ID: 1091671623

View in Genome Browser
Species Human (GRCh38)
Location 12:2456345-2456367
Sequence GTTGTGGGAGACTCCCCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091671623 Original CRISPR GTTGTGGGAGACTCCCCTGT CGG (reversed) Intronic
900872185 1:5312019-5312041 GGTGGGGGATACTCCTCTGTGGG - Intergenic
901445374 1:9305062-9305084 GAAGTGGGAGAGGCCCCTGTAGG - Intronic
902845246 1:19105346-19105368 GATGTGGGAAATTCCCATGTGGG - Intronic
904990690 1:34590333-34590355 GGTGGGGGAGGCCCCCCTGTTGG - Intergenic
905481494 1:38265044-38265066 GATGTGGGAGACTCCTCTCCAGG + Intergenic
907021183 1:51068095-51068117 GTTGTGGGAGGGACCCCGGTGGG - Intergenic
909446580 1:75755158-75755180 GTTGCTGTAGACTCCCCTCTGGG + Intronic
910085469 1:83396628-83396650 GTTGTGGGAGGGACCCCGGTGGG - Intergenic
912116755 1:106416881-106416903 GTTGGTGGAGATTCCCCTTTGGG + Intergenic
913034720 1:114952696-114952718 GTTGTGGGAGAGTACCCAGTGGG - Intronic
918937167 1:190936196-190936218 GTTCTGTGAGAGTCCTCTGTGGG - Intergenic
919741512 1:200983961-200983983 CTAGTGTGAGACTCCCCTGAAGG + Intronic
922170445 1:223150093-223150115 GTTGTGGAAATATCCCCTGTTGG + Intergenic
922757507 1:228104764-228104786 GGTGTGGGGCACTCCCTTGTGGG + Intronic
1067469977 10:46528924-46528946 GTTGTCTGAGACTGCACTGTGGG - Intergenic
1076139598 10:128068698-128068720 GTTCTGGAAGACTCTGCTGTGGG - Intronic
1076475986 10:130751741-130751763 GCAGATGGAGACTCCCCTGTAGG - Intergenic
1076833683 10:133009443-133009465 GTTCTGGGCCACTCCCGTGTGGG - Intergenic
1080341874 11:31274007-31274029 GTTGTGGGAGGCACCCAGGTGGG - Intronic
1084719030 11:70892354-70892376 GGTGGGGGGGACTGCCCTGTTGG + Intronic
1087221123 11:95547341-95547363 GTTGTGGGAAATGCCCCTGAGGG + Intergenic
1091671623 12:2456345-2456367 GTTGTGGGAGACTCCCCTGTCGG - Intronic
1092946369 12:13457847-13457869 GTAGAAGGAGTCTCCCCTGTTGG + Intergenic
1093859308 12:24143727-24143749 GTTGTGGGACACTCTACTCTGGG + Intergenic
1094230680 12:28099438-28099460 GTTGTGGGAGGGACCCCTGGTGG - Intergenic
1096913437 12:55007298-55007320 GTTGTGGGAGAGTCCCCAGGAGG + Intergenic
1097043369 12:56169760-56169782 CTTGTGGGAGGCTCACCTATTGG + Exonic
1097119339 12:56719545-56719567 GTTGTGGGAGCCACCCCGGCAGG + Exonic
1100038330 12:90280761-90280783 GTGGTGGGAGAGACTCCTGTGGG + Intergenic
1102709025 12:114909011-114909033 ATTTTGGGAGTCTCACCTGTTGG + Intergenic
1102896589 12:116603250-116603272 GTGTTGGGAGGCTGCCCTGTAGG + Intergenic
1102951245 12:117033043-117033065 GCAGTGGGAGACGGCCCTGTTGG - Intergenic
1102954809 12:117052596-117052618 GTGGTGAGAGCCTCCCCTATAGG - Intronic
1103272324 12:119683706-119683728 GTTGTGGGAGCCCACCCTGAGGG - Intergenic
1108776561 13:53772132-53772154 GTTGTGGGAGAGACCCTGGTAGG - Intergenic
1112495064 13:99897587-99897609 ACTGTGTGAGACTCCTCTGTCGG + Intergenic
1115160436 14:30387679-30387701 GTTGAGGGAGACTCCCCAGAAGG + Intergenic
1115952390 14:38735901-38735923 ATTCTGGCAGACACCCCTGTGGG + Intergenic
1117058681 14:51938827-51938849 GTTCAGGGAGACTACCCTGGTGG - Intronic
1118747211 14:68782812-68782834 GTCCTGGGAGCCACCCCTGTGGG - Intergenic
1126063004 15:44801957-44801979 GTTGTGGAAGACTGACCTGGGGG - Intergenic
1126363548 15:47870831-47870853 GTTGTCTGAGCCTCCCCAGTGGG + Intergenic
1132854886 16:2040304-2040326 GTGGTGGCAGACTCGCCTCTGGG - Intronic
1133045675 16:3087147-3087169 GCTCAGGGAGCCTCCCCTGTGGG - Intergenic
1134047913 16:11114770-11114792 GTTTTGGGTGACTCCTTTGTGGG - Intronic
1135018423 16:18943584-18943606 GTTGTAGGAGAGACCCCTGGTGG + Intergenic
1136188729 16:28602896-28602918 GTTGTGTGAGACTCCCATAAAGG + Intergenic
1136646926 16:31628839-31628861 GTGGAGCGAGGCTCCCCTGTAGG - Intergenic
1138297535 16:55899774-55899796 ATAGTGGGAGGCTGCCCTGTGGG - Intronic
1142635714 17:1256345-1256367 CCTGTCGGAGACTCCCCTCTTGG - Intergenic
1144455919 17:15418190-15418212 GGTGGGGCAGACACCCCTGTAGG - Intergenic
1145116208 17:20212598-20212620 GTTGTGGGAGGGACCCCAGTGGG - Intronic
1146441855 17:32904084-32904106 TTTGTTGGAGATTTCCCTGTGGG + Intergenic
1147428530 17:40357471-40357493 GTGAGGGGAGACCCCCCTGTAGG - Intronic
1147769268 17:42856525-42856547 GTTGTGAGAGAAGCCCCCGTGGG - Exonic
1147772002 17:42874344-42874366 GTTGTGAGAGAAGCCCCCGTGGG - Intergenic
1152629812 17:81405860-81405882 GTTGGGGGAGACTCTCCGGTGGG - Intronic
1153167518 18:2279590-2279612 CCTGTTGGAGACTCCACTGTGGG - Intergenic
1154504559 18:15022227-15022249 GTTGTGGGAGGAACCCCAGTGGG - Intergenic
1154969042 18:21388823-21388845 ATTGTAGGAGACCCCCCTATTGG + Intronic
1159477787 18:68945665-68945687 GTTGTGGAAGAATCTCTTGTAGG + Intronic
1159781602 18:72666918-72666940 GTTGTGAGAGAGGCCCCAGTGGG + Intergenic
1163276520 19:16287826-16287848 GTTCAGGCAGCCTCCCCTGTTGG - Intergenic
1166118815 19:40672586-40672608 ATTCTGGGAGTCTCCCCTTTGGG + Intronic
1166373371 19:42314340-42314362 GTTGGGGGAGACTCACCTCAGGG - Exonic
930618059 2:53614622-53614644 GTTGTGGGTGAGTTCCCTCTTGG - Intronic
932543771 2:72685583-72685605 GTAGTGGCAGACTCCCCTAAAGG - Intronic
938503747 2:131852433-131852455 GTTGTGGGAGGAACCCCAGTGGG - Intergenic
939002992 2:136757667-136757689 TTTGTGGCAGACACCACTGTAGG - Intergenic
941107816 2:161379686-161379708 ATTGGGGGAGACACCCATGTTGG + Intronic
941402517 2:165047830-165047852 GTTGTTGGAGGCTCACCTGTTGG - Intergenic
947529716 2:230901117-230901139 CTGGTGGGAGACTTCCCTGAAGG + Intergenic
948975856 2:241463486-241463508 GGTGTGGGAGTCTCCCGTGTGGG - Intronic
1172189041 20:33050470-33050492 GGTGTGTCAGAGTCCCCTGTTGG + Intergenic
1172891386 20:38268397-38268419 TTTGTGCCAGAGTCCCCTGTTGG + Intronic
1176164501 20:63665610-63665632 TTTGTGGGAGATGCCTCTGTGGG + Intronic
1177992674 21:28057713-28057735 GTTGTGGGAGGAACCCCAGTGGG + Intergenic
1178488855 21:33035298-33035320 GTTGGGGGAGCCTCAGCTGTGGG - Intergenic
1179640959 21:42746936-42746958 GCTCTGGCAGCCTCCCCTGTAGG + Intronic
1179647416 21:42784358-42784380 GCTGTGCCAGACTGCCCTGTGGG - Intergenic
1185029835 22:48436410-48436432 GTTTGGGGAGACGCCCCTGCTGG + Intergenic
949217071 3:1583198-1583220 GCTGTGGGCGCCTCTCCTGTAGG - Intergenic
951208734 3:19950971-19950993 CTTCTGGGAGAGTCCGCTGTTGG + Exonic
951869520 3:27345566-27345588 CTTGTGGGCCACTCCCCTCTCGG - Intronic
952701656 3:36335330-36335352 GGTGGGGGAGGGTCCCCTGTGGG - Intergenic
953435293 3:42872946-42872968 GTGCTGGGAGACTCCCATGTGGG + Exonic
958162107 3:89830830-89830852 GGAGTGAGAGACTCTCCTGTTGG + Intergenic
960529382 3:118746034-118746056 GTTGTGGGAGAGACCCCAGTGGG - Intergenic
963033990 3:141009072-141009094 GTTCAGGGACACTCCTCTGTGGG - Intergenic
967122909 3:186399565-186399587 TTTGTGGGTGCCTCCCCTGGGGG + Intergenic
969549395 4:7854448-7854470 GTTATGGGAGATTCCCCCGTTGG - Intronic
969601347 4:8178211-8178233 GCTGTGGGAGACTCGCCTCACGG + Intergenic
972190777 4:36587989-36588011 GTTGTGGGAGTATCTCCAGTGGG + Intergenic
972700472 4:41490218-41490240 GTTGTTGGAGAGTCAGCTGTAGG + Intronic
981749715 4:148082067-148082089 TTTGTGGGTGCCTGCCCTGTAGG + Intronic
981818279 4:148856264-148856286 GTTGTGGGAGGGACCCCAGTGGG - Intergenic
985043807 4:185919340-185919362 GTTGTGGGCGACTGTGCTGTGGG + Intronic
985901275 5:2796627-2796649 GTTGTGGGAGGCTCACATGATGG + Intergenic
994122615 5:96133885-96133907 GTTTTTGGAGAGGCCCCTGTGGG + Intergenic
997400733 5:133599805-133599827 GTGGCGGGAGCCTCCCCTTTTGG - Intronic
999282043 5:150372379-150372401 GGAGTGCAAGACTCCCCTGTGGG - Intronic
1005021805 6:21425314-21425336 GTTGTGGGAGGAACCCCAGTGGG - Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1013650093 6:112185960-112185982 GATCTGGGTGACTCCCCTGGGGG + Intronic
1013791086 6:113837339-113837361 CTTGTGGGAGACTCCACAGCTGG + Intergenic
1013876096 6:114830823-114830845 TTAGTTGGAGACTCCCCTCTAGG - Intergenic
1018727663 6:166626631-166626653 GGTGTGGGATGGTCCCCTGTGGG - Intronic
1019319361 7:408662-408684 GGGGTGGGGGAGTCCCCTGTTGG + Intergenic
1019781900 7:2945389-2945411 GTTGTGGGAGTCTGGACTGTGGG + Intronic
1023723074 7:43114508-43114530 ATTGTGGTAGAATTCCCTGTTGG + Intronic
1026674523 7:72417758-72417780 GTTGTGGGAGCCTCATCAGTGGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1027302342 7:76853089-76853111 GTTGTGGGAGGGACCCCGGTGGG - Intergenic
1028038757 7:86020141-86020163 GTTGTGGGAGGCTACCGGGTAGG - Intergenic
1031992490 7:128207379-128207401 ACTCTGGGAGAGTCCCCTGTGGG + Intergenic
1032285341 7:130535302-130535324 TCTGTAGGTGACTCCCCTGTCGG - Intronic
1032286125 7:130539702-130539724 TCTGTAGGTGACTCCCCTGTTGG - Intronic
1040152319 8:44138675-44138697 GTTTTGAGACACTCTCCTGTTGG + Intergenic
1040167244 8:44359889-44359911 GTTTTGAGACACTCTCCTGTTGG + Intergenic
1040238568 8:45414578-45414600 GTTTTGAGACACTCTCCTGTTGG + Intergenic
1040244578 8:45503064-45503086 GTTTTGAGACACTCTCCTGTTGG + Intergenic
1040252195 8:45615516-45615538 GTTTTGAGACACTCTCCTGTTGG + Intergenic
1040254452 8:45648631-45648653 GTTTTGAGACACTCTCCTGTTGG + Intergenic
1040261824 8:45757474-45757496 GTTTTGAGACACTCTCCTGTTGG + Intergenic
1040270894 8:45941659-45941681 GTTTTGAGACACTCTCCTGTTGG + Intergenic
1040307862 8:46221532-46221554 ATGGTGGGAGCCTCCCCTGAAGG + Intergenic
1044803855 8:95984472-95984494 GAGGTGGGAGGCTCCCCTGGAGG - Intergenic
1049752965 8:144294327-144294349 TTTGTGGGAGGGTGCCCTGTTGG - Intronic
1050357591 9:4797593-4797615 GTTGTGGGAGGCTGTCCTGTAGG - Intronic
1057444135 9:95102175-95102197 GTTGTGGGATGATCCACTGTGGG + Intronic
1057467670 9:95330483-95330505 TTTGTGGGGGATTTCCCTGTAGG + Intergenic
1061503972 9:131020225-131020247 GCTGGGTGTGACTCCCCTGTAGG - Intronic
1062052906 9:134456727-134456749 CTTCTGGGAGAGACCCCTGTTGG - Intergenic
1186862950 X:13691142-13691164 GTTGTGGGGGGCTGTCCTGTAGG - Intronic
1188380767 X:29488853-29488875 GGTGGGGGAGACGCCCCTTTGGG + Intronic
1188745973 X:33844157-33844179 CTTGTGAGAGATTCCCCTGCTGG + Intergenic
1189520510 X:41762455-41762477 GTTGTAGGATACCCACCTGTAGG - Intronic
1195443235 X:104921437-104921459 GTTGTTGGCCCCTCCCCTGTGGG - Intronic
1197992391 X:132332101-132332123 GTTGGTGGAGGCTCTCCTGTAGG + Intergenic