ID: 1091671623

View in Genome Browser
Species Human (GRCh38)
Location 12:2456345-2456367
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091671623 Original CRISPR GTTGTGGGAGACTCCCCTGT CGG (reversed) Intronic