ID: 1091670231

View in Genome Browser
Species Human (GRCh38)
Location 12:2447280-2447302
Sequence GTTTAGGGAGGCAGCTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 222}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091670231_1091670238 0 Left 1091670231 12:2447280-2447302 CCAAGGCAGCTGCCTCCCTAAAC 0: 1
1: 0
2: 0
3: 16
4: 222
Right 1091670238 12:2447303-2447325 CAATTTTATGGCACAAAAATGGG 0: 1
1: 0
2: 2
3: 28
4: 336
1091670231_1091670240 8 Left 1091670231 12:2447280-2447302 CCAAGGCAGCTGCCTCCCTAAAC 0: 1
1: 0
2: 0
3: 16
4: 222
Right 1091670240 12:2447311-2447333 TGGCACAAAAATGGGCAGGAAGG 0: 1
1: 0
2: 4
3: 31
4: 278
1091670231_1091670242 13 Left 1091670231 12:2447280-2447302 CCAAGGCAGCTGCCTCCCTAAAC 0: 1
1: 0
2: 0
3: 16
4: 222
Right 1091670242 12:2447316-2447338 CAAAAATGGGCAGGAAGGGAAGG 0: 1
1: 0
2: 12
3: 99
4: 978
1091670231_1091670239 4 Left 1091670231 12:2447280-2447302 CCAAGGCAGCTGCCTCCCTAAAC 0: 1
1: 0
2: 0
3: 16
4: 222
Right 1091670239 12:2447307-2447329 TTTATGGCACAAAAATGGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 167
1091670231_1091670241 9 Left 1091670231 12:2447280-2447302 CCAAGGCAGCTGCCTCCCTAAAC 0: 1
1: 0
2: 0
3: 16
4: 222
Right 1091670241 12:2447312-2447334 GGCACAAAAATGGGCAGGAAGGG 0: 1
1: 1
2: 0
3: 33
4: 361
1091670231_1091670237 -1 Left 1091670231 12:2447280-2447302 CCAAGGCAGCTGCCTCCCTAAAC 0: 1
1: 0
2: 0
3: 16
4: 222
Right 1091670237 12:2447302-2447324 CCAATTTTATGGCACAAAAATGG 0: 1
1: 0
2: 2
3: 32
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091670231 Original CRISPR GTTTAGGGAGGCAGCTGCCT TGG (reversed) Intronic
900089368 1:913164-913186 GTTCACAGAGGCAGCTGCTTTGG - Intergenic
900457310 1:2783539-2783561 GTGGAGGAAGGCAGCTCCCTGGG + Intronic
901293927 1:8146227-8146249 GCTTGGAGAGGCAGATGCCTTGG + Intergenic
901374272 1:8826334-8826356 CTTTGGGGAAGCAGCTCCCTGGG - Intergenic
902443191 1:16444692-16444714 GTTTGGAGAGGCAGCTGCCATGG + Intronic
904039001 1:27573648-27573670 GTTTGGGGAGACAGCTCTCTGGG - Intronic
905449930 1:38049513-38049535 GTCTATGGAGGCAGCAGCTTTGG + Intergenic
905450712 1:38054311-38054333 GCTTAGGGTAGCATCTGCCTAGG + Intergenic
910428005 1:87134735-87134757 GTTTCAGGAGCCAGCAGCCTCGG + Intronic
913535575 1:119768939-119768961 GCTTAGGGAGGCAGGAGTCTTGG - Intergenic
914411620 1:147434767-147434789 GTATATGGAGGTAGATGCCTGGG - Intergenic
914451136 1:147792636-147792658 CTCTAGGCAGGCAGCTCCCTAGG - Intergenic
916750314 1:167717631-167717653 TGTTAGGGAAGCAGCAGCCTAGG - Intergenic
920211399 1:204331454-204331476 GTTAAGGGAGGAAGCAGCCTGGG - Intronic
920646291 1:207806629-207806651 TTTTAGGAGTGCAGCTGCCTAGG - Intergenic
920939058 1:210463738-210463760 GTAGAGCGAGGCAGCTGCTTTGG - Intronic
921166875 1:212514153-212514175 GTCCAGGGAGTGAGCTGCCTGGG - Intergenic
924270233 1:242324926-242324948 ATTTAGGCAGGCAGGAGCCTAGG - Intronic
924280116 1:242428628-242428650 GGTTATGGAAGCAGCTGCTTAGG - Intronic
924836090 1:247649216-247649238 TTTTAGGGAGACAGGTGCCCAGG + Intergenic
924836097 1:247649267-247649289 TTTTAGGGAGACAGATGCCCAGG + Intergenic
924836105 1:247649318-247649340 TTTTAGGGAGACAGGTGCCCAGG + Intergenic
924836113 1:247649369-247649391 TTTTAGGGAGACAGGTGCCCAGG + Intergenic
924836121 1:247649420-247649442 TTTTAGGGAGACAGGTGCCCAGG + Intergenic
924836129 1:247649471-247649493 TTTTAGGGAGACAGGTGCCCAGG + Intergenic
924836137 1:247649522-247649544 TTTTAGGGAGACAGGTGCCCAGG + Intergenic
924836145 1:247649573-247649595 TTTTAGGGAGACAGGTGCCCAGG + Intergenic
924836153 1:247649624-247649646 TTTTAGGGAGACAGGTGCCCAGG + Intergenic
1063185111 10:3643643-3643665 CTTTAGGAAGGCAGATTCCTGGG - Intergenic
1066714685 10:38273834-38273856 ATTTAGGCAGGCAGGAGCCTAGG + Intergenic
1066783388 10:38976875-38976897 ATTTAGGCAGGCAGGAGCCTAGG - Intergenic
1070124679 10:73611555-73611577 GTCAAGGGATGCACCTGCCTTGG - Intronic
1072670256 10:97424215-97424237 GTCTTGGGAGCCAGCAGCCTGGG + Intronic
1073190517 10:101647441-101647463 GGATGGGCAGGCAGCTGCCTAGG - Intronic
1074687584 10:115974673-115974695 GTTAAGTCAGGCAGCTGCATGGG + Intergenic
1075098548 10:119489887-119489909 GTGGAGGGAGGCAGCTCCCGGGG - Intergenic
1075214226 10:120517843-120517865 TTTTCGGGAAGGAGCTGCCTAGG - Intronic
1075600307 10:123762663-123762685 AATTAGGGAGGAAGCTGCCCAGG - Intronic
1076282926 10:129265063-129265085 GTGTAGGTAGACAGCTACCTAGG + Intergenic
1076347420 10:129788883-129788905 GTGGAGGGACGCTGCTGCCTGGG + Intergenic
1077062577 11:624383-624405 ATTTCGGGATGAAGCTGCCTGGG - Intronic
1077315310 11:1917075-1917097 ATGTGGGGAGGCAGCTACCTAGG + Intergenic
1077722438 11:4642267-4642289 GTTTAGGGAGGCCAGTGCCTCGG - Intergenic
1077973701 11:7223721-7223743 GTTTAGAGAGGAAAATGCCTTGG - Intergenic
1078460863 11:11514386-11514408 GCTCAGGGAGGCTGCTTCCTTGG - Intronic
1079455715 11:20634394-20634416 CTTTAGGGAGGCAGCTGAAATGG + Intronic
1081249442 11:40811808-40811830 CTTTAGGCAGGCTGCTCCCTTGG + Intronic
1081786074 11:45748549-45748571 GTTTCTGGAGACAGCTGGCTGGG - Intergenic
1083316127 11:61816002-61816024 GCTTGGGGAGACCGCTGCCTTGG - Intronic
1083998342 11:66283147-66283169 GGTGAGGGTAGCAGCTGCCTTGG + Exonic
1085744254 11:79101059-79101081 GTGTAGGAGGGCAGCTACCTGGG + Intronic
1086574704 11:88326229-88326251 GTTCAGGAGGGCAGCTGCCTTGG + Intronic
1087970345 11:104473483-104473505 GTTTATGAAAGCACCTGCCTTGG - Intergenic
1088789487 11:113211762-113211784 GTTCAGGGATGCAGGGGCCTCGG + Intronic
1090384465 11:126348496-126348518 ATTGAGGGAGGGAGCTGCATGGG - Intergenic
1090711043 11:129385607-129385629 GTTTAGAGAGGCAGGGGCATGGG + Intronic
1090719619 11:129459565-129459587 GTTTAAGGAGCCAGGTGCTTGGG - Intergenic
1091670231 12:2447280-2447302 GTTTAGGGAGGCAGCTGCCTTGG - Intronic
1091908753 12:4211760-4211782 GTTGAGAGAAGCAACTGCCTGGG + Intergenic
1092744246 12:11658614-11658636 GTGCAGGGAGTCAGCTGACTCGG - Intronic
1092869381 12:12792665-12792687 TGTAAGGGAGGCAGATGCCTTGG - Intronic
1093980730 12:25472426-25472448 GTTTAGGGCAGCTGCTGACTGGG + Intronic
1094333403 12:29321290-29321312 CTCAAGGGAGCCAGCTGCCTTGG - Intronic
1095162859 12:38937229-38937251 GTCTGGGGTGGCAGCTGCTTGGG + Intergenic
1095767294 12:45911043-45911065 CTTTTGCAAGGCAGCTGCCTGGG + Intergenic
1096520621 12:52182668-52182690 GTTGAGGGAGACAGCTGGCCTGG + Intronic
1096611312 12:52803827-52803849 GTTTAGTGAGACAGCTACGTGGG - Intergenic
1097978685 12:65714966-65714988 AGCTAGGGAGGCAGCAGCCTAGG - Intergenic
1101150465 12:101878078-101878100 GTTTAGGGAGGCAGCGGGTGCGG + Intronic
1102116017 12:110403500-110403522 GTTGAGGCGGGTAGCTGCCTGGG - Intronic
1102228009 12:111242786-111242808 GTTGATGGATGCAGCTGCCCCGG - Intronic
1103794096 12:123491420-123491442 CCTTAGGGAGGCAGCATCCTGGG + Intronic
1104551564 12:129761792-129761814 ATTTGTGGAGGCAGCTTCCTAGG - Intronic
1108783943 13:53871856-53871878 GGTTAGGGAGACATCTGCCAAGG - Intergenic
1109168895 13:59071627-59071649 GCTTGGGGGAGCAGCTGCCTGGG - Intergenic
1109669235 13:65583430-65583452 CTTTAGGGAGCCAACAGCCTTGG + Intergenic
1111627234 13:90804685-90804707 GTTGAGGGAAGAATCTGCCTAGG + Intergenic
1113819582 13:113203751-113203773 GATGAGGGTGGCAACTGCCTTGG + Intronic
1114646969 14:24261253-24261275 GGTAAGGGAGGCACCTGCCTTGG + Intronic
1117034791 14:51716907-51716929 GTTTAGGAATGAAGCTGACTTGG - Intronic
1121450550 14:94004443-94004465 GCTTAGGGAGGGAGCTGGGTGGG + Intergenic
1122017459 14:98808389-98808411 TTGTAGGGAGGAAGCTGTCTTGG - Intergenic
1122263401 14:100535628-100535650 GCTCAGGGAGGCTGCTTCCTGGG + Intergenic
1122382319 14:101317109-101317131 GTCTGGGGTGGCAGCTGCTTGGG - Intergenic
1128497851 15:68208425-68208447 GGTGAGTGAGGCAGCTGCCGTGG + Intronic
1129905355 15:79183451-79183473 GATTAGGCAGGAGGCTGCCTGGG - Intergenic
1131382494 15:91975375-91975397 GTTTAGGGAGCCAACTGCAGGGG - Intronic
1132241997 15:100265368-100265390 GTTTAGGGAGACACCTGGTTGGG + Intronic
1132357481 15:101183241-101183263 ATTAAGGGAGTCAGGTGCCTGGG + Intronic
1136120127 16:28127532-28127554 GGTGAGGAAGGAAGCTGCCTGGG - Intronic
1136473789 16:30499256-30499278 ATTTGGGGCGGCAGCTGCCCTGG - Intronic
1140484486 16:75282966-75282988 GTTTTGGGAGGAGGCTGACTCGG + Intergenic
1141907272 16:87035299-87035321 GTTGTGGCAGGCAGCTGCCATGG - Intergenic
1145004282 17:19328714-19328736 GTCAATGGAGGCAGCTGGCTTGG - Exonic
1145209952 17:21005376-21005398 TTTTGAGGAGGCACCTGCCTAGG - Intronic
1145242107 17:21246045-21246067 GGCTAGGTAGGCAGCTCCCTTGG - Intronic
1146546934 17:33748183-33748205 GCTTAAGGAGGCAGGTGGCTAGG - Intronic
1146921192 17:36713449-36713471 GTTTATGGAGGAATTTGCCTGGG + Intergenic
1147521845 17:41180809-41180831 GTTCAGTGGGGCTGCTGCCTGGG + Intergenic
1148328410 17:46797639-46797661 GTTCATGGAGGTACCTGCCTAGG - Intronic
1149265538 17:54923883-54923905 GTTGAGGCAGTGAGCTGCCTGGG + Intronic
1151292873 17:73163181-73163203 GCTTGGGGGAGCAGCTGCCTGGG - Intergenic
1151357399 17:73568127-73568149 GTGTTGGGAGGCAGATCCCTTGG + Intronic
1151986096 17:77544834-77544856 ATTCAGAGAGGCAGCTGCCCTGG + Intergenic
1152485334 17:80587491-80587513 TTTTCGGGAGGTAGTTGCCTAGG + Intronic
1153944079 18:10003533-10003555 GTTTGGGGAGACAGGTGGCTTGG - Intergenic
1154046763 18:10913291-10913313 GTCTAGGCAGGCAGTTGCCACGG - Intronic
1155060566 18:22224480-22224502 GCTTAGGAAGCCAGATGCCTGGG - Intergenic
1157706895 18:49814325-49814347 GTCTAGGGAGGCCTCTGCCGCGG + Intronic
1158613906 18:58968523-58968545 GTTCAGGGAGGCACTGGCCTGGG - Intronic
1159015772 18:63100727-63100749 GTTTGGGGATGCAGCTGTCAGGG - Intergenic
1159097326 18:63919137-63919159 TGTTATGGAGGCATCTGCCTTGG - Intronic
1160175998 18:76594713-76594735 GACTTGGGAGTCAGCTGCCTGGG - Intergenic
1162413362 19:10519219-10519241 GTTCAGGGAGGCAGCTGGAGAGG - Intergenic
1162618153 19:11818446-11818468 TGTTAGGGAAGCAGGTGCCTAGG - Intronic
1162622070 19:11851560-11851582 TGTTAGGGAAGCAGGTGCCTAGG - Intronic
1162626903 19:11891879-11891901 TGTTAGGGAAGCAGGTGCCTAGG - Intronic
1162631139 19:11927904-11927926 TGTTAGGGAAGCAGGTGCCTAGG - Intronic
1165951115 19:39474360-39474382 GTGTAGGGTGGTAGCTGGCTGGG - Exonic
1167079175 19:47267556-47267578 GCTGAGGGCAGCAGCTGCCTGGG + Intronic
929193563 2:39162757-39162779 GTTTGGGGCGGTAGCAGCCTTGG + Intergenic
934504663 2:94880758-94880780 GTTTGGGCAGGCAGCTGGCGGGG - Intergenic
934761444 2:96859100-96859122 GCTTGAGCAGGCAGCTGCCTGGG - Intergenic
934925193 2:98377345-98377367 TTTTATGGAAGCAGCTGCTTTGG + Intronic
936290775 2:111222352-111222374 GTTCAAGGAGGCTGCTGCCAGGG - Intergenic
936608196 2:113978096-113978118 GTGGAGGGAGGCAGCTGCTGTGG + Intergenic
936988933 2:118341614-118341636 GTTTCTGGAGGCAGCTGCTTTGG + Intergenic
937932716 2:127219240-127219262 GCTGAGGGGGGCTGCTGCCTGGG - Intronic
937980750 2:127613736-127613758 GTTTTAGGAGGCAACTACCTTGG + Intronic
938470768 2:131558821-131558843 GTTTAGTTTGACAGCTGCCTAGG + Intergenic
943325121 2:186488257-186488279 AATTAGGGTGGCAGCTACCTGGG - Intronic
945985991 2:216354044-216354066 GTGTTTGGAGGCACCTGCCTGGG - Intronic
947033166 2:225820997-225821019 GGCAAGTGAGGCAGCTGCCTGGG + Intergenic
947544271 2:231000322-231000344 GGTGAGGGAGGCACCTGCCCTGG - Intronic
947966778 2:234288841-234288863 GGTGTGAGAGGCAGCTGCCTGGG + Intergenic
948467908 2:238160880-238160902 GTTTTGGGAGGGACCTTCCTGGG - Intronic
1171823123 20:29873911-29873933 GTAGAGGGAGACAGCTGCCTGGG + Intergenic
1172742179 20:37177984-37178006 GATTCTGGAGTCAGCTGCCTAGG + Intronic
1174788072 20:53451770-53451792 GTTTAGTGAGGAAACTGACTTGG - Intronic
1175753998 20:61517864-61517886 GTTTTGTGAGGCACCTGCATGGG - Intronic
1175904877 20:62374838-62374860 GTTCAGGCGGGCAGGTGCCTGGG + Intergenic
1181174868 22:21029654-21029676 GGAAGGGGAGGCAGCTGCCTGGG + Intronic
1182777552 22:32842043-32842065 GGTTAGGGGGGAGGCTGCCTAGG + Intronic
1183019566 22:35016366-35016388 GTTTAGGGACATACCTGCCTTGG + Intergenic
1184466545 22:44671717-44671739 GGTTCTGGAGCCAGCTGCCTGGG + Intronic
1184957749 22:47903023-47903045 GTCTAGAGTGGCAGCTGCCCTGG + Intergenic
1185044459 22:48522285-48522307 GGGAAGGGCGGCAGCTGCCTTGG + Intronic
1185274487 22:49944455-49944477 GTTCAGGGAGGCAGCTCTGTGGG - Intergenic
950436905 3:12985595-12985617 CTGGAGGGAGGCAGCAGCCTGGG + Intronic
952089328 3:29865184-29865206 GTTAAGGGTGCCAGCTTCCTGGG - Intronic
953883528 3:46703351-46703373 GTGTAGGAAGTGAGCTGCCTTGG + Intronic
954076878 3:48188079-48188101 GTTCAGGGACGCGGCTGCCGCGG + Exonic
954122125 3:48505463-48505485 CTTTAGGGAGGCAGAGGGCTGGG - Intergenic
954644604 3:52123272-52123294 GCTGAGGGAGGCACCTGGCTGGG + Intronic
956319467 3:67980493-67980515 GTTCAGTGATGCAGCTGTCTTGG + Intergenic
961199525 3:125033261-125033283 GTTGAGGCTGGCAGCTGCCCTGG + Intronic
961462596 3:127061974-127061996 GGTTGGGGTGGCATCTGCCTGGG + Intergenic
962426175 3:135271161-135271183 GATCAGAGAAGCAGCTGCCTGGG - Intergenic
962904855 3:139792432-139792454 GTTTGAGGAGGTAGCTTCCTGGG + Intergenic
962960703 3:140308844-140308866 GCTTAGGGAGGCAGCAGAATGGG - Intronic
964271631 3:154962736-154962758 GTTTTGGGAGGGGACTGCCTAGG + Intergenic
966756109 3:183372953-183372975 TGTTAGGGAGGCAGGAGCCTAGG + Intronic
966756343 3:183374877-183374899 TGTTAGGGAGGCAGGAGCCTAGG + Intronic
967850812 3:194081406-194081428 TTTTTGGGAGCCAGCTTCCTGGG - Intergenic
968642043 4:1719862-1719884 GTTTGAGGATGCAGCTGCCTGGG - Intronic
969999086 4:11345673-11345695 GTTCAGGGAGGAAGCTCCCCAGG - Intergenic
970168500 4:13264850-13264872 GTTGTGGGAGGCAGGTGCCTAGG - Intergenic
972135606 4:35889514-35889536 TTTTAGGAAGACAGCTGCATAGG - Intergenic
972568561 4:40290208-40290230 GATTATGAAGGCAGCTGTCTAGG + Intergenic
973271490 4:48267597-48267619 GTCTTGGGGGCCAGCTGCCTTGG - Intronic
973739540 4:53906080-53906102 GTTTAGGGAGGCAGTTTCAGAGG + Intronic
975662596 4:76702589-76702611 GATTCCGGAGCCAGCTGCCTGGG - Intronic
977163180 4:93662075-93662097 CTTGAGGCAGGAAGCTGCCTGGG - Intronic
979468355 4:121067906-121067928 GTTTAGGAAGGAAGCAGCCAAGG + Intronic
985228539 4:187789431-187789453 GTTGAGGGGGGCGGCTTCCTGGG - Intergenic
985444555 4:190014990-190015012 GTAGAGGGAGACAGCTGCCCGGG + Intergenic
985816901 5:2134054-2134076 GTTTGGGGACCCAGCTGGCTGGG + Intergenic
989273181 5:39555969-39555991 CGTTAAGGAGGCAGCTGCCAGGG - Intergenic
990530677 5:56670276-56670298 GGTTAGGAAGGCAGCTGAGTAGG - Intergenic
995015362 5:107303427-107303449 GTGTGGGGAGGCAGGTGCTTGGG + Intergenic
995065051 5:107852097-107852119 GTAGAGGGAGGAAGATGCCTGGG + Intergenic
997192937 5:131956323-131956345 GTTTGGGGAGGTAGCTGGATCGG - Intronic
997235324 5:132269180-132269202 GCCTAGAGAGGCAGCTGCATGGG + Intronic
997626909 5:135337275-135337297 GTTGTTGGAGACAGCTGCCTGGG - Intronic
998428250 5:142048328-142048350 GGGTGGGGAGGCAGCTGCTTGGG - Intergenic
998457890 5:142287782-142287804 GTGCAGGGCTGCAGCTGCCTCGG + Intergenic
998881260 5:146647644-146647666 ATTTTGGGAGACAGATGCCTTGG - Intronic
1000051037 5:157563143-157563165 GTCTAGGGACGCAGCTGGCCAGG + Intronic
1002619208 5:180475018-180475040 GTTTCAGCAGGCAGCTGCCCAGG - Intergenic
1004171566 6:13299509-13299531 GTTAGGGGAGGCAGCTGCTAAGG - Intronic
1007584993 6:42984075-42984097 GTCTAGGGAGGCGGGTGTCTTGG + Intergenic
1010786032 6:80003029-80003051 GTTAAGTGATGCAGATGCCTTGG + Intergenic
1017052511 6:150407079-150407101 TCTTAGGGAGTCAGCAGCCTGGG - Intergenic
1019048221 6:169163873-169163895 GTTTCTGGAGGCAGCATCCTTGG - Intergenic
1019466753 7:1193885-1193907 GTCTGGGGAGACAGCTGCCCTGG - Intergenic
1019657709 7:2205556-2205578 GTTTTGGCGGGCAGCGGCCTAGG - Intronic
1026451156 7:70530741-70530763 GTTTAGTGGGACTGCTGCCTCGG + Intronic
1026548194 7:71343202-71343224 GTAAGGAGAGGCAGCTGCCTGGG + Intronic
1026994069 7:74604585-74604607 AATTGGGGAGGCAGCTGCCAGGG + Intergenic
1027047072 7:74998137-74998159 GTTAAAGGAGTTAGCTGCCTGGG - Intronic
1029385924 7:100243503-100243525 GTTAAAGGAGTTAGCTGCCTGGG + Intronic
1029402644 7:100355474-100355496 GTTTTGGGAGGCACCGGCCCTGG - Intronic
1033396986 7:140984425-140984447 GTTTAAGAAGGCATCTGGCTGGG + Intergenic
1033546862 7:142409173-142409195 GTTTGGGAAGGCAGCTTCCTGGG + Intergenic
1034405422 7:150899547-150899569 GTGGAGGGAAGCAGGTGCCTAGG - Intergenic
1034869974 7:154675394-154675416 GGTTAGGATGGCAGCTCCCTTGG + Intronic
1035164100 7:156974074-156974096 CTATAGGGATGCAGGTGCCTGGG - Intergenic
1035174606 7:157041193-157041215 AATGAGGGAGGCGGCTGCCTGGG + Intergenic
1035451357 7:158979191-158979213 GTTTAGGGCGACCGGTGCCTCGG - Intergenic
1040884990 8:52252366-52252388 TTTTAAGGAGGCAGCTACCATGG + Intronic
1045292153 8:100842865-100842887 GGTTAGGCAGGCAACTGCCAGGG + Intergenic
1047415035 8:124657729-124657751 TTGTAGGGAGGTAGGTGCCTGGG - Intronic
1048438516 8:134440693-134440715 ATTTAGGCAGGCAGCTATCTTGG + Intergenic
1049154626 8:141059222-141059244 GTTTTGGGAGGAAGCGGCCCTGG + Intergenic
1049311085 8:141934232-141934254 GTGTATGGAGGCAGCGGCCATGG - Intergenic
1049678437 8:143904011-143904033 GTTCAGGGTGGCGGCTGCCAGGG + Intergenic
1050697634 9:8297074-8297096 ATTAAGGGAGGCAGGTTCCTGGG + Intergenic
1053749599 9:41237683-41237705 GTAGAGGGAGACAGCTGCCCGGG - Intergenic
1054255045 9:62802564-62802586 GTAGAGGGAGACAGCTGCCCGGG - Intergenic
1054336263 9:63813042-63813064 GTAGAGGGAGACAGCTGCCCGGG + Intergenic
1055395468 9:75869195-75869217 CTTGAGTGAGGCAGCTTCCTTGG + Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1057845096 9:98516810-98516832 GTTTAGGGCAGCAGCTTCCAAGG + Intronic
1058951527 9:109908233-109908255 GTTTAAGGAGAAAGCTGACTGGG - Intronic
1059251407 9:112890574-112890596 GTAGAGGGAGGCAGCCACCTGGG + Exonic
1061506452 9:131034347-131034369 GTTTAGGCAGGCAGCACCCCAGG - Intronic
1061598712 9:131650509-131650531 GGGCAGGGAGGCAGCAGCCTGGG + Intronic
1062041978 9:134408413-134408435 GTGCAGGGAGGCAGGTGCCTGGG + Intronic
1203376194 Un_KI270442v1:380460-380482 GTAGAGGGAGACAGCTGCCTGGG + Intergenic
1190971642 X:55355830-55355852 GTTTAGGGAGGAAATTACCTTGG + Intergenic
1194956518 X:100187546-100187568 GTTTAGGAAGGCAGCTCCTTAGG + Intergenic
1195786151 X:108526168-108526190 GTTTATGGATGCACCTACCTTGG + Intronic
1196715542 X:118807393-118807415 GTTATGGGAGCCAGCTGCCAGGG + Intergenic
1199264676 X:145817347-145817369 GTTAGGGGAGGCAGCTGTCCCGG + Intergenic
1199488546 X:148373712-148373734 GTTTTGGCAGGCTCCTGCCTTGG - Intergenic
1201065848 Y:10093119-10093141 GTAGAGGGAGACAGCTGCCCTGG - Intergenic
1201683051 Y:16670273-16670295 ATTTTGGGAGGCTGATGCCTTGG - Intergenic
1201901445 Y:19048621-19048643 GTTTGGGGAGGGAACTGCCTGGG - Intergenic
1201910458 Y:19128540-19128562 GTTTGGGGTGGCAGCTGCTTGGG - Intergenic