGAGGGCCAGG - Intronic
926634747 2:15167173-15167195 GCGCTGGGATGCAGAGGAGCTGG - Exonic
926635388 2:15173611-15173633 CTGATGGTATGCTGAGAAAATGG - Intronic
927294865 2:21442166-21442188 CTCCTGGGAGCCAGGGAAACAGG + Intergenic
927458349 2:23276562-23276584 CTGCTGGGAAGAAGAGGAAGTGG + Intergenic
927488975 2:23508050-23508072 CTGCTGGGAGGCTGAGAATAGGG - Intronic
928200035 2:29241946-29241968 CTGCTGGGATGCACAAAGAGAGG + Intronic
928409422 2:31043039-31043061 GTGCTGGGATGAGGAGAAAGGGG - Intronic
928942889 2:36744457-36744479 TTGGTGGGCTGCAGAGAAAAGGG - Intronic
929405562 2:41637421-41637443 CTGCTGGTCTGCAGAGACAATGG - Intergenic
929999379 2:46850627-46850649 ACCCTGGGATGCAGAGAAGCAGG - Intronic
932560497 2:72863273-72863295 GAGCTGGGAAGGAGAGAAACGGG + Intergenic
932833007 2:75008687-75008709 CTGAAGAGATGGAGAGAAACAGG - Intergenic
932935706 2:76098660-76098682 CAGCTGGGATGCAGGGCACCAGG + Intergenic
932954683 2:76337560-76337582 CTGCTGGGAGGCAGGTAACCTGG - Intergenic
933423052 2:82076390-82076412 CTTCTAGGATGCAGGAAAACTGG + Intergenic
933687925 2:85157973-85157995 CTTCTGGGATGGAGAGAGCCTGG + Intronic
935205767 2:100895546-100895568 CTGCTGGCAGGCAGAGCTACTGG - Intronic
935551186 2:104457113-104457135 CAGTGAGGATGCAGAGAAACTGG - Intergenic
936118056 2:109718079-109718101 TGGCAGGAATGCAGAGAAACTGG + Intergenic
936273768 2:111072894-111072916 CAGCTAGGATGCTGAGTAACTGG - Intronic
936621360 2:114101572-114101594 CTGCTGTTATGCAGGCAAACAGG - Intergenic
937168979 2:119845846-119845868 TTGATGGGATGCAGGTAAACTGG - Intronic
937434173 2:121866690-121866712 CTGCTGGGAAGCAGAGCATGAGG + Intergenic
938464069 2:131515491-131515513 CTGTGGGGAAGCAGAGCAACTGG + Intergenic
938479735 2:131650191-131650213 TAGCAGGGATGCAGAGAAAAGGG - Intergenic
940587724 2:155675333-155675355 TGGCAGGGATGCAGAGAAAAGGG + Intergenic
940692822 2:156940850-156940872 CTGCAGGGATGTTGAGAAAGAGG - Intergenic
942557529 2:177187138-177187160 GTGCTGTGCTGCAGAGAAATGGG - Intergenic
943225591 2:185169974-185169996 CTGCTAGGTTGCAGAGAAAAGGG - Intergenic
944742434 2:202625537-202625559 ATGCTGGGAAGAAGAGAAAAGGG - Intergenic
944962409 2:204890121-204890143 CTGCTGGCATGCGGAGAAGGCGG - Intronic
945267786 2:207908309-207908331 TGGCAAGGATGCAGAGAAACTGG - Intronic
945362541 2:208908547-208908569 CAGCTGGGATGCAAAGCATCAGG + Intergenic
945487720 2:210417268-210417290 CTGCTGAGATGCACACAAATTGG + Intergenic
945740359 2:213652527-213652549 CGCAAGGGATGCAGAGAAACTGG - Intronic
945858495 2:215094391-215094413 CTGATGAGAAGCAGAAAAACTGG - Intronic
946284467 2:218692689-218692711 CTGCTGGGATGCCAAGGAGCAGG + Exonic
946711404 2:222510744-222510766 TTGCGGGGATGAAGACAAACAGG + Intronic
946962156 2:224996908-224996930 CTGCTGCCTTGCAGAGAAGCTGG + Intronic
947384972 2:229581827-229581849 CTGCTCTGTTGCATAGAAACAGG + Intronic
948224274 2:236296871-236296893 TGGCGAGGATGCAGAGAAACTGG + Intergenic
948360807 2:237418834-237418856 ATTCTGGGAGGCAGGGAAACAGG - Intergenic
948896717 2:240931093-240931115 CCGCTGGGACGCAGAGAAGGTGG + Exonic
1171306773 20:24113375-24113397 CTGCTGGGCTCAAGAGAATCTGG - Intergenic
1171476521 20:25413617-25413639 TTGGTGAGATGCGGAGAAACTGG - Intronic
1171796246 20:29568704-29568726 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1171851991 20:30315463-30315485 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1171958673 20:31477889-31477911 CACCTGGGAGGCCGAGAAACTGG + Exonic
1172285026 20:33734219-33734241 CTCCTGGGATTCACAGAAGCTGG + Intronic
1172447384 20:35000329-35000351 CTCCCTGGATGCAGAGACACGGG + Exonic
1172648568 20:36487048-36487070 CTGCTGGGGTGGAGAGACGCTGG + Intronic
1172838860 20:37890029-37890051 CAGCTGGGATGCAGTGAGGCTGG + Intergenic
1173817711 20:46000438-46000460 GTGCTGGGATGCAGGGAAGATGG - Intergenic
1174838858 20:53882885-53882907 CGGCAAGGATGTAGAGAAACGGG - Intergenic
1175222734 20:57426650-57426672 ATGGTGGGATGCAGAGACACTGG + Intergenic
1175818390 20:61895633-61895655 CTGCTGGAATCCAGAGGAAGTGG - Intronic
1176317108 21:5256826-5256848 CTGCTGATATGCAGGCAAACAGG - Intergenic
1176444191 21:6804297-6804319 TAGCAGGGATGCAGAGAAAAGGG - Intergenic
1176822357 21:13669335-13669357 TAGCAGGGATGCAGAGAAAATGG - Intergenic
1178395926 21:32243564-32243586 CGGTGAGGATGCAGAGAAACTGG + Intergenic
1179601992 21:42485444-42485466 GTACTGAGATCCAGAGAAACGGG + Intronic
1179891053 21:44335302-44335324 GTCATGGGGTGCAGAGAAACTGG + Intronic
1180480865 22:15752604-15752626 TAGCAGGGATGCAGAGAAAAGGG - Intergenic
1180880974 22:19203379-19203401 CTGATGGGAAGCATGGAAACAGG - Intronic
1181740444 22:24917328-24917350 TGGCGAGGATGCAGAGAAACTGG - Intronic
1183455145 22:37918561-37918583 GTGCTTGGATGTAGAGAAACTGG + Intronic
1183740330 22:39665326-39665348 CTCCAGGAATGCAGAGAAAGTGG - Intronic
1184465394 22:44666250-44666272 TGGTAGGGATGCAGAGAAACTGG + Intergenic
1184993841 22:48188267-48188289 CTGCTGGGATGCTGAGGGATGGG - Intergenic
949470090 3:4385272-4385294 TGGCTAGGATACAGAGAAACTGG - Intronic
950138260 3:10598288-10598310 CAGTTTGGAAGCAGAGAAACTGG - Intronic
950507840 3:13406765-13406787 CTGCTGAGGTGCAGAGAAGAAGG - Intronic
953812177 3:46122551-46122573 TGGCCAGGATGCAGAGAAACTGG - Intergenic
954517178 3:51189076-51189098 TTGCATGGATGCAGAGAAAAGGG - Intronic
954946004 3:54424904-54424926 CAGATGGGATGCAGAGACACAGG - Intronic
955356140 3:58234743-58234765 CTGCTGGGAGGCAGTGATACTGG + Intergenic
957080555 3:75632587-75632609 CTGTTTGAATGCAGAGAAAGTGG - Intergenic
958004409 3:87793222-87793244 CCGCTGGGGTGGAGAGAGACGGG + Intergenic
958017249 3:87953543-87953565 CAGCAAGGATGCAGAGAAAAGGG + Intergenic
958135549 3:89485165-89485187 CTGCTGGGCAGTAGAGAAAAGGG - Intergenic
960382010 3:116974458-116974480 CTGCAGGGCTGCAGACAAGCTGG - Intronic
960442967 3:117711536-117711558 CTACTTTAATGCAGAGAAACAGG + Intergenic
960782637 3:121336615-121336637 CTGCAAGGTTGCAGAGAAAAGGG + Intronic
961421998 3:126813740-126813762 CTGCTAGTAAGCAAAGAAACAGG - Intronic
961773793 3:129269319-129269341 GTGCTGGGATTCAAAGACACTGG + Intronic
962188221 3:133282397-133282419 CTGCTGGATTCCAGAGATACAGG + Intronic
962940605 3:140121535-140121557 TTGCAGAGATGCAGAGAAAAGGG + Intronic
963143516 3:141967924-141967946 CTGTTGGCATGCTGATAAACAGG + Intronic
963504118 3:146162869-146162891 CACCTGTGATGCAGAGAAGCCGG - Intronic
963769327 3:149373595-149373617 CTGCTGACATGCAGAAAGACAGG - Intronic
964392230 3:156210018-156210040 CTGCAGGGAAGCAGGGAAACTGG - Intronic
964443316 3:156734834-156734856 CGGCTGGGCTGCAGAGAAAAAGG + Intergenic
965466035 3:169031739-169031761 ATGCAGGGATGCAGAGCAGCAGG - Intergenic
965876449 3:173328164-173328186 TGGCTATGATGCAGAGAAACTGG - Intergenic
965952310 3:174325128-174325150 CTGATAGGAAGCAAAGAAACAGG + Intergenic
965976288 3:174627441-174627463 CTGCAAGGATGCAGAGACAAAGG + Intronic
966010345 3:175067599-175067621 CTGCAGGGCTGCAGAGAAAAAGG + Intronic
966695773 3:182789465-182789487 GTGCTGTGATGCAGGGAAACTGG - Intergenic
967928002 3:194667554-194667576 CAGCTGGAATCTAGAGAAACAGG - Intronic
968075119 3:195812053-195812075 CTGATGAGAAGCAGAGCAACGGG - Exonic
968982456 4:3857613-3857635 CTGCAGGGGTGCAGAGATGCAGG + Intergenic
969352821 4:6607830-6607852 CTGCTGGGAGGAACAGAAAATGG - Intronic
971035455 4:22688269-22688291 ATGCTGTGATACAGAGAACCAGG + Intergenic
971755822 4:30706905-30706927 CAGCTAGGATGCAGAGACAAAGG - Intergenic
971985022 4:33810928-33810950 CTGCTGAGGTGCTTAGAAACTGG + Intergenic
972115649 4:35630064-35630086 CAGTAAGGATGCAGAGAAACTGG + Intergenic
973689312 4:53409268-53409290 CTGCTGGTATCCAGGCAAACAGG - Intronic
973797397 4:54442019-54442041 CAGCTGGGAGGTGGAGAAACAGG - Intergenic
976143764 4:82020420-82020442 CTGCTGGTATCCAGGCAAACAGG + Intronic
976833274 4:89339958-89339980 CAGCTGGGAAGCAGGGAGACAGG - Intergenic
977571889 4:98637388-98637410 CTGCTGGAATCCAGGGATACAGG - Intronic
978234313 4:106439417-106439439 TGGCAAGGATGCAGAGAAACTGG - Intergenic
978645394 4:110925079-110925101 CAGCAGAGATGGAGAGAAACTGG - Intergenic
978888880 4:113798012-113798034 TGGCTAGGATGCAGAGAAAAAGG + Intergenic
979059907 4:116044288-116044310 CTCCTGCCATGCAGAGAGACTGG - Intergenic
979524367 4:121701888-121701910 CTGCTGGGATGTAGAGATGATGG - Intergenic
980003927 4:127519489-127519511 CTGCTGGGATTCAGAGAGTCTGG + Intergenic
980340588 4:131540342-131540364 CTGCTGGGATGAGGAGGAGCTGG + Intergenic
981187073 4:141816205-141816227 CTGCTGGTCTGCAGAGACTCTGG - Intergenic
984982724 4:185298633-185298655 TGGCTGGAATGCAGAGAGACAGG - Intronic
985108696 4:186524868-186524890 CTTCTGGGATGCTGTGAAAACGG - Intronic
985393459 4:189515693-189515715 GTGCTGAGATGGAGAGCAACTGG + Intergenic
985516628 5:348949-348971 CGGCGGGGATGCAGAGAAACTGG - Intronic
986158294 5:5198937-5198959 GTGGTGAGATGCAGAGAAAAGGG - Intronic
986498567 5:8373151-8373173 ATGCTAGGATGCAGTGAAATTGG + Intergenic
986547769 5:8917908-8917930 CTGCTGGGATGTAAAGAGAGAGG + Intergenic
986911635 5:12565055-12565077 CAGCTGGGATGCAGGGCACCAGG + Intergenic
987275636 5:16359511-16359533 CTGCAAGGATGCAGAGAAATAGG + Intergenic
987519308 5:18958687-18958709 ATGCTGGGGGTCAGAGAAACAGG - Intergenic
987709068 5:21486134-21486156 CAGCTGGGATGCAGGGCACCAGG + Intergenic
987760226 5:22152163-22152185 CTGCTGGGCTCCAGAGAGAAGGG + Intronic
988750544 5:34188019-34188041 CAGCTGGGATGCAGGGCACCAGG - Intergenic
989091855 5:37742221-37742243 TGGCCAGGATGCAGAGAAACTGG - Intronic
990487202 5:56270936-56270958 TTGCTGGGAACAAGAGAAACGGG - Intergenic
990551102 5:56879810-56879832 CTGCTGGGATAGAAAGAAATAGG - Intronic
990760243 5:59121574-59121596 TGGCTAGGATGCAGAGAAAAGGG + Intronic
991154881 5:63421295-63421317 CTGTTGGGATGGGGAAAAACAGG + Intergenic
992272787 5:75082867-75082889 TTGCAGAGATGCAGAAAAACTGG + Intronic
992521233 5:77553797-77553819 TGGCAAGGATGCAGAGAAACTGG + Intronic
992774425 5:80077175-80077197 CTGCAGCTATGCAGAGAAGCTGG - Intronic
993075797 5:83228994-83229016 TTCCTGTGGTGCAGAGAAACAGG + Intronic
993371400 5:87097124-87097146 ATGGTGGGATGAAGAGAAATAGG - Intergenic
994073035 5:95621761-95621783 CTGTAGGGAAGAAGAGAAACTGG - Exonic
995080707 5:108047825-108047847 CTGCTGGTCTGCAGAGACAGTGG - Intronic
995799384 5:115977339-115977361 CTGCTTCGAGGCAGAAAAACAGG + Intronic
995986126 5:118176380-118176402 CTGCTGGGAAGCATTGAAATTGG + Intergenic
997173109 5:131745208-131745230 CTGCTGGTATGAATACAAACTGG + Intronic
997296025 5:132768968-132768990 CTCTTTGGATGCAGAGGAACAGG + Intronic
998536543 5:142937403-142937425 CGGCAAGGATGCAGAGAAACTGG + Intronic
998692673 5:144604409-144604431 TTGCTGGGATGGACAGAGACTGG + Intergenic
999057265 5:148591806-148591828 CTGCAAGGTTGCAGAGAAAAGGG + Intronic
1001839663 5:174864587-174864609 CTGCTGGTCTGCAGAGACAGTGG + Intergenic
1001970900 5:175954194-175954216 CAGCTGTGAGGCAGAGAAGCAGG - Intronic
1002246537 5:177889571-177889593 CAGCTGTGAGGCAGAGAAGCAGG + Intergenic
1002282759 5:178142568-178142590 CTGGAGGGCTGCAGAGAAAGTGG - Exonic
1002384083 5:178852706-178852728 CTGCTGGAATGCAGTGAGTCAGG - Intergenic
1002778748 6:350438-350460 GTGGTGGAATTCAGAGAAACTGG - Exonic
1003258923 6:4498308-4498330 CTCCAGGGATGCAAAGAAGCTGG + Intergenic
1003300358 6:4875160-4875182 CTGCTAGGATGCAGGACAACAGG - Intronic
1003427518 6:6007487-6007509 CTGCTGGGTTGGAGAAAAAGAGG - Intronic
1003558846 6:7164486-7164508 CTGATGGGATGCCAAGAAAATGG + Intronic
1003568124 6:7237745-7237767 TTGCAGGGATGCAGGAAAACGGG - Intronic
1003824513 6:9938312-9938334 CTGCGGGAATGCAGAGAACTGGG - Intronic
1006446330 6:34081775-34081797 CTCCAGGGATGCAGAGAAAAAGG + Intronic
1008637375 6:53424350-53424372 CAGATGGGATACAGACAAACAGG - Intergenic
1008777032 6:55052390-55052412 CAGCATGGATGCAGAGAAAGTGG - Intergenic
1010449238 6:75984074-75984096 CTGGTGAGATGCGGAGAAAGGGG + Intronic
1010602437 6:77846783-77846805 TTTATGGGATACAGAGAAACTGG + Intronic
1010722969 6:79304519-79304541 CTGCTTGGATGCAGAGCATCTGG - Intergenic
1010821677 6:80422138-80422160 CAGCTGGGATGCAGGGTACCAGG - Intergenic
1010867407 6:80996069-80996091 CTGGTGAGATGTAGAGAAAAGGG - Intergenic
1011699794 6:89945029-89945051 TGGCGAGGATGCAGAGAAACTGG + Intronic
1013076265 6:106774484-106774506 CTGCTGGGAGGCAGGCACACTGG - Intergenic
1014135475 6:117884140-117884162 CTGCTGCTATGCAAAGACACTGG - Intergenic
1015873466 6:137799948-137799970 CAGCTGAGATGTAGAGAAAAGGG - Intergenic
1015993393 6:138972027-138972049 TTGCTGGGATATAGAGATACTGG + Intronic
1016055563 6:139574575-139574597 CTGGCGGGTTGCAGAGAAAAAGG - Intergenic
1016155584 6:140803457-140803479 GTGCTGGGATGCAGATAGTCAGG - Intergenic
1016787910 6:148033534-148033556 TAGCAAGGATGCAGAGAAACTGG + Intergenic
1016792199 6:148077711-148077733 TTCCTGGGATGCAGAGATGCTGG + Intergenic
1017673242 6:156787878-156787900 CTGCTGGAGTGCAGAGAAAATGG - Intronic
1017741063 6:157407209-157407231 CTGCTGGGTTGCAGAGCTGCTGG + Intronic
1018717956 6:166549180-166549202 CGGTGAGGATGCAGAGAAACTGG + Intronic
1019351684 7:557011-557033 CTCCTGAGCTGCAGAGAACCAGG + Intronic
1019425765 7:975829-975851 CACCTGGGATGCAGAGACGCCGG - Intergenic
1019498183 7:1350658-1350680 CTGCTGGTAGGCAGGGAAAAAGG - Intergenic
1019575883 7:1737414-1737436 CTGCTGGGATTCAGAGCCAGGGG - Intronic
1019604564 7:1901955-1901977 TTGCAGGGATGCAGGGACACAGG + Intronic
1020683655 7:11267604-11267626 AAGCTGGGATGCAAAGAAGCAGG - Intergenic
1020949360 7:14655394-14655416 TGGCTAGGATGCAGAGAAAAGGG + Intronic
1021431686 7:20566781-20566803 TGGCTAGGATGTAGAGAAACTGG + Intergenic
1021543865 7:21791082-21791104 CTGATGAGATACAGAGAGACGGG + Intronic
1021693225 7:23249928-23249950 TTGCAAGGATGTAGAGAAACTGG - Intronic
1023476827 7:40589381-40589403 CATCTTGGAAGCAGAGAAACTGG - Intronic
1023513419 7:40977210-40977232 CTGCTGGGAGGGAGAGAAAAGGG + Intergenic
1023887062 7:44366382-44366404 GAGCAAGGATGCAGAGAAACTGG + Intergenic
1024116758 7:46201481-46201503 CACCTTGGAAGCAGAGAAACTGG + Intergenic
1024701795 7:51911705-51911727 CACCTGGGCTGCAGAGACACTGG - Intergenic
1025152861 7:56574073-56574095 CTCCTGAGATGCAGAGATAGGGG - Intergenic
1028589527 7:92480690-92480712 CTGATGGGAAGGAGAAAAACTGG + Intergenic
1028599204 7:92582841-92582863 TAGCAAGGATGCAGAGAAACTGG + Intronic
1028716973 7:93981915-93981937 CAGCTGGGAAGCAAAGAAAGCGG + Intronic
1029141385 7:98412995-98413017 CAGGTGGGATGCAGACAAAAAGG - Intergenic
1029415805 7:100442429-100442451 CTGCTGGGATGCAGAAAAGTTGG + Intergenic
1029528533 7:101110041-101110063 CAGCTGAGATACGGAGAAACAGG + Intergenic
1030914379 7:115294646-115294668 ATGCTGGCTTGCAGAGAAAAGGG + Intergenic
1032057159 7:128692767-128692789 CGGCAGGGAAGCAGAGAAGCTGG + Intergenic
1032106756 7:129038105-129038127 CTGAAGGGAAGCAGAGAAAAAGG + Intronic
1032195546 7:129786325-129786347 CTGCTGGGATGCCTAGAAAGAGG + Intergenic
1032677602 7:134145652-134145674 TTGCTGGGAGGCAGCGGAACTGG + Intronic
1034440314 7:151082729-151082751 CGACTGGGAGGCAGAGAAGCCGG - Intronic
1034487594 7:151375722-151375744 CTGCTATGAGGCAGAGAAAGGGG - Intronic
1034540153 7:151752986-151753008 CTGCTGGGATGCAGAAGCCCAGG + Intronic
1035006099 7:155662330-155662352 CTGCTGTGCTGGAGAGAAATGGG - Intronic
1035613089 8:981558-981580 CGGAGAGGATGCAGAGAAACTGG - Intergenic
1035700378 8:1634343-1634365 CTGCTGGGAGCCAGAGAGCCAGG - Intronic
1036647520 8:10620951-10620973 CTGGTGGGAGACAGAGGAACAGG + Intronic
1037015466 8:13900773-13900795 CTACAGTGATGCAGAGAAAATGG + Intergenic
1037571995 8:20165692-20165714 CTGCTGGGATGCTTGGAAAGAGG - Intronic
1037936683 8:22919748-22919770 CTTCTGGGCTGGAGAGAAGCTGG - Intronic
1038101057 8:24376328-24376350 AAGCAAGGATGCAGAGAAACTGG + Intergenic
1038231104 8:25701106-25701128 ATGCTGGGAAGCAGAGCCACTGG - Intergenic
1038516804 8:28194248-28194270 CTGCTGGGATGCTGATAATAGGG - Intergenic
1039086007 8:33780576-33780598 CTGCAAGGCTGCAGAGAAAAGGG - Intergenic
1039738446 8:40357471-40357493 TGGCTAGGTTGCAGAGAAACGGG + Intergenic
1040582919 8:48712135-48712157 CTGCTGGGAGGCAGTGACTCAGG + Intronic
1040754395 8:50754333-50754355 TTGCAGGGATGTAGAGAAACTGG - Intronic
1041057671 8:54004141-54004163 TTGCAAGGATGCAGAGAAACTGG + Intronic
1042178784 8:66063962-66063984 ATGCTGGCCAGCAGAGAAACAGG + Intronic
1042193746 8:66214144-66214166 CTGCTGAGATTCACAGAACCGGG - Intergenic
1042943803 8:74134498-74134520 CGGCTAGGAAGCAGAGAAAAGGG + Intergenic
1043235001 8:77853461-77853483 TTGCGAGGATGCAGAGAAATGGG - Intergenic
1043689553 8:83133026-83133048 CTGATGAGATGTAGAGAAATGGG + Intergenic
1047598921 8:126407181-126407203 CTGCAGGAATGCAGAGGAAGGGG + Intergenic
1047696915 8:127412860-127412882 ATGGTTGGATGCAGAGAAACTGG - Intergenic
1049277733 8:141728352-141728374 CAGCTGGGAGGCAGAGAAGTGGG - Intergenic
1049520210 8:143084105-143084127 TGGCTGGGATGCAGAGCGACGGG - Intergenic
1049639817 8:143710423-143710445 CTGCAGGGATGCAGGGATGCAGG - Intronic
1050520232 9:6489548-6489570 CTGGTGAGATGCAGAGAAACTGG - Intronic
1051590716 9:18774463-18774485 CTGGGTGGGTGCAGAGAAACAGG - Intronic
1053503194 9:38620015-38620037 CTGCCGGGCTGCAGGGAAGCCGG + Intergenic
1053523029 9:38800858-38800880 CTTCTGGGATACAGCAAAACTGG + Intergenic
1053675364 9:40420556-40420578 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1053789774 9:41678717-41678739 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1053925153 9:43046893-43046915 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1054155367 9:61636036-61636058 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054178114 9:61890407-61890429 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054195254 9:62025278-62025300 CTTCTGGGATACAGCAAAACTGG + Intergenic
1054288636 9:63259082-63259104 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1054386462 9:64560619-64560641 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1054475153 9:65567147-65567169 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054509258 9:65955736-65955758 CAGCTGGGATGCAGGGCACCAGG + Intergenic
1054643154 9:67563411-67563433 CTTCTGGGATACAGCAAAACTGG - Intergenic
1054659415 9:67690417-67690439 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1056114415 9:83427902-83427924 TTGGTGGGATGCAGAGAAACTGG + Intronic
1056444969 9:86656716-86656738 ATTCTGGGAAGCAGAGAAAAAGG - Intergenic
1056579457 9:87880454-87880476 CTGCAGGGAAGCAGAGGAAAGGG - Intergenic
1056703401 9:88931095-88931117 TTGCTGTGATGCAGAGATGCTGG - Intergenic
1056762588 9:89425734-89425756 CTGCTGGGAAGAGGAAAAACAGG + Intronic
1056878259 9:90360063-90360085 TGGCAAGGATGCAGAGAAACTGG - Intergenic
1057139168 9:92716467-92716489 CTGCAGGGATACTGAGAAACTGG + Intronic
1057312761 9:93952208-93952230 CGCCAAGGATGCAGAGAAACCGG - Exonic
1057568251 9:96183962-96183984 CAGCTGGGAAGCAGTGAAGCTGG + Intergenic
1057736105 9:97662577-97662599 CTTCTGCCAAGCAGAGAAACTGG + Intronic
1057889596 9:98859178-98859200 TTGCAAGGATGCAGAGAAAGAGG - Intergenic
1058791215 9:108447682-108447704 GTGCTGGGATGTGGAGAAACAGG + Intergenic
1059820808 9:117970007-117970029 CTGATGGAATGGACAGAAACTGG - Intergenic
1060051211 9:120379729-120379751 CAGCTGAGATGGAGAGACACAGG + Intergenic
1060401531 9:123352617-123352639 CTGCTGGGAAGTGGAGAAGCCGG + Intergenic
1061775163 9:132958136-132958158 CTGCTGGGGTGTAGAGAATGGGG + Intronic
1203525008 Un_GL000213v1:80230-80252 TAGCAGGGATGCAGAGAAAAGGG + Intergenic
1203415372 Un_KI270582v1:1874-1896 CTGCTGATATGCAGGCAAACAGG - Intergenic
1185506283 X:634085-634107 CTGCTGTTCTGCTGAGAAACAGG + Intronic
1186063751 X:5739435-5739457 CTGCAGGGCTGCTGAGAGACAGG - Intergenic
1186108686 X:6232471-6232493 CTATTGGGATGCTGAGAAAATGG + Intergenic
1186324015 X:8459129-8459151 CGGCTGGGACACAGGGAAACAGG + Intergenic
1186969867 X:14830093-14830115 CTGATGAGAGGGAGAGAAACAGG + Intergenic
1187283970 X:17885056-17885078 CTGCTGGGATAAAAAGTAACAGG - Intergenic
1187326941 X:18299707-18299729 TGGCTAGGATGCAGAGAAAAGGG + Intronic
1189741829 X:44125639-44125661 TGGCTAGGATGCAGAGCAACTGG - Intergenic
1190842939 X:54163028-54163050 TGGCAAGGATGCAGAGAAACTGG + Intronic
1190886092 X:54531832-54531854 ACTCTGGGGTGCAGAGAAACTGG - Intronic
1190967705 X:55317354-55317376 ATGGTGAGATGCAGAGAAACTGG - Intergenic
1192210052 X:69122043-69122065 CTCCTGGTATGCAGGGAAAATGG + Intergenic
1192397518 X:70796970-70796992 TAGCTGGGCTGCAGAGAAAAGGG + Intronic
1192442309 X:71183553-71183575 CTGCTGGGGTGGAGAGTAAGTGG + Intergenic
1192916190 X:75653543-75653565 ATGCAAGGATGCAGAGAAACTGG + Intergenic
1193010041 X:76665997-76666019 CTGCAGGGCTGCAGCGAGACTGG - Intergenic
1193297266 X:79847643-79847665 TAGCTAGGATGCAGAGAAAAAGG + Intergenic
1193399681 X:81027693-81027715 CTGCTGGTATCCAGGCAAACAGG + Intergenic
1193969339 X:88032503-88032525 CTGGTGAGGTGCAGAGAAAAGGG + Intergenic
1194153326 X:90353776-90353798 TGGCTAGGATGCAGAGAAATGGG - Intergenic
1194417184 X:93628187-93628209 CTGCTGGTACCCAGGGAAACAGG + Intergenic
1194441629 X:93940602-93940624 CTGCTGGTACCCAGGGAAACAGG + Intergenic
1195002706 X:100657309-100657331 CGGCCAGGATGCAGAGAAAAGGG - Intronic
1195304647 X:103568865-103568887 TGGCAAGGATGCAGAGAAACTGG + Intergenic
1195791134 X:108587753-108587775 CTGCAAGGATGCAGAGAAGAGGG - Intronic
1196187584 X:112761205-112761227 TTCCAGGGATGCAGAGGAACAGG - Intergenic
1197112089 X:122788513-122788535 CTAGTGTGATGAAGAGAAACAGG + Intergenic
1197819165 X:130528902-130528924 CTCCTGGGTTCCAGAGAACCAGG - Intergenic
1199078389 X:143549593-143549615 CTGCTGAGATGGAGGGAAAAAGG + Intergenic
1199167242 X:144691299-144691321 TGGCGGGGATGCAGAGAAATAGG - Intergenic
1199563099 X:149185307-149185329 CAGCAAGGATGCAGAGAAACAGG + Intergenic
1199609693 X:149601913-149601935 CTGGGAGGATGCAGAGGAACTGG - Intronic
1199629423 X:149767439-149767461 CTGGGAGGATGCAGAGGAACTGG + Intergenic
1199869762 X:151887984-151888006 TGGCTGGGATGCAGAGCACCAGG - Intergenic
1200176985 X:154123807-154123829 GTCCTGGGATGGAGAGAACCAGG + Intergenic
1200364805 X:155651040-155651062 TGGTTAGGATGCAGAGAAACTGG - Intronic
1200499664 Y:3930564-3930586 TGGCTAGGATGCAGAGAAATGGG - Intergenic