ID: 1091667601

View in Genome Browser
Species Human (GRCh38)
Location 12:2430644-2430666
Sequence GCTTGGGTTTACAGGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091667601_1091667613 27 Left 1091667601 12:2430644-2430666 CCCTTTCCCCTGTAAACCCAAGC 0: 1
1: 1
2: 2
3: 14
4: 183
Right 1091667613 12:2430694-2430716 CTTACTGGTATACTCCTTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 102
1091667601_1091667611 12 Left 1091667601 12:2430644-2430666 CCCTTTCCCCTGTAAACCCAAGC 0: 1
1: 1
2: 2
3: 14
4: 183
Right 1091667611 12:2430679-2430701 GTTCTTCAGATGCCGCTTACTGG 0: 1
1: 0
2: 1
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091667601 Original CRISPR GCTTGGGTTTACAGGGGAAA GGG (reversed) Intronic
903374147 1:22855200-22855222 GCCTGGGTTCACAGAGCAAATGG + Intronic
905090370 1:35426261-35426283 ACTTGGGTTAAAAAGGGAAATGG - Intergenic
906076421 1:43055434-43055456 TCTAGGGTTGACAAGGGAAATGG + Intergenic
912626235 1:111206603-111206625 GTTTGGCTTTAAATGGGAAAAGG + Intronic
912956346 1:114156453-114156475 GGTTGGGTTTGCAGGGCAAAGGG - Intergenic
913533616 1:119750660-119750682 GATTGGGGTGACAGGAGAAATGG - Intronic
916077315 1:161209372-161209394 GCTTGGGTTCAACGGGGAAGTGG - Intronic
917428267 1:174938105-174938127 CCTTGGATGTAGAGGGGAAATGG + Intronic
920349857 1:205330541-205330563 GCTTGGGGTTCCAGAGGGAAGGG + Intergenic
923147686 1:231209567-231209589 GCTTGGGTTGACAGTTGAAAAGG - Intronic
924541142 1:244981802-244981824 GGTTGGTTTAACAGGGGAAGGGG + Intronic
1063708790 10:8457120-8457142 GCTGGGGAGTACAGGGGAGAAGG - Intergenic
1065901633 10:30213450-30213472 CCTTGGGTTTATAGGGAATAAGG - Intergenic
1070772011 10:79088117-79088139 GCTTTGGCTGGCAGGGGAAAGGG - Intronic
1073049783 10:100660105-100660127 CCTTGAGTTTCCAGTGGAAACGG + Intergenic
1073084102 10:100877364-100877386 GCATTGATCTACAGGGGAAATGG - Intergenic
1074558410 10:114513065-114513087 GGTTTGGTTTGCTGGGGAAAGGG - Intronic
1075287105 10:121196379-121196401 GCTTGGGTGAACAGAGAAAAGGG - Intergenic
1075799174 10:125142110-125142132 TCTTGGGTTTGCAGGGGACGGGG + Intronic
1077611674 11:3646800-3646822 GATCGGGTTTGGAGGGGAAATGG - Intronic
1078154804 11:8790211-8790233 GCATGGTTTCACAGAGGAAATGG - Intronic
1078548539 11:12264112-12264134 GCTTGGGTGTGCGGGGGAAACGG - Intergenic
1079561672 11:21829147-21829169 GCTGGGGTTTAAAGTGGATAAGG - Intergenic
1085175319 11:74481657-74481679 ATCTGGGTTTACAGGGGAGAGGG + Intergenic
1087173446 11:95074339-95074361 GCTTGGGTTTAGAGGGGCCTGGG + Intergenic
1089758316 11:120703532-120703554 GGTTGGGCTTACAGGAGTAAGGG + Intronic
1090388180 11:126368696-126368718 CCTTGTGAGTACAGGGGAAATGG + Intronic
1090390920 11:126386675-126386697 CCTTGTGAGTACAGGGGAAATGG + Intronic
1090900433 11:131026158-131026180 GCTGGGGATAAGAGGGGAAAAGG + Intergenic
1090920359 11:131201240-131201262 GCTTTGATTTACAGGGTGAAGGG + Intergenic
1091667601 12:2430644-2430666 GCTTGGGTTTACAGGGGAAAGGG - Intronic
1092159636 12:6309212-6309234 CCTTGAGTTGCCAGGGGAAAAGG - Intergenic
1092288595 12:7144751-7144773 GGGTGGGTTTAGAGGGGAGAGGG + Intronic
1093212614 12:16325998-16326020 GCTTTGGCTAACAGCGGAAATGG + Intergenic
1095383833 12:41627283-41627305 GCTTGGGATGACTGGGGGAAGGG - Intergenic
1096492524 12:52020592-52020614 GGTTTGGTTTCCAGGGGAAATGG - Intergenic
1103816109 12:123657838-123657860 GCTAGGGTTTTCAGTGTAAATGG + Intronic
1104164099 12:126209889-126209911 GATTGGGCTTAAAGAGGAAAAGG + Intergenic
1104182692 12:126398104-126398126 GCTTGGGTGTAGAAGGGAGATGG + Intergenic
1108013891 13:46052749-46052771 GCCTGGGTCTACAGAGGAACAGG - Exonic
1108114616 13:47113212-47113234 GCATGGATTTAGAGGGAAAATGG + Intergenic
1109221230 13:59642979-59643001 GCTTTGGTATTGAGGGGAAATGG + Intergenic
1110297374 13:73884335-73884357 GCTTGGGTTGTCTGGGAAAATGG - Intronic
1114416139 14:22545945-22545967 GGTTGGCTTTAAAGAGGAAAGGG - Intergenic
1119509221 14:75198050-75198072 GCCTGGGTTTGCAGGAAAAATGG + Intergenic
1120097500 14:80404726-80404748 TCTTAGGTTTCCAGGGGAAAGGG - Intergenic
1121367457 14:93326937-93326959 GACTGGGTTAACAGGGAAAATGG + Intronic
1121705582 14:95990820-95990842 TCTTGGGTTTCCAGGAGAAGGGG + Intergenic
1123461621 15:20477690-20477712 GCTTGTGTATCCATGGGAAAAGG + Intergenic
1123656435 15:22522690-22522712 GCTTGTGTATCCATGGGAAAAGG - Intergenic
1124272282 15:28293660-28293682 GCTTGTGTATCCATGGGAAAAGG + Intronic
1124310346 15:28617868-28617890 GCTTGTGTATCCATGGGAAAAGG - Intergenic
1124939609 15:34206141-34206163 GCTTGGTGTTACAGTGGGAAAGG - Intronic
1126526612 15:49663227-49663249 GCATGGGTTTACAGGGGAAAAGG - Intergenic
1126645354 15:50869898-50869920 GCTGAGGTTTACAGGGGACTGGG + Intergenic
1128388852 15:67169282-67169304 ATTTGGGGTTACAGGGGAGAAGG + Intronic
1129141270 15:73600027-73600049 ACTTGGGGTTACAGTGGAATTGG - Intronic
1131274915 15:90972846-90972868 TCTTGGTCTTACAGGGAAAATGG + Intronic
1133100360 16:3475739-3475761 GGCTGGATTTGCAGGGGAAATGG - Intronic
1133572148 16:7051727-7051749 GCTGGGGTTTTCAGGGAAAAGGG + Intronic
1138139392 16:54554753-54554775 GTTAGGGTGTACAAGGGAAAGGG + Intergenic
1140013830 16:71163020-71163042 TCTTGGATCTACAGGAGAAATGG - Intronic
1140219736 16:73034930-73034952 GCTTGCATTTACTGGGGAATGGG - Intronic
1141707112 16:85672350-85672372 GCTTGTCCTTACAGAGGAAACGG + Intronic
1142306126 16:89286719-89286741 GCTTGATTTTACAAGGGTAAGGG + Intronic
1142975300 17:3639990-3640012 TCTTTGATATACAGGGGAAACGG - Intronic
1143451456 17:7039126-7039148 GCTTGGGTTTGCAGAGGACCTGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144533501 17:16063714-16063736 GCTTGAGTTTAGAGGAGGAATGG - Intronic
1145016511 17:19402169-19402191 GATTGGCTTTACAGGCAAAAAGG + Intergenic
1145043283 17:19592651-19592673 GCTTGGGGATAGCGGGGAAAAGG + Intergenic
1148681703 17:49477834-49477856 GCTTGGGCTGTCAGGGGAACTGG + Intergenic
1149372630 17:56010376-56010398 GCCTGGGATGTCAGGGGAAAGGG + Intergenic
1150429809 17:65105952-65105974 AAGTGAGTTTACAGGGGAAAAGG + Intergenic
1151068539 17:71180925-71180947 TCTTGGGTTTACAGGGACAGAGG - Intergenic
1151387576 17:73764531-73764553 GTTTGGGCTCCCAGGGGAAAAGG + Intergenic
1152787747 17:82258915-82258937 GCTGGTGTTTGCAGGGCAAATGG + Intronic
1154056332 18:11016077-11016099 GTTTGGGTCTACAGGAGCAATGG - Intronic
1155103771 18:22640541-22640563 GCTTGGGTGTGCAGTGAAAATGG - Intergenic
1155164420 18:23221025-23221047 ACTTGGGTGTATCGGGGAAAAGG - Intronic
1155275314 18:24181719-24181741 GCTTAAGTTAACAGGGGAGAGGG - Intronic
1156570837 18:38250987-38251009 GCTTGTGGTTACAGGGGGAGGGG + Intergenic
1158730942 18:60021877-60021899 TCTTGGGTTTTCAGAGGATAAGG - Intergenic
1160364414 18:78312327-78312349 GCTTGTGTTTGCCGTGGAAATGG + Intergenic
1161437640 19:4273225-4273247 GCCTGGGCTTACAGGAGAAGAGG + Intergenic
1161613701 19:5257910-5257932 GCTTGGGTGTGCAGGGGACGGGG + Intronic
1161633874 19:5374805-5374827 GCCTGGGATTGCAGGGGCAAGGG - Intergenic
1162301276 19:9846562-9846584 GCTTGGGACTGCAGTGGAAATGG - Intronic
1163897049 19:20068438-20068460 ACTTGGGTTTACAGAGGGGAGGG - Intergenic
1167247264 19:48381128-48381150 GCTGGGGTTGACTGGGGAAGGGG - Intergenic
925715644 2:6782178-6782200 GCGTGTGTTAACTGGGGAAATGG - Intergenic
927539169 2:23891935-23891957 CCTTGAGTTTATATGGGAAAGGG - Intronic
930423538 2:51183468-51183490 CCTTGGGTACTCAGGGGAAAGGG + Intergenic
932941869 2:76176271-76176293 GCTAGGAGTTAAAGGGGAAATGG + Intergenic
935876230 2:107511191-107511213 GCTTGAGCTTACTGGGGCAATGG - Intergenic
936054024 2:109247156-109247178 GTTTGGGTTTGCAGAGGACAAGG + Intronic
938605246 2:132885630-132885652 GGTTTGGTTTACTGTGGAAAAGG + Intronic
939318796 2:140588330-140588352 GCTTCGCTTTACTGGGTAAATGG + Intronic
940143502 2:150521694-150521716 CGGTGGGTTTACAGGGGAAGTGG - Intronic
942129391 2:172863560-172863582 GCTCGGTTTTAAAGAGGAAATGG + Intronic
942336715 2:174895636-174895658 GTTTGGATTTACAGAGGGAAGGG - Intronic
947758697 2:232587929-232587951 TCTTGGGCTCACAGGGGACAAGG - Intergenic
1175358402 20:58387815-58387837 TCTTGGGGTTACAGTGGCAAAGG + Intergenic
1177418211 21:20822147-20822169 GTTTGGGGTTACAGTGGGAACGG - Intergenic
1179826380 21:43968500-43968522 CCTTGGGTTTCCCAGGGAAAGGG + Intronic
1180557049 22:16586359-16586381 GCTTGATGTTTCAGGGGAAAAGG + Intergenic
1181876005 22:25941390-25941412 GGTTGGGTTGACAGGCGACAGGG - Intronic
1184266549 22:43350004-43350026 GCTTGGGTTGACACGTGGAAGGG - Intergenic
953273303 3:41468354-41468376 GCAAGGATTTACAGAGGAAATGG + Intronic
953493088 3:43366046-43366068 GCTTGGGCTTGCAGAGAAAAGGG - Exonic
954642662 3:52110874-52110896 GCTTTGGCTGCCAGGGGAAAAGG + Intronic
954859068 3:53672186-53672208 GACTGGGTTTAGAGGTGAAAGGG - Intronic
955823642 3:62922541-62922563 GTTTGGGTTTACAAAGGAAGTGG - Intergenic
960764997 3:121116760-121116782 GACTAGGATTACAGGGGAAAAGG - Intronic
961378254 3:126481336-126481358 GCTTTTGTTCACAAGGGAAAGGG + Intronic
962258152 3:133886132-133886154 GCTTGGGGTTTCTGGGGAATCGG - Intronic
963677966 3:148337681-148337703 GCTGGGGTAGTCAGGGGAAAAGG - Intergenic
967114924 3:186328542-186328564 GCTTGAATTCACAGTGGAAAAGG + Intronic
968173673 3:196530064-196530086 CTTTGGGTATTCAGGGGAAAGGG - Intergenic
968276137 3:197441812-197441834 GCTTGATTTGACAGGGGAAAGGG + Intergenic
970488143 4:16544815-16544837 GCTTGACTTTACAGGAGAAGTGG + Intronic
970538497 4:17054439-17054461 GCTTGGGCTTACTGGGAAATAGG - Intergenic
970666675 4:18344370-18344392 ACTTGGGTTAATAGGGGAAGAGG - Intergenic
971786433 4:31109387-31109409 GTTTTGTTTTACATGGGAAAAGG - Intronic
973702400 4:53550347-53550369 GGTAGAGTTTACAGAGGAAATGG - Intronic
977085418 4:92590814-92590836 ACTCAGGTTTACAGAGGAAAAGG - Intronic
977429713 4:96915946-96915968 GTTTGTGTGTACAGGGGAGATGG + Intergenic
978428553 4:108607941-108607963 GCTAGTGTTTCCAAGGGAAATGG + Intergenic
979385044 4:120054704-120054726 GGTTGGGGTTAGTGGGGAAATGG - Intergenic
980474217 4:133290901-133290923 GTTTGGGCAAACAGGGGAAAAGG - Intergenic
980557601 4:134430259-134430281 GCCTGGGCTCACAGGGGTAAAGG - Intergenic
982305667 4:153928259-153928281 CCTTGGGGTTACAGGCTAAAAGG + Intergenic
983156907 4:164359791-164359813 GCTTGTGTTTACTGGAGAGATGG - Intronic
986822275 5:11480934-11480956 GCTTGGGATGAAAGGGGAAATGG + Intronic
987452454 5:18103166-18103188 ACTTGGGTATAAAGGAGAAAAGG + Intergenic
992180555 5:74193232-74193254 GCTTTGGGTTTCAAGGGAAAAGG + Intergenic
998308943 5:141107626-141107648 GCTTGGGTTTGCAGAGGCCAGGG - Intronic
999098990 5:149006718-149006740 GAGTGGCTTTACAGGGGACATGG - Intronic
1000041255 5:157486704-157486726 ACTTGGGGTTACAGGAGAACAGG - Intronic
1000256770 5:159546703-159546725 GCTTCTGTTTAGTGGGGAAAAGG - Intergenic
1000502444 5:162068326-162068348 GTTTGGTTTTAGAGTGGAAAAGG + Intronic
1001817076 5:174678537-174678559 GCTTGGATTTAAAGAGAAAATGG + Intergenic
1003279503 6:4679263-4679285 TCTTGGGTTTACTGGGGAAAGGG + Intergenic
1004577109 6:16907786-16907808 AATTGGGGTTGCAGGGGAAAAGG + Intergenic
1006986742 6:38180467-38180489 GCTTGGGGTTACGGTGGGAAGGG - Intronic
1012442034 6:99269996-99270018 GAATGGGTTTGCAGGGAAAATGG - Intergenic
1013823667 6:114185162-114185184 GCATGAGTTTTGAGGGGAAAAGG + Intronic
1017941088 6:159053766-159053788 GCCTGTGGTTACAGTGGAAAAGG - Intergenic
1018349150 6:162938056-162938078 CCTTGGGGACACAGGGGAAAAGG - Intronic
1018702302 6:166436724-166436746 GGGTGGGTTTGCATGGGAAATGG + Intronic
1019572620 7:1720005-1720027 GCTGGGGTTTGCAGAGGAGATGG - Intronic
1023138356 7:37076549-37076571 GTTTGGGTTTTCAGGTGATAAGG - Intronic
1024743622 7:52382621-52382643 CCTTGGGGTTATTGGGGAAAAGG - Intergenic
1024764326 7:52639212-52639234 CATTGGGTTTTCATGGGAAAGGG + Intergenic
1027483622 7:78731075-78731097 GGTTGGGTTTAAAGAGAAAATGG - Intronic
1030314043 7:108096165-108096187 GCTAGGGATTAGAGGGGAGAAGG - Intronic
1032069858 7:128797645-128797667 GATTGGGTTTGGAGAGGAAATGG + Intronic
1032568782 7:132976892-132976914 GCTTTGATTTTTAGGGGAAAAGG - Intronic
1033367983 7:140685687-140685709 GCCTGGATTTACAGGGAAGAGGG + Intronic
1033651461 7:143346673-143346695 GTTTGGGGATACAGGGGAAAGGG + Intronic
1034025838 7:147702927-147702949 GCTTGGTTTTACCGGGGCAGGGG - Intronic
1034461751 7:151201384-151201406 GCTTTGGTCTACAGGGGAAGTGG + Intronic
1034732791 7:153402679-153402701 GCTTAGTTTTACAGGGGCTAGGG - Intergenic
1035746158 8:1963263-1963285 GGTTGGGATTACAGAGTAAAGGG + Intergenic
1037353508 8:17991860-17991882 CTTTGGGGTTTCAGGGGAAAGGG - Intronic
1038420839 8:27433243-27433265 GCATGGGCGTACAGGTGAAAGGG + Intronic
1039132235 8:34279251-34279273 GCCGGGGATTACAGGGGAAGTGG + Intergenic
1039161705 8:34628704-34628726 GCTGGGCTTGAAAGGGGAAATGG + Intergenic
1039171646 8:34753965-34753987 GTTTGGGTTTAGAGGGGTAAGGG - Intergenic
1044843358 8:96356761-96356783 GCATGGGTTTACAGGGAAAAGGG + Intergenic
1046918506 8:119702546-119702568 GATTGGGCTTACATGAGAAATGG + Intergenic
1047200239 8:122759134-122759156 GGTTGGGTTTTAAGTGGAAAAGG - Intergenic
1047925064 8:129674634-129674656 GTTTGGGTTTACAGATGACAGGG - Intergenic
1048717026 8:137282086-137282108 GCTTGGGAGAACAGGGAAAAAGG - Intergenic
1050668993 9:7975022-7975044 ACTTGAGTTTACAGCGGAGATGG - Intergenic
1050768867 9:9171412-9171434 GCTTGGTTTCACAGGGAAATAGG + Intronic
1052085862 9:24264685-24264707 CCTTGGATTTACTGGGAAAATGG + Intergenic
1052582243 9:30373281-30373303 GGTTGTGTTTAGAGGGGAAGAGG - Intergenic
1053577812 9:39370706-39370728 GGCTGGGTATACAGAGGAAAGGG + Intergenic
1053842321 9:42198649-42198671 GGCTGGGTATACAGAGGAAAGGG + Intergenic
1054099388 9:60929423-60929445 GGCTGGGTATACAGAGGAAAGGG + Intergenic
1054120785 9:61205047-61205069 GGCTGGGTATACAGAGGAAAGGG + Intergenic
1055781899 9:79829585-79829607 TCTTTGGTTGACAAGGGAAAGGG - Intergenic
1056727564 9:89134238-89134260 GCCTGTGTTTAAAGGGTAAAAGG + Intronic
1056957907 9:91097156-91097178 GCTTGGATTTGTGGGGGAAAAGG - Intergenic
1058464543 9:105214655-105214677 GTTTGTTTTTAGAGGGGAAAGGG - Intergenic
1059457123 9:114406611-114406633 GCTGGGGTTGGCAGGGGAGACGG + Exonic
1059691436 9:116688709-116688731 GCTTGGGGGTACAGGGAAAAAGG - Intronic
1060044293 9:120327612-120327634 GCTTGGTTTGAGAGGGGAAGGGG + Intergenic
1060061870 9:120467896-120467918 GCATGGGTTTCCAGGGAAATGGG - Exonic
1061723979 9:132571329-132571351 GGTTGGGATTCCAGGGCAAAGGG - Intronic
1061781679 9:132999894-132999916 GCTTGGGGTTAGGGAGGAAAAGG - Intergenic
1187782434 X:22843036-22843058 GCCTTGGTTTCCAGGGAAAAGGG - Intergenic
1189734478 X:44055774-44055796 GCTTGGGGTTGGAGGAGAAAAGG - Intergenic
1190476264 X:50830898-50830920 GCTTAGGTTGACAGTGGGAACGG - Intergenic
1196629575 X:117921995-117922017 GTTTGGGTTTACAAAGAAAAAGG - Intronic
1198014322 X:132593147-132593169 GCTTTGTTTTCCAGGGCAAAGGG + Intergenic
1198097991 X:133399328-133399350 GATTGGGTTTACAGGGGCACTGG - Intronic
1198764260 X:140064818-140064840 GGTTGAGTTTACAGGTGAATTGG - Intergenic
1201477698 Y:14401115-14401137 GCTTGGGTTTACATATAAAATGG - Intergenic
1202191140 Y:22247092-22247114 GCTTGGATTTACAGTGGATATGG - Intergenic