ID: 1091671315

View in Genome Browser
Species Human (GRCh38)
Location 12:2454077-2454099
Sequence GACACAAATGTCAAAACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091671315 Original CRISPR GACACAAATGTCAAAACTGG AGG (reversed) Intronic
902245577 1:15118450-15118472 GACACAAATGACACAAGGGGAGG - Intergenic
904803053 1:33109960-33109982 CACACAGATATCAAAACTGAAGG - Intronic
906179892 1:43809177-43809199 GACACAAATGAGAGAACTGGGGG + Intronic
907185437 1:52605469-52605491 GACCCAAATGTCAATTATGGAGG + Intronic
909529484 1:76665989-76666011 GACACAGATGTTAAAATTAGCGG + Intergenic
910781401 1:90939110-90939132 GACACAAATATGAAAACTATAGG - Exonic
912711755 1:111954926-111954948 GACATAAAAGGCAAAACTGAGGG - Intronic
916218934 1:162423535-162423557 AACAAAAAGGACAAAACTGGAGG + Intergenic
916507379 1:165440276-165440298 TATACAGATGTAAAAACTGGGGG - Intronic
918892885 1:190298503-190298525 AACACAAATATCAAAAATTGTGG - Intronic
1064377856 10:14813154-14813176 GACAAAAGTGTCAAAACTCTAGG - Intergenic
1065609657 10:27460284-27460306 AACACAACTGCCAAAAATGGAGG - Intergenic
1066315887 10:34246100-34246122 GACAAAATTGCCAAATCTGGAGG - Intronic
1067656541 10:48196465-48196487 GAGAGAGATGTCAAAGCTGGGGG - Intronic
1074157511 10:110811749-110811771 GAAATAAATGAGAAAACTGGAGG + Intronic
1075434130 10:122419907-122419929 TTCAGAAATGTTAAAACTGGGGG - Intronic
1078037104 11:7818253-7818275 GGCAGAAAGGACAAAACTGGAGG + Intergenic
1079214756 11:18498692-18498714 GACATAAATTTGAGAACTGGGGG + Intronic
1081974314 11:47222023-47222045 TACACATATGTCAAAACTCATGG - Intronic
1082034692 11:47635390-47635412 AACAGAACTGTCCAAACTGGTGG + Intronic
1084568476 11:69944882-69944904 GACAGAAATGTGAAAGCAGGTGG - Intergenic
1085367291 11:75961359-75961381 GATATAAATGACAAACCTGGAGG - Intronic
1086383264 11:86281596-86281618 GAAACACATGTCAAAACTTATGG - Intergenic
1089417788 11:118306936-118306958 GACACCAATGTTCAAAATGGAGG + Intronic
1090619304 11:128547605-128547627 GACACAACTTTGAAAATTGGTGG + Intronic
1091671315 12:2454077-2454099 GACACAAATGTCAAAACTGGAGG - Intronic
1091940608 12:4477266-4477288 GTTACAAATGCCAAAAGTGGTGG - Intergenic
1093729340 12:22549785-22549807 GACACAAATGGAAAACCTGCAGG - Intergenic
1095270711 12:40215337-40215359 GACAAAAATGACAAGATTGGAGG - Intronic
1095656678 12:44678189-44678211 GAGACAAATGTCAAAACGGTAGG + Intronic
1096419047 12:51440451-51440473 GTCACAAATGTCATAAAAGGCGG - Intronic
1098026294 12:66206181-66206203 GAAAAAAATGTGAAATCTGGGGG - Intronic
1098582556 12:72117515-72117537 AACAAAAATAACAAAACTGGAGG - Intronic
1099035303 12:77579882-77579904 AACACAAATGAGAAAACTGGAGG - Intergenic
1099066657 12:77989080-77989102 GACAGAAATATCAAATCTTGTGG - Intronic
1103156786 12:118692353-118692375 GATAAGAATGTCAGAACTGGAGG - Intergenic
1108906124 13:55476595-55476617 GACACAGATGTTAAAATTGTCGG - Intergenic
1109601753 13:64640257-64640279 GAGACAGATCTCAAATCTGGTGG + Intergenic
1111378992 13:87420968-87420990 TTCACAAATGTCAAAATTTGTGG + Intergenic
1112163529 13:96893932-96893954 GACTTAAATAGCAAAACTGGAGG - Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1115189807 14:30735417-30735439 AACTCAAATGTTAAAACTGAAGG - Intronic
1115454983 14:33591692-33591714 GACACAAAGGTGAAATTTGGGGG - Intronic
1118070614 14:62243294-62243316 GACCCAGATGACAAAACTGTTGG + Intergenic
1119056367 14:71425389-71425411 AACACAAATGCCAAAACTTATGG - Intronic
1120234018 14:81870243-81870265 GACACAAATTTTAAATTTGGAGG + Intergenic
1120452462 14:84685443-84685465 CACACAAATGTAAAAACTCAAGG + Intergenic
1120861934 14:89262344-89262366 CACACAAATATGCAAACTGGAGG + Intronic
1122167741 14:99842017-99842039 GACAAGAATGTAAAAACTTGGGG + Intronic
1122220660 14:100237843-100237865 GAGACAAATGCAAAACCTGGTGG + Intergenic
1123952400 15:25293556-25293578 GCCACATATGACAAACCTGGAGG + Intergenic
1124044718 15:26138274-26138296 GACACAAATCTGAAAGCTGCAGG - Intergenic
1124907062 15:33879640-33879662 GAAACATCTTTCAAAACTGGAGG + Intronic
1126169698 15:45684915-45684937 GACACAAATGTAAAAACAATGGG - Intronic
1126462504 15:48928427-48928449 GACAGAAATGTCTGAACAGGAGG + Intronic
1130426642 15:83807693-83807715 CACACAAAAAACAAAACTGGAGG + Intronic
1130790180 15:87146149-87146171 GACAGAAATGTCAAAGCTTTGGG - Intergenic
1131267340 15:90924532-90924554 GACACAAATATTCAAACTTGCGG - Intergenic
1135036376 16:19081306-19081328 GACACAATTGGAGAAACTGGTGG + Intergenic
1135801554 16:25501882-25501904 AATACAAATGTGAAAACTGAAGG + Intergenic
1137983507 16:53089325-53089347 GATACTAATGGCAAAACTGAAGG + Intronic
1138259821 16:55609211-55609233 AACAAAAAGGACAAAACTGGAGG - Intergenic
1138527013 16:57614673-57614695 AAACCAAATGTCAAGACTGGGGG - Intronic
1140673245 16:77299907-77299929 GACAGAAAAGCCAAGACTGGCGG + Intronic
1142128530 16:88421936-88421958 AACACAAATGTAAAGACTTGTGG + Intergenic
1144353637 17:14423597-14423619 GACTCAAATGTCAATAGTGCTGG - Intergenic
1147215891 17:38898845-38898867 AGCACAAAGGTCAAAACTGGGGG + Intronic
1148752892 17:49955726-49955748 GGCTCATATGTCAGAACTGGAGG + Intergenic
1149230660 17:54530704-54530726 GACACCAATGTTTAGACTGGAGG - Intergenic
1153297756 18:3563834-3563856 GACACTAATGTCTAAACTTGAGG - Intronic
1156361385 18:36387265-36387287 GACACTTTTGTCAAAAATGGGGG + Intronic
1157926226 18:51769201-51769223 GATGCAAAGGTCAAAACTGAAGG - Intergenic
1159139247 18:64372534-64372556 AACATAAATGTCAAAATTGATGG - Intergenic
1159696122 18:71558131-71558153 CACACTGATGTCAAAACTGGAGG + Intergenic
1159727677 18:71982737-71982759 GACAAAAATGTAAAAACAGTGGG + Intergenic
1160727861 19:625508-625530 CACACAATTGACAAATCTGGAGG - Intronic
1161078923 19:2300783-2300805 GACACCAATGCCAGAACAGGAGG - Intronic
1165813581 19:38627291-38627313 CACACACACTTCAAAACTGGGGG - Intronic
925021337 2:571350-571372 GGCACAAAGGACAAAACTGAAGG + Intergenic
925781961 2:7389490-7389512 TACACAGAAGTCAAAAATGGAGG - Intergenic
927402519 2:22729451-22729473 GACAAAAATGACAAAACTCAAGG - Intergenic
927615236 2:24587205-24587227 GACACACATGGCAAAACTCCAGG - Intronic
928160239 2:28916767-28916789 GAAAAAAATGTTACAACTGGAGG - Intronic
929214197 2:39393231-39393253 CACAAAAATGTACAAACTGGTGG + Intronic
929337424 2:40766424-40766446 AACACAAATATCAAAAAAGGAGG + Intergenic
932095771 2:68847148-68847170 GAAACATATGTCAAACCTGTGGG - Intergenic
933375980 2:81480602-81480624 GAAAAAAAGATCAAAACTGGAGG - Intergenic
936228338 2:110678400-110678422 GAGAAAAATGTCTTAACTGGAGG + Intergenic
936961078 2:118075301-118075323 TTCACAAATGTGAAAACTTGTGG + Intergenic
938076878 2:128344540-128344562 TACATAAATGACAAAACTGAGGG - Intergenic
941299238 2:163780541-163780563 GCCTCACATGTAAAAACTGGTGG + Intergenic
944695033 2:202193129-202193151 GACCCAAAAGTCCAAGCTGGTGG + Intronic
944784930 2:203059937-203059959 GGCATACATGTCAAAACAGGGGG - Intronic
945179001 2:207072587-207072609 CTCACAAATGGTAAAACTGGGGG - Intergenic
1169013507 20:2272046-2272068 CACGCATTTGTCAAAACTGGGGG - Intergenic
1170789989 20:19499900-19499922 CACACAAATGCACAAACTGGAGG - Intronic
1172463130 20:35135085-35135107 AAGATAAATGTCATAACTGGAGG + Intronic
1176693445 21:9945389-9945411 GACACAATTGAAGAAACTGGTGG - Intergenic
1176926774 21:14759433-14759455 GACAAAAAGAGCAAAACTGGAGG + Intergenic
1177351743 21:19951935-19951957 GGCATAAATCTCAAAACTGTTGG + Intergenic
1177684029 21:24413804-24413826 GAGAATAATGTCAAAAATGGAGG + Intergenic
1181424963 22:22829277-22829299 GAAACATCTTTCAAAACTGGAGG + Intronic
1181772206 22:25133903-25133925 GACACCAATGTCTAGACTGAGGG - Intronic
1184135868 22:42549598-42549620 TACAGAAGTGTGAAAACTGGGGG + Intergenic
949229445 3:1733332-1733354 GATAAAAATGTTATAACTGGAGG + Intergenic
953943952 3:47129147-47129169 GACAGAAATGACAAGACAGGAGG + Intronic
954454329 3:50589110-50589132 AACACAAATGTTTGAACTGGGGG + Intergenic
955469720 3:59273825-59273847 GAGACAGAGGTCAAATCTGGAGG + Intergenic
955797790 3:62655695-62655717 GACTCAAATGACAAAGTTGGTGG + Intronic
956655074 3:71541894-71541916 GACTCAAAAGTCAACACTCGAGG + Intronic
956948111 3:74247661-74247683 TAGACTAATGTCAAAATTGGAGG + Intergenic
957341680 3:78906481-78906503 GAATCAAATGTGAAAACTGAAGG + Intronic
957391747 3:79582733-79582755 GAGACAAAGTTCAAATCTGGAGG - Intronic
957485931 3:80863063-80863085 GAAAAAAATAACAAAACTGGAGG + Intergenic
957645772 3:82923374-82923396 GACAGCAATGTCAAAACGGATGG + Intergenic
958120009 3:89274106-89274128 GACCCAAAAGTCAATACTTGTGG - Intronic
959267955 3:104167842-104167864 TACACAAAAGTCAAAAATTGAGG - Intergenic
959339153 3:105106442-105106464 GACACCACTGTCAAAAGTAGAGG + Intergenic
961065808 3:123876050-123876072 GCCAAAAATGTCAAAATTGTGGG + Intronic
964291969 3:155191406-155191428 GACACTAATCTCAAACATGGAGG - Intergenic
964410069 3:156388861-156388883 GACAGACTTGTCAAAGCTGGAGG - Intronic
965725801 3:171714291-171714313 AACACTAATGGCAAAACTGGAGG + Intronic
966569466 3:181424959-181424981 CACCCAAATGTTAAAGCTGGAGG + Intergenic
968054058 3:195677505-195677527 GACATAAAAGGCAAAACTGTTGG - Intergenic
968101834 3:195971644-195971666 GACATAAAAGGCAAAACTGTTGG + Intergenic
969728244 4:8938612-8938634 GACACAAATGCCAAAATGGGTGG - Intergenic
970171834 4:13298480-13298502 CACACAAATATGAAAACCGGTGG + Intergenic
970968300 4:21952114-21952136 GTCCCAAATATCAAAAATGGCGG - Intergenic
974228029 4:59073555-59073577 GACATAAATGACAAACCTGTTGG + Intergenic
975869354 4:78761258-78761280 CACAAAGATGTCAGAACTGGAGG + Intergenic
976306506 4:83565399-83565421 GATCCAAATGTATAAACTGGAGG - Intronic
976609226 4:87012545-87012567 TACTTAAATGTAAAAACTGGGGG + Intronic
976665778 4:87589501-87589523 TACACAAATGTCATAACTAGAGG - Intergenic
977393928 4:96448667-96448689 TACACAAAAGTCAAGAATGGAGG + Intergenic
978411788 4:108434017-108434039 GACAAAAATGTAAACATTGGTGG + Intergenic
978912912 4:114086101-114086123 GACAAAAAAATAAAAACTGGAGG - Intergenic
980037402 4:127900985-127901007 GACAAGAAGGACAAAACTGGAGG - Intergenic
981183784 4:141777610-141777632 GAAACAAATGACAAAGCTGAAGG + Intergenic
982613572 4:157610871-157610893 GAAACAAAGGTGAAAACTGAAGG - Intergenic
984237082 4:177172585-177172607 GAAACAAATATCATAACTGCAGG + Intergenic
987952891 5:24698832-24698854 AACTAAAATATCAAAACTGGAGG - Intergenic
988415190 5:30938205-30938227 GACAGGAATGTTAAAATTGGGGG + Intergenic
988662160 5:33282720-33282742 CCCACAAATGTCAAAACTTCTGG + Intergenic
989604955 5:43235351-43235373 GACAAAAATATTAATACTGGAGG + Intronic
990487753 5:56276063-56276085 GAGACCTATGTCAATACTGGGGG - Intergenic
990737146 5:58876909-58876931 GTCACAAATCTGGAAACTGGGGG - Intergenic
992235473 5:74704518-74704540 GACTCAAATTTCAGAACTGTGGG + Intronic
993338236 5:86688773-86688795 GACACAAATCTCAAAAATATGGG - Intergenic
994351097 5:98747420-98747442 GACAAAAATGTCAGAAGTAGAGG + Intergenic
995341254 5:111063150-111063172 AAAACAAATGTTAAAACTGTTGG + Intergenic
999975429 5:156907531-156907553 AACAAGAATGTCAAACCTGGGGG - Intergenic
1003841238 6:10122205-10122227 AAGACAAATTACAAAACTGGGGG + Intronic
1004760532 6:18661087-18661109 GGCAAAAATAACAAAACTGGAGG + Intergenic
1005413804 6:25580213-25580235 CACACAAATGTCAAAGACGGAGG - Intronic
1005528229 6:26673681-26673703 GAGACAATTGTGAAAAGTGGAGG + Intergenic
1005542566 6:26827958-26827980 GAGACAATTGTGAAAAGTGGAGG - Intergenic
1005810306 6:29510133-29510155 TACACAAATATAAAAACTTGAGG - Intergenic
1008249916 6:49227113-49227135 AACAAAAACATCAAAACTGGAGG - Intergenic
1009013379 6:57870076-57870098 GAGACAATTGTGAAAAGTGGAGG - Intergenic
1009770569 6:68138769-68138791 GTCACAAATGTCAAAAATTCTGG + Intergenic
1010047891 6:71469109-71469131 GTCACAAATTTCAAAACATGTGG - Intergenic
1012822434 6:104103064-104103086 TACACAATTGTCAAAACTAATGG + Intergenic
1013312907 6:108914379-108914401 GACACAAATGTCAGGAAAGGAGG - Intronic
1014029530 6:116684365-116684387 GAGACAAATCTCACTACTGGTGG - Intronic
1014076178 6:117236989-117237011 AAAACAAATGTCAGAACTGTGGG + Intergenic
1015077742 6:129181901-129181923 GAGAAAAATATTAAAACTGGGGG + Intronic
1018974918 6:168556852-168556874 TTCACAGATGACAAAACTGGAGG - Intronic
1021412666 7:20346065-20346087 GTTACAAGTGTCAAAGCTGGGGG + Intronic
1023186285 7:37536607-37536629 GAGACAGCTGGCAAAACTGGTGG + Intergenic
1023505476 7:40895758-40895780 AACAAAAAGGACAAAACTGGAGG + Intergenic
1023584738 7:41717393-41717415 GAGAGAGATGTCAAAGCTGGTGG + Intergenic
1024939418 7:54746508-54746530 GATACACGTGTCAGAACTGGAGG - Intergenic
1026066611 7:67079769-67079791 GAAGCAAATGTCAAAACTTAAGG - Intronic
1026155972 7:67826109-67826131 GACTCACATGTCAAAGGTGGAGG + Intergenic
1026710303 7:72732577-72732599 GAAGCAAATGTCAAAACTTAAGG + Intronic
1027817618 7:82996986-82997008 GACATAAATGGCAAAAGTGGAGG - Intronic
1028953185 7:96659540-96659562 CAAAGAAATGTCTAAACTGGAGG + Intronic
1031118227 7:117691268-117691290 TACACAACTGTCAAAACACGTGG + Intronic
1031398393 7:121301641-121301663 GACAAGAAAGTCAAAACTGTTGG + Intergenic
1032293853 7:130616672-130616694 GACACAAATCTCAGAATTTGAGG - Intronic
1032930891 7:136668915-136668937 GAAAAAAATATCAAAGCTGGAGG - Intergenic
1032981695 7:137291589-137291611 GATACTCAAGTCAAAACTGGTGG - Intronic
1033609719 7:142953830-142953852 GAAAAACATGTCACAACTGGTGG - Exonic
1036983077 8:13493112-13493134 GAAACAAGTGTCAAAACAAGGGG + Intronic
1038882604 8:31631223-31631245 AACAAAAGTGACAAAACTGGAGG + Intergenic
1038891285 8:31727211-31727233 AACATAATTGTCAAAACAGGAGG + Intronic
1039772439 8:40701011-40701033 GACATAAAAGTCAAAAGAGGAGG + Intronic
1040484442 8:47856643-47856665 CACACACATGTCTACACTGGTGG + Intronic
1041533752 8:58902510-58902532 GAAAATAATGTCAAACCTGGAGG + Intronic
1042908842 8:73803706-73803728 GACAGAAATGTGAAAATTTGGGG - Intronic
1045508126 8:102793111-102793133 CACACAAATGCCAAAGATGGCGG + Intergenic
1048233917 8:132672385-132672407 GACACAAACATCAAAAATAGTGG + Intronic
1048238533 8:132716890-132716912 AACCCAAATGTCATAAATGGAGG - Intronic
1049939729 9:533949-533971 AACATAAATGTGAAATCTGGGGG - Intronic
1049970672 9:819425-819447 CATACAAATGTAAAAACTGATGG + Intergenic
1050009532 9:1171894-1171916 GACAGAAATGGCAAACCTGATGG - Intergenic
1051416336 9:16844945-16844967 GTCACAAATGACTCAACTGGGGG - Intronic
1053384980 9:37679949-37679971 AACACCAATGCCAACACTGGTGG - Intronic
1053630405 9:39931469-39931491 GACACAATTGAAGAAACTGGGGG - Intergenic
1053775363 9:41532039-41532061 GACACAATTGAAGAAACTGGTGG + Intergenic
1054213482 9:62319233-62319255 GACACAATTGAAGAAACTGGGGG + Intergenic
1056800432 9:89687025-89687047 GGCACAGATGTCAAAGCTGGGGG + Intergenic
1056911461 9:90704692-90704714 CCCCCAAATGTCTAAACTGGAGG + Intergenic
1057604202 9:96487130-96487152 GACACAAATGTTAAACATGAAGG + Intronic
1058658499 9:107247269-107247291 GACTCAAATTTTAATACTGGGGG - Intergenic
1060690983 9:125659997-125660019 GAAAAAAATGTTAAAACAGGAGG - Intronic
1188007608 X:25027003-25027025 AACACAAATGTCTAATATGGGGG - Intergenic
1188275368 X:28193708-28193730 GGCAAAAATAACAAAACTGGAGG - Intergenic
1188421964 X:30001026-30001048 TAAACAAATCTCAAAAGTGGTGG + Intergenic
1189504082 X:41593681-41593703 GACAAAAATGTAGAAATTGGTGG - Intronic
1191796083 X:65023097-65023119 AGCACAAATAACAAAACTGGAGG - Intronic
1193670644 X:84381399-84381421 GGCAAAAATAACAAAACTGGAGG + Intronic
1193899011 X:87152180-87152202 CACACACATCACAAAACTGGAGG - Intergenic
1197052347 X:122075004-122075026 CACACAAATGACAAAATGGGAGG - Intergenic
1197102395 X:122671887-122671909 ACCACCAATGTCAACACTGGTGG - Intergenic
1197467359 X:126821065-126821087 GGCACAAAGGTCAACAATGGGGG + Exonic
1197684431 X:129424254-129424276 AACAAAAATAACAAAACTGGAGG - Intergenic
1197793232 X:130275954-130275976 TACACAAATGACAAAAATTGTGG + Intergenic
1198791381 X:140350593-140350615 GAGACAAATCTAAAGACTGGAGG + Intergenic
1199490414 X:148392501-148392523 AACAAAAATATCAAAGCTGGAGG + Intergenic
1199756698 X:150871452-150871474 GACAGAAAAATCAAAGCTGGAGG + Intronic
1200036766 X:153335972-153335994 GATACAAAGGTCGAAATTGGGGG - Intronic