ID: 1091671701

View in Genome Browser
Species Human (GRCh38)
Location 12:2456746-2456768
Sequence CTGAGGAGGAGGAGCGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1666
Summary {0: 1, 1: 1, 2: 16, 3: 167, 4: 1481}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091671701 Original CRISPR CTGAGGAGGAGGAGCGGGGA GGG (reversed) Intronic
900117068 1:1033457-1033479 CTGGGGAGCAGGAGCTGGGCCGG - Intronic
900149096 1:1170533-1170555 GAGAGGAGGAGGAGGGAGGAGGG - Intergenic
900151932 1:1182615-1182637 CTGAGGAGTTGGAAAGGGGAGGG + Intronic
900159099 1:1215114-1215136 CTGGGGAGCAGGTGCGGGGCTGG + Intergenic
900192785 1:1358566-1358588 CTAAGGAGGGGGAGGGGGTAGGG - Intronic
900315151 1:2052585-2052607 GAGAGGAGGAGGACCTGGGAGGG - Intronic
900478539 1:2887402-2887424 CTGAGGATGGGGGTCGGGGAAGG + Intergenic
900626521 1:3611115-3611137 GTGAGTAGCAGGAGCTGGGAGGG - Intronic
900631717 1:3639863-3639885 CTGAGGATGAGGCCCGGGGTGGG + Intronic
901004568 1:6165572-6165594 CTGAGGAGTGAGGGCGGGGATGG + Intronic
901056410 1:6450498-6450520 CTGAGGCTGAGGCGCGGGGTGGG + Intronic
901344805 1:8530497-8530519 ATGGGGAGGCGGGGCGGGGAGGG + Intronic
901453965 1:9352837-9352859 GTGAGGAGGAGGCTGGGGGAGGG - Intronic
901630763 1:10647090-10647112 CTGGGGAGGAGGAGGGGGAGGGG + Intronic
901641611 1:10695551-10695573 GAGGGGAGGAGGAGCCGGGATGG - Intronic
901689284 1:10962056-10962078 GTGAGGAGGAGGAGGAAGGAAGG - Intronic
901740317 1:11338017-11338039 AAGAGGGGGAGGAGGGGGGAAGG - Intergenic
901740348 1:11338091-11338113 GGGAGGAGGAGGGGAGGGGAAGG - Intergenic
901740385 1:11338179-11338201 GGGAGGAGGAGGAGGGGAGAAGG - Intergenic
901780409 1:11590544-11590566 CCCAGGAGAAGGAGAGGGGAGGG - Intergenic
901798347 1:11692937-11692959 CTGTGGAGGAAGGGAGGGGAGGG + Intronic
901969400 1:12895478-12895500 CTCAGGAGGAGTAGTGGGGTTGG - Intronic
902255422 1:15186070-15186092 CTGAGTGGGAGGAGGGGGCAGGG - Intronic
902278812 1:15359441-15359463 GTGAGGAGGAGGTGCTGGGATGG + Intronic
902380546 1:16050409-16050431 CTGGGGAGGAAGAGCAGGAATGG - Intronic
902412099 1:16217647-16217669 CTGGGGAGGAGGGGCGCGGCGGG - Intergenic
902472162 1:16656730-16656752 TGGAGGAGGAGCAGCAGGGAGGG - Intergenic
902477939 1:16697987-16698009 CTGAGGCTGAGGCGCGGGGTGGG - Intergenic
902486641 1:16750716-16750738 TGGAGGAGGAGCAGCAGGGAGGG + Intronic
902702827 1:18184331-18184353 CTGGGGAGGGGGAGAAGGGAGGG - Intronic
902784730 1:18725529-18725551 CAGAAGAGGGGGAGCAGGGAAGG + Intronic
902829325 1:19000063-19000085 AGGAGGAGGAGGAAAGGGGAGGG + Intergenic
902861482 1:19249809-19249831 CTCAGGAGGCTGAGCTGGGAGGG + Intronic
902955935 1:19924076-19924098 CAGAGCAGGAGGGTCGGGGAGGG - Intergenic
902985065 1:20149955-20149977 CTGGGGAGGGAGAGCCGGGAAGG + Exonic
903020339 1:20389283-20389305 ATCAGGAGGAGGAGCAGGGCTGG + Intergenic
903212226 1:21824616-21824638 CTGCGGAGGAAGAGCGGGTGAGG + Exonic
903294591 1:22335705-22335727 CTGAGCAGGAGGAGGGAGGAGGG - Intergenic
903380835 1:22895961-22895983 CTTAGGAGGAGGAGGGGGGAGGG + Intronic
903534688 1:24059240-24059262 CTCAGGAGGCTGAGCGGGGGAGG - Intronic
903556670 1:24198983-24199005 CTCAGGAGGCTGAGGGGGGAGGG - Intergenic
903576439 1:24342397-24342419 GGGTGGAGGAGGAGAGGGGAAGG - Intronic
903581267 1:24372784-24372806 AGCAGGAGGAGGAGCAGGGAAGG - Intronic
903676414 1:25067369-25067391 TGGAGGAGGTGGAGCGGGAAGGG - Intergenic
903867500 1:26410207-26410229 CTGAGGGGGAAGAGAGGGGGAGG + Intergenic
904087179 1:27917083-27917105 AGGAGGAGGAGGAGGGAGGAAGG - Intergenic
904259930 1:29282690-29282712 TTGTGGAGGAGGAGCGGGCGCGG + Exonic
904293165 1:29500468-29500490 GTGAGGAGGAGGTGCGGGAAAGG + Intergenic
904642109 1:31938527-31938549 ACGAGGAGGAGGAGCGGGGGAGG - Intronic
904772009 1:32886046-32886068 TTGAGGCGCAGGAGCAGGGAGGG + Intronic
904995312 1:34626928-34626950 CAGAGGAGGAGGAGAGGGCAAGG + Intergenic
905121878 1:35688717-35688739 TTGAGGAGGGAGAGTGGGGAAGG + Intergenic
905183965 1:36183044-36183066 CTGAGGAGGGGAGGCCGGGAGGG - Intergenic
905394686 1:37659627-37659649 CTGAGGTGGAGGTGGGAGGACGG - Intergenic
905793521 1:40802619-40802641 CTGAGGAGAAGGAGCCCGGGCGG + Intronic
905859097 1:41335226-41335248 ATGAGGAGAGGGAGCGGGAAGGG - Intergenic
905869570 1:41395353-41395375 CTGGGAGTGAGGAGCGGGGAGGG - Intergenic
906139372 1:43524636-43524658 CTGAGAAGCAGGAGTGGGTAGGG + Intergenic
906143258 1:43545993-43546015 CTGAGGGGGAGGGGCGAGGTCGG + Intronic
906288334 1:44602974-44602996 CCGAGGAGGAGGAGGAGGGGTGG - Intronic
906551293 1:46668329-46668351 CTGAGGAGGAGGAGGAGGCGGGG - Exonic
906720073 1:47997707-47997729 GGGAGGAGGAGGCGCGGGCAGGG - Intergenic
906773107 1:48502768-48502790 CTGAGGATGAGTAGAGTGGATGG + Intergenic
907305933 1:53513224-53513246 CTGGGGAGGGGGAGCCCGGAAGG - Intronic
907308204 1:53525282-53525304 ATGGGGAGGAGGAGAGGGGAAGG + Intronic
907363952 1:53945109-53945131 CTGAGGAGGAGGGTTTGGGATGG - Intronic
907451461 1:54548193-54548215 CTGGGGAGGAGGAGCAGGAGAGG + Intronic
907501425 1:54884418-54884440 GGGAAGAGGAGGAGCAGGGAAGG + Intronic
908216944 1:61963702-61963724 CTGAGGAGGAGGAAGAGGCAGGG + Intronic
908404453 1:63800507-63800529 CTGAGGACTAGGAGCTGGGGAGG + Intronic
908516465 1:64897490-64897512 GGGGGGAGGAGGAGGGGGGAGGG + Intronic
908534643 1:65066740-65066762 CGGAGGAGGAGGAGGAGGGAGGG - Intergenic
908975216 1:69888625-69888647 CTCAGGAGGAGGAGCCAAGATGG - Intronic
909081353 1:71116427-71116449 CTGAGGAAGTGAAGAGGGGAAGG + Intergenic
909217227 1:72904929-72904951 GTGAGGTGGGGGAGGGGGGAGGG + Intergenic
909561803 1:77016076-77016098 ATGAGGGGGAGGAGTGGAGAAGG - Intronic
910001207 1:82344475-82344497 CTGAGGAGGTGGGGCATGGAAGG - Intergenic
910670673 1:89769612-89769634 ATGAGGAAGAGGAGCAGGAAAGG + Intronic
910844511 1:91592570-91592592 CTGGGGAGGAGGTGCATGGAAGG - Intergenic
911725275 1:101236336-101236358 CTGGGGAGGAGAGGCTGGGAAGG - Intergenic
911744503 1:101425622-101425644 GTGGGGTGGAGGAGGGGGGAGGG - Intergenic
911876726 1:103174725-103174747 ATGATGGGGAGGAGGGGGGAGGG + Intergenic
911961559 1:104310332-104310354 CTAAGAAGGAGGAGCGGAAATGG + Intergenic
912306072 1:108568806-108568828 CTGGGAAGGAGGAGAGGGGAAGG + Intronic
912380651 1:109246443-109246465 CTGGGAAGGAGGGGTGGGGAGGG - Intergenic
912442278 1:109708280-109708302 CTGAGGGAGAGGAGCGGCGGTGG - Intronic
913130774 1:115837490-115837512 CTGGGAAGGAGGAGAGAGGAGGG - Exonic
914058049 1:144183172-144183194 AGGAGGAGGAGGAGGGGGAAGGG - Intergenic
914121096 1:144783193-144783215 AGGAGGAGGAGGAGGGGGAAGGG + Intergenic
914876647 1:151517283-151517305 CTGAGGACTAGGAACAGGGATGG - Intronic
915035320 1:152918759-152918781 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
915228843 1:154430723-154430745 CTGAGGAAGAGGAGATGAGAGGG + Intronic
915238594 1:154502947-154502969 CAGAGGGGGCGGAGCGCGGAGGG + Intronic
915312983 1:155013698-155013720 CTGAGGGGGAGGTGGGGGGTGGG + Intronic
915458081 1:156053731-156053753 GGGAGGAGGAGGAGCCGGGCGGG - Exonic
915808913 1:158886100-158886122 CCGAGGAGGAGGAGCCAAGATGG + Intergenic
915824778 1:159063864-159063886 CTGAGGAGGAAGAGGAGGGTTGG - Intronic
916121137 1:161529319-161529341 GTGAGGAGTAGGACCTGGGAAGG - Intergenic
916130911 1:161610959-161610981 GTGAGGAGTAGGACCTGGGAAGG - Intronic
916332049 1:163628292-163628314 GAGGGGAGGAGGAGGGGGGAGGG - Intergenic
916412361 1:164559075-164559097 ACGAGAAGGAGGAGAGGGGAGGG - Intronic
916694628 1:167222006-167222028 CGGAGGGGGGGCAGCGGGGAGGG - Intronic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
917073172 1:171174994-171175016 GGGAGGGGGAGGAGAGGGGAGGG + Intergenic
917329598 1:173868220-173868242 CTGAGGAGGAAGAGCAGAGAGGG + Intronic
917445007 1:175099586-175099608 CTCAGGAGGAGGAGAGGTGAGGG + Intronic
917445014 1:175099609-175099631 GTCAGGAGGAGGAGAGGTGAGGG + Intronic
917445021 1:175099632-175099654 GTCAGGAGGAGGAGAGGTGAGGG + Intronic
917716048 1:177739144-177739166 CTGTGTAGAGGGAGCGGGGAAGG + Intergenic
917802074 1:178580563-178580585 CTGAGGAGGAGGGATGGGGAGGG - Intergenic
918002929 1:180514573-180514595 AAGAGGAGGAGGAGGGGGGGAGG + Intergenic
918028619 1:180779817-180779839 GGGGGTAGGAGGAGCGGGGAGGG - Intronic
918086910 1:181253231-181253253 CTGAGGGAGAGGAGCGGTGGTGG - Intergenic
918087497 1:181258055-181258077 CTGAGGGGTAGGAGAGAGGACGG + Intergenic
918202527 1:182280436-182280458 CTGGGGAGGGGTAGAGGGGAGGG + Intergenic
918556820 1:185811488-185811510 CTTAGGAGGCGGAGGTGGGAAGG + Intronic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
919176731 1:194028451-194028473 AGGAGGAGGAGGAGGGGAGAGGG - Intergenic
919207673 1:194437789-194437811 CTGGGGTGGAGGTGGGGGGAAGG - Intergenic
919449343 1:197751893-197751915 AGGAGGAGGAGGAGGGGAGAAGG + Intronic
919781850 1:201226135-201226157 CTGAGAGGGAGGAGCAGGCAGGG + Intronic
919886159 1:201936487-201936509 TAGAGCAGGAGGAGTGGGGAAGG - Intronic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
919920946 1:202166116-202166138 CTGAGGATGAGGAGTGAGAATGG - Intergenic
919961403 1:202473736-202473758 CTAAGGAGGAGGAGAAGGAAGGG - Intronic
920092428 1:203464131-203464153 AGGAGGAGGAGGAGGGAGGAAGG + Intergenic
920097623 1:203496848-203496870 CTGTGGAGGAGGAGGAGGGAAGG - Intronic
920268872 1:204747782-204747804 CTGCAGAAGAGGAGAGGGGATGG + Intergenic
920335419 1:205241945-205241967 TGGTGGAGGAAGAGCGGGGACGG - Exonic
920655003 1:207868512-207868534 GTGTGGAGGAGGAGGCGGGAAGG - Intergenic
920760764 1:208781889-208781911 TTTAGGAGGGGGAGCGGGAAGGG - Intergenic
921540001 1:216402491-216402513 CTGAGGAGGAGGAGAAAGAAGGG - Intronic
921923111 1:220690327-220690349 CTGGGGCGGAGGAGCGGGCGGGG + Exonic
921928422 1:220732779-220732801 GGGAGGAGGAGGAGGGGGAAAGG - Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922471594 1:225880427-225880449 CTGAGGAGAAGGCAGGGGGAGGG + Intronic
922564126 1:226590174-226590196 CTGAGGAGAAGCTGCCGGGAGGG - Intronic
922621494 1:226991990-226992012 GTGAGGAGGAGAGGAGGGGAGGG + Exonic
922689440 1:227676663-227676685 GTGGGGAGGGGGAGGGGGGAGGG - Intronic
922724399 1:227915705-227915727 CTGGAGAGGAGGAGGGGGAAGGG - Intergenic
922885324 1:229015908-229015930 CTGGGGAGGAGCAACGGGAAAGG + Intergenic
922894430 1:229089283-229089305 TTGAGGAGGGGGAGAGAGGAGGG + Intergenic
923022502 1:230175641-230175663 GTGAGGAGGAGGAGGGGGAGAGG - Intronic
923211135 1:231805474-231805496 CAGAGCAGGAGGAGGGGGGTGGG + Intronic
923482338 1:234397216-234397238 AGGAGGGGGAGGAGGGGGGAAGG + Intronic
923529594 1:234803128-234803150 AAGGGGAGGAGGAGGGGGGAAGG - Intergenic
923534430 1:234838175-234838197 AGGAGGAGGAGGAGGGGGGCGGG + Intergenic
924129818 1:240895429-240895451 ATGGGGTGGAGGAGGGGGGAGGG - Intronic
924415296 1:243850719-243850741 CTGAGGACGAGGGCCGGGCAGGG - Intronic
924608658 1:245556254-245556276 AAGAGGAGGAGGAGGGAGGAAGG - Intronic
924608667 1:245556292-245556314 AGGAGGAGGAGGAGGGAGGAAGG - Intronic
924608678 1:245556338-245556360 AGGAGGAGGAGGAGGGAGGAAGG - Intronic
924637173 1:245799191-245799213 CTGTGTAGGAGGACCAGGGAAGG - Intronic
924878938 1:248136966-248136988 CTGAGGAAGAGGACAGGCGAGGG - Intergenic
924933490 1:248748488-248748510 GTAAGGAGGAGGTGTGGGGAGGG + Intronic
924944701 1:248838451-248838473 CTGGGGCGGGGGAGCGAGGAAGG - Exonic
1062843790 10:689721-689743 CTGAGGAGGCGCCGAGGGGAGGG - Intronic
1062901224 10:1148154-1148176 CTCATGGGGAGGAGCAGGGAGGG + Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063201990 10:3792962-3792984 AAGAGGAGGAGGAGGAGGGAGGG + Intergenic
1063443163 10:6089445-6089467 ATGAGGAGGAGGAGGAGGAAGGG - Exonic
1063499197 10:6537888-6537910 CGGAGGAGGAAGTGCAGGGAAGG - Intronic
1063873000 10:10439782-10439804 CTGGGGCGGGGGAGAGGGGAGGG + Intergenic
1064103949 10:12485493-12485515 CCCAGGTGGAGGAGAGGGGAGGG + Intronic
1064311144 10:14212755-14212777 CTGAGCAGGAGATGCTGGGATGG + Intronic
1064751965 10:18539325-18539347 CTGAGGAGGAAGAGCGGTGCTGG - Exonic
1064778861 10:18810820-18810842 GGGAGGAGGAGGGGAGGGGAGGG - Intergenic
1065276197 10:24088436-24088458 TTGAGTAGGGGGAGGGGGGAGGG - Intronic
1065540843 10:26765615-26765637 CTGAGGAAGAGGGGAAGGGAAGG + Intronic
1066326155 10:34361101-34361123 CTGAGGAGGAGGAGCTCAGAAGG - Intronic
1066408650 10:35144199-35144221 GTAAGGAGGAGGAGTTGGGATGG + Intronic
1066447200 10:35493988-35494010 CTGACCAGGAGGAGAAGGGATGG + Intronic
1067031662 10:42882193-42882215 CTGAGGAGGAGGAGGAGGAAGGG + Intergenic
1067060796 10:43077027-43077049 CTGCGCCGGAGGAGCGGGTAGGG - Exonic
1067083822 10:43227917-43227939 CAGAGAAGGAGGAGGAGGGAAGG - Intronic
1067181022 10:43986120-43986142 CAGAGGAGGAGGAGAGGTCAGGG - Intergenic
1067310714 10:45111183-45111205 CTGAGGAGGAAGAGGAGGGTTGG - Intergenic
1067442596 10:46318020-46318042 CTGATGAAGAGGAGCAGGGTTGG - Intronic
1067582366 10:47453796-47453818 CTGAGGTGGAGGAGGGATGAGGG - Intergenic
1067665061 10:48270693-48270715 AAGAGGAGGAGGTGGGGGGAAGG - Intronic
1068378118 10:56211508-56211530 ATGGGGTGGGGGAGCGGGGAGGG + Intergenic
1068390836 10:56394882-56394904 CTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1068568863 10:58606412-58606434 CTGGGGTGGGGGAGGGGGGAGGG + Intronic
1069615100 10:69801843-69801865 AGGAGGAGGAGGAGGAGGGAGGG + Intergenic
1069634646 10:69917905-69917927 AGGAGGAGGAGGAGATGGGAAGG - Intronic
1069726952 10:70586254-70586276 CTGAAGATGAGGAGGTGGGAGGG + Intergenic
1069786986 10:70994743-70994765 ATGAGGTGGAGGAGAGGAGAGGG + Intergenic
1069850111 10:71398687-71398709 CTGCCAAGGAGGAGCTGGGAAGG + Intronic
1070025286 10:72626177-72626199 CAGAGGAAAAGGAACGGGGAGGG + Intronic
1070032707 10:72692502-72692524 GAGAGGAGGAGGAGGGGCGACGG + Intronic
1070126430 10:73625855-73625877 CTGGGGAGGGGGTGCGGGGAAGG - Intronic
1070346104 10:75543471-75543493 GTGGGGAGGAGGAGAGAGGAAGG + Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070756409 10:78996163-78996185 CTGTGTAGCAGGAGGGGGGAGGG - Intergenic
1070800363 10:79241799-79241821 CTGAGGCTGAGAAGAGGGGATGG + Intronic
1070800689 10:79243091-79243113 AGGAGGAGGAGGAGCGCGGGAGG - Intronic
1070810086 10:79293270-79293292 GGGAGGTGGAGGAGTGGGGAGGG - Intronic
1070919508 10:80175300-80175322 GTGAGCAGGAAGAGCCGGGATGG + Intronic
1070928922 10:80246701-80246723 GGGAAGAGGAGGAGAGGGGAGGG - Intergenic
1071203814 10:83251734-83251756 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1071294179 10:84207254-84207276 GTGAGGAGGAGGAGAGGGGCAGG + Intronic
1071335967 10:84600832-84600854 CTGAGGATGAGGACCAGGGTAGG - Intergenic
1071531228 10:86391615-86391637 CTGAGGAGGAGGAGTGAGCAAGG + Intergenic
1071755154 10:88529139-88529161 CTGAGGAGTGGGAGGAGGGATGG - Intronic
1071948316 10:90673476-90673498 CTGAGGAGGAGGAGCAGAGGAGG + Intergenic
1072044125 10:91637671-91637693 GTGAGGAAAAGGAGAGGGGAGGG + Intergenic
1072273626 10:93801414-93801436 CTGAGGAGGAGGACACGGGTAGG + Intergenic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1072687193 10:97544933-97544955 CTGAGGAGGAGGAAAGGGAGGGG + Intronic
1072875030 10:99163417-99163439 CTGAGGAGGTGGAAAGAGGAAGG - Intronic
1073051066 10:100667775-100667797 GTGCTGAGGAGGAGCGGGGAGGG + Intergenic
1073062600 10:100741482-100741504 ATGGGGAGGAGGAGGGGGAAAGG + Intronic
1073134296 10:101211562-101211584 CTGGGGAGGAGTAGATGGGAAGG + Intergenic
1073137154 10:101226374-101226396 CTGTGGAGGAGGTGAGGTGAGGG + Exonic
1073147789 10:101291996-101292018 GTGAGGACGGGGAGGGGGGAAGG - Intergenic
1073185433 10:101612742-101612764 CTGAGGAGGAGTGGCTGGGTGGG - Intronic
1073597724 10:104817412-104817434 AAGAGGAGGAGGAGGGGGAAGGG - Intronic
1073597780 10:104817575-104817597 AGGAGGAGGGGGAGGGGGGAGGG - Intronic
1073784610 10:106875110-106875132 CTCAGGAGGAGGAGAGTGGAAGG - Intronic
1073897021 10:108173565-108173587 CTGAGGAGGAGAAGGGTGGGGGG - Intergenic
1074107195 10:110397347-110397369 CTGAGGAGGAAGAGGAGGGGTGG + Intergenic
1074490833 10:113938257-113938279 CAGAAGGGGAGGAGCGGAGATGG - Intergenic
1074528661 10:114281692-114281714 CTGGGGTGGAGGGGCGGGGCTGG + Intronic
1074542799 10:114379348-114379370 CTGTGGGGGAGGAGCTGGGTAGG - Intronic
1074778171 10:116781497-116781519 CTGAAGGGGAGGAGTGGGGAGGG + Intergenic
1074801489 10:117005198-117005220 AGGAGGAGGAGGAGCGGGAGCGG - Exonic
1074919476 10:117992981-117993003 GTGAGGGGAAGGAGCGGGGAGGG + Intergenic
1074968113 10:118511300-118511322 CTGAGGAGGAGGAAAGGGAGGGG + Intergenic
1075015973 10:118910294-118910316 CAGAGGCGGAGGAGAGGGGCTGG - Intergenic
1075100414 10:119502591-119502613 CAGAGGAGGAGGGGGAGGGAAGG + Intronic
1075452516 10:122561826-122561848 CAGAGAAGGAGGAGGAGGGAGGG - Intronic
1075575195 10:123572745-123572767 GAGAGGAGGAGGAGAGGGGAGGG + Intergenic
1075592943 10:123705693-123705715 ATGAGGAGGAGGATGGGGGTAGG - Intergenic
1075792046 10:125091813-125091835 TTGGGGAGGAGGAGTGGGTATGG + Intronic
1076312539 10:129518561-129518583 CTGGGGAGGGGGAGGGGGAAGGG - Intronic
1076374186 10:129972696-129972718 CTGCGGCGGAGGCGCGGGGTGGG - Intergenic
1076580350 10:131504703-131504725 GTGGGGTGGAGGAGAGGGGAGGG - Intergenic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1076895477 10:133309228-133309250 CTGAGGTGGTGGGGCGGGGCCGG + Intronic
1076902585 10:133347328-133347350 CTGGGCAGGAGGAGCTGGGCCGG + Exonic
1076989856 11:267356-267378 AGGAGGGGGAGGAGCGAGGAGGG + Intergenic
1077236985 11:1486574-1486596 GTGGGGAGGAGAAGCGGGGCGGG + Exonic
1077394999 11:2316338-2316360 CTGAGGGGCAGGAGGTGGGAAGG - Intronic
1077479332 11:2806284-2806306 GTGAGGAAGAAGAGAGGGGAGGG + Intronic
1077484055 11:2830802-2830824 CTGATGATGGGGAGAGGGGAAGG - Intronic
1077491715 11:2863864-2863886 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1077914434 11:6602102-6602124 CTGAGGAGGAGGAGGAGGAAAGG - Exonic
1077919004 11:6629578-6629600 CTGAGGAGGGGCAGCATGGAGGG + Intronic
1078313475 11:10270492-10270514 CTGAGGAGGAGGAAGAGGAAGGG + Intronic
1078519572 11:12052360-12052382 CAGAGAAGGAGGTGCGAGGATGG + Intergenic
1078599157 11:12715389-12715411 CTGGGGAGGAGGAGAGGGTATGG + Intronic
1078660648 11:13282863-13282885 TTGTGGAGGAGGAGATGGGATGG + Intronic
1079127064 11:17724655-17724677 CTCAGGAGGAGAAGCAGGTATGG + Intergenic
1079249160 11:18774511-18774533 CTGAGGAGGAGGGGGCTGGAGGG + Intronic
1079347788 11:19668130-19668152 CTGAGCAGGCAGAGCAGGGAGGG + Intronic
1079383873 11:19961706-19961728 GTGAGGAGGAGTAGAGGAGATGG + Intronic
1079408085 11:20162737-20162759 CAGGGAAGGAGGAGCTGGGAAGG - Intergenic
1079431827 11:20397486-20397508 TTGAGGAAGAGGAAAGGGGAGGG - Intronic
1079451612 11:20603800-20603822 CTGAGGAGGAGGTGTGGTGAAGG + Intronic
1079695576 11:23478041-23478063 CTGAGGAGGCTGGGAGGGGAGGG + Intergenic
1080174742 11:29349076-29349098 AGGAGGAGAAGGAGAGGGGAAGG + Intergenic
1080577008 11:33609278-33609300 CTGAAGAGGCTGAGCTGGGACGG - Intronic
1080797851 11:35582038-35582060 CTGAGTAGGAAGAGCAGGAAGGG + Intergenic
1081648214 11:44804791-44804813 CTGAGGAGGAAGGGTGGGGGTGG + Intronic
1081759864 11:45569672-45569694 CTGGGGAGGAGGGGAAGGGAGGG + Intergenic
1081773938 11:45665327-45665349 CGGAGGAAGAGGAGGGAGGAGGG - Exonic
1081864242 11:46350964-46350986 CTGAGGAGGAGGAGGAGGAGAGG + Intronic
1081967386 11:47178003-47178025 GTGAGGAGGACGAGCAGGGCTGG - Exonic
1081981663 11:47270393-47270415 CTGCCGAGGAGGGGCGGGGACGG + Intronic
1082009880 11:47442638-47442660 GTGAGGTGGGGCAGCGGGGAAGG - Exonic
1082079424 11:48000668-48000690 CTGAGGGAGAGGGGCGGGGTAGG - Intronic
1082097561 11:48143793-48143815 GGGAGGAGGAGGAGAGGGGAGGG - Intronic
1082097575 11:48143826-48143848 GGGAGGAGGAGGAGAGGGGAGGG - Intronic
1082719985 11:56662324-56662346 GTGAGGTGGAGCAGAGGGGAGGG - Intergenic
1082849839 11:57754813-57754835 GGGAGGAGGAGGGGAGGGGAAGG - Intronic
1083243836 11:61410203-61410225 CTTAGGAGGTGGAGGTGGGAGGG - Intronic
1083267594 11:61553962-61553984 CTGAGGCGGAGGGGAGGGGGTGG + Intronic
1083318142 11:61828746-61828768 AGGAGGAGGAGGATTGGGGAGGG - Intronic
1083372155 11:62190677-62190699 GATAGGAGGAGGCGCGGGGAGGG - Intronic
1083627224 11:64077970-64077992 CTGAGGAGGAGGCAGGGGAAAGG - Intronic
1083749287 11:64752620-64752642 TGGAGGAGGAGGGGCTGGGAGGG - Intronic
1083831437 11:65236363-65236385 CTGAGGAGGAGGGGAGGAGAGGG - Intergenic
1083901133 11:65644108-65644130 TTAAGGAGGAGGAGCAGGGTGGG + Intronic
1083913052 11:65721029-65721051 GGGAGGAGGGGGAGGGGGGAGGG - Intergenic
1084104874 11:66974976-66974998 AGGAGAAGGAGGAGGGGGGAGGG + Intergenic
1084148880 11:67278910-67278932 GTGAGGCAGAGGAGCGGGGTTGG - Intronic
1084224109 11:67704303-67704325 CTGAGGGAGAGGAGCGGCGGTGG - Intergenic
1084315121 11:68341434-68341456 TTGAGAAGGAGGAGAAGGGAGGG - Intronic
1084365234 11:68693264-68693286 CTGGGGCGGAGGAACGGGAAGGG - Intergenic
1084433461 11:69124037-69124059 CTGAGGTGGAGGCCCTGGGAGGG - Intergenic
1084447433 11:69212084-69212106 CGGAGGAGGGGAAGAGGGGAAGG - Intergenic
1084471738 11:69365678-69365700 CTGAGGAGGAGGGGTGGAGGAGG + Intronic
1084571663 11:69963418-69963440 AGGAGGAGGAGGAGGGGGAAGGG + Intergenic
1084717293 11:70882163-70882185 TGGAGGAGGAGGAGGAGGGAGGG + Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084794559 11:71496523-71496545 CAGAGCAGGAGGTGAGGGGAGGG - Intronic
1084868542 11:72080274-72080296 CTGAGAGGGAGGAGCCGGGGGGG - Intronic
1084869921 11:72091457-72091479 CTGAGGAGGAGGAGAGGTGGGGG + Intronic
1084972509 11:72779657-72779679 CTGAGGAGCAGGGATGGGGAAGG - Intronic
1084972513 11:72779663-72779685 CTGAGCCTGAGGAGCAGGGATGG - Intronic
1085243919 11:75082301-75082323 CTGGGGTGGGGGAGTGGGGAGGG + Intergenic
1085256231 11:75175120-75175142 CTGGGGATGGGGAGTGGGGAGGG + Intronic
1085279614 11:75321279-75321301 CTGAGGAAGAGGTGGGGGGATGG - Intronic
1085301241 11:75460000-75460022 CTGAGGATGAGGGCCAGGGAGGG - Intronic
1085310039 11:75510752-75510774 CGGAGGAGGAGGAGGGGGGAGGG - Intronic
1085326568 11:75610975-75610997 GTGAGGAGGAGGGGTGAGGAAGG - Intronic
1085423131 11:76380863-76380885 CTGAGGAGGCGGGGAGGGGAGGG - Exonic
1085470349 11:76753575-76753597 CCGACCAGGAGGAGCAGGGAGGG + Intergenic
1086488829 11:87337969-87337991 ATCAGGAGGAGGGGAGGGGAGGG + Intergenic
1087680383 11:101213317-101213339 CTGAGGGGAAGGAGCGGTGGTGG + Intergenic
1087761837 11:102110750-102110772 CCGAGGTGGAGAAGCGGCGACGG - Exonic
1087896261 11:103589981-103590003 ATGAGGAGCTGGAGAGGGGATGG - Intergenic
1088079551 11:105894645-105894667 AGGAGGAGGAGGAGGAGGGAGGG + Intronic
1088422245 11:109661138-109661160 CTGCTGAGGAGGAGTAGGGAAGG - Intergenic
1088440839 11:109868244-109868266 ATGAGGAGTAGGAGTGGGGCTGG - Intergenic
1088544024 11:110941928-110941950 CTGAGGAGGAGGAAGGGAGGGGG + Intergenic
1089341413 11:117760320-117760342 CTGAGGAGGAGGCGATGGGCTGG - Intronic
1089534516 11:119152478-119152500 CTAAGGAGGTGGAGTGGGGAGGG + Intronic
1089603830 11:119630276-119630298 CTGAGGAGGAGGAGCTTGTGAGG - Intronic
1089640359 11:119843786-119843808 TTGGGGAGGAGGAGGGGGAAAGG + Intergenic
1089650261 11:119908327-119908349 CTGGGGAGGTGGAGCAGGGCTGG + Intergenic
1089746893 11:120623915-120623937 AGGAGGAGGAGGAACGGGGAGGG - Intronic
1089775575 11:120833091-120833113 CTGAGGAGGGGCAGCTGGGAGGG - Intronic
1089792143 11:120953038-120953060 GTGGGGAGGAGGAGAGGGGGAGG + Intronic
1090062598 11:123477206-123477228 GAGAGGAGGGGGAGGGGGGAGGG - Intergenic
1090086398 11:123654409-123654431 CTGGGGAGGTGCAGCGGGGCCGG + Exonic
1090743793 11:129691339-129691361 CTGAGCAGGAGGCTGGGGGAGGG - Intergenic
1090813107 11:130265102-130265124 CTGAGGAGGAGGAGAGAGATGGG - Intronic
1090855583 11:130607323-130607345 CTGAGGAGGAGGTGGAGGGAGGG + Intergenic
1090979017 11:131700665-131700687 CTGAGGATGAGGTGCCTGGAAGG - Intronic
1091070514 11:132558409-132558431 GGGAGGAGGAGGAGGGGAGAAGG - Intronic
1091124423 11:133082559-133082581 ATGAGGAGGAGAGGAGGGGAAGG - Intronic
1091218813 11:133918946-133918968 AGGGGGAGGAGGAGCGGGGACGG + Intronic
1091286697 11:134412099-134412121 GCGGGGAGGGGGAGCGGGGAGGG + Intergenic
1091305722 11:134535012-134535034 CTGAGGAGCAGGACGGGAGATGG + Intergenic
1091358591 11:134957242-134957264 CAGAGGAGGAGGAGCAGCAAAGG + Intergenic
1091424800 12:378216-378238 CTGAGGAGTAGGAATGGGGGTGG + Intronic
1091445740 12:543393-543415 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091445752 12:543435-543457 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091445796 12:543603-543625 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091445808 12:543645-543667 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091445863 12:543855-543877 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091445896 12:543981-544003 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091445908 12:544023-544045 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091445919 12:544065-544087 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091451553 12:575415-575437 CAGAGCAGGAGCAGCTGGGAAGG - Intronic
1091600055 12:1912568-1912590 ATGAGAAGGAGGAGAGGGGAGGG + Intronic
1091636284 12:2199333-2199355 CTGAGGAGGAGGAAGGGGAGGGG - Intronic
1091671701 12:2456746-2456768 CTGAGGAGGAGGAGCGGGGAGGG - Intronic
1091687341 12:2572774-2572796 AGGAGGAGGAGGAGAGGAGAAGG - Intronic
1091687349 12:2572805-2572827 GGGAGGAGGAGGAGAGGAGAAGG - Intronic
1091747167 12:2999802-2999824 CTGAGTGTGAGGAGCGGGGAAGG - Intronic
1091789028 12:3260717-3260739 CAGAGGTGGAGGGGCAGGGAGGG + Intronic
1091789962 12:3266431-3266453 ATGAGGAGGAAGGGCAGGGAAGG + Intronic
1092011470 12:5116568-5116590 GTGGGGTGGGGGAGCGGGGAGGG - Intergenic
1092012090 12:5122413-5122435 CTGAGGCGGAGGAGCCAAGATGG - Intergenic
1092024872 12:5232059-5232081 CTGGGGTGGAGCAGAGGGGAGGG - Intergenic
1092217578 12:6693961-6693983 CTGAGGAGGGGGAAAGGGCAGGG + Exonic
1092237450 12:6819034-6819056 TTGAGGAGGAAGAGCTGGGAGGG + Intronic
1092239874 12:6829836-6829858 CTGAGGAGGCGAAGGGAGGAGGG - Intronic
1092658223 12:10710088-10710110 CTGGGGAGGAGGAGGAGGAAGGG - Exonic
1092797631 12:12128916-12128938 ATGAGGAGGAGGAGTGGGGGTGG - Intronic
1092849173 12:12611674-12611696 CTGAGGAGGCGGGGCTGGGCTGG - Intergenic
1092875284 12:12842385-12842407 CTGAGGAGCAGGCCTGGGGAAGG - Intergenic
1092926294 12:13275483-13275505 CGGAGAAGGAGGAGAGGGGATGG - Intergenic
1092986615 12:13851929-13851951 CAGAGGAGGAGGAGGGTGGGTGG + Intronic
1093926299 12:24911700-24911722 ATGAGGACGAGGGGTGGGGAGGG - Intronic
1095485607 12:42681257-42681279 CTGAGGAACAGGACTGGGGAAGG - Intergenic
1095748097 12:45682162-45682184 ATGAGGAGGTGGAAGGGGGATGG - Intergenic
1096194015 12:49637391-49637413 CTGAGGGGGAAGAGAGGGAATGG - Exonic
1096496111 12:52040387-52040409 CTGAGGAGGAAGGGTAGGGAGGG - Intronic
1096572597 12:52532460-52532482 TTGAGGAGGGGCAGAGGGGAGGG - Intergenic
1096676719 12:53230288-53230310 CTGAGGTGGAGTTGAGGGGAGGG + Intronic
1096750996 12:53758817-53758839 CTGAGGGAGGGAAGCGGGGAGGG - Intergenic
1096884019 12:54698913-54698935 TGGAGGAGGAGGAGCGGGGGTGG - Intergenic
1096886159 12:54721350-54721372 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1096886182 12:54721434-54721456 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1096918978 12:55063623-55063645 CTGAGAAGCAGGGGTGGGGATGG + Intergenic
1096975261 12:55696238-55696260 CCCAGGGGGAGGAGCTGGGAGGG - Intronic
1096979533 12:55720314-55720336 CTGAGGAGGAGGAGGAGCCAGGG - Intronic
1097050427 12:56219907-56219929 CTGAGGAGGCTGAAGGGGGAAGG + Intronic
1097173244 12:57128851-57128873 CAGAGAAGGAGGAGGGGGAAAGG + Exonic
1097174716 12:57136045-57136067 CTGAGGGGGAAGAGGGGGGCTGG - Intronic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097640445 12:62174401-62174423 CTGAGGAAGAGGAGCCAGCAAGG + Intronic
1098116548 12:67184740-67184762 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1098236378 12:68422359-68422381 GGAAGGAGGGGGAGCGGGGAAGG - Intergenic
1098504852 12:71237605-71237627 AAGAGGAGGAGGAGGGTGGATGG - Intronic
1098542374 12:71671041-71671063 CTGAGGAGGAGGAGGAAGAAGGG + Intronic
1099288021 12:80739451-80739473 CTGAAGGGGAGGAGAAGGGAGGG + Intergenic
1100767266 12:97881066-97881088 CTGAGGAGGTGGAGTGAGAATGG - Intergenic
1101626796 12:106451633-106451655 CGGGGGGGGAGGAGAGGGGAGGG + Intronic
1102180136 12:110906329-110906351 AGGAGGAGGAGGAGGAGGGAGGG + Intronic
1102258399 12:111429053-111429075 AGGAGGAGGAGGAGGAGGGACGG + Intronic
1102462228 12:113107008-113107030 CTGAGGAGCTGGAGGGGGAAAGG + Intronic
1102466973 12:113135686-113135708 CCGAGCAGGAGGAGCGCGCAGGG + Intronic
1102470605 12:113157879-113157901 CTGATGAGGAGGTGATGGGAAGG + Exonic
1102555535 12:113724300-113724322 CTCGGGAGGCTGAGCGGGGAGGG - Intergenic
1102655629 12:114480351-114480373 GTGAGGAGGAGGAGGAGGAAGGG + Intergenic
1103152026 12:118649114-118649136 ATTAGGAGGAGAAGCTGGGAGGG + Intergenic
1103325383 12:120116785-120116807 CTGAGGAGGAGGAGGGGGAGCGG - Exonic
1103865541 12:124049234-124049256 CTCAGGAGGTGGGGTGGGGAGGG - Intronic
1103914430 12:124369192-124369214 CTGAAGAGTAAGAGAGGGGAAGG + Intronic
1103932385 12:124457592-124457614 AGGAGGAGGAGGAGGAGGGAGGG + Intronic
1103963906 12:124626181-124626203 CAGAGGAGGAGGAGTGTGGAGGG - Intergenic
1104316227 12:127704394-127704416 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1104617811 12:130285014-130285036 CTGAGGTGGAGGTGGGGGGATGG + Intergenic
1104749938 12:131231912-131231934 GTGAGGAGGAGGAGGAGGGGAGG - Intergenic
1104782785 12:131432558-131432580 ATGAGGAGGAGGAGTTGGGGAGG + Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1105538009 13:21287809-21287831 ATAAGGAGGAGCAGCGAGGACGG - Intergenic
1105546615 13:21355449-21355471 CTGGGGAGGGGGAGGAGGGAAGG + Intergenic
1105578909 13:21675569-21675591 CGGAGGAGGAGGAGGGCCGAAGG - Intronic
1105859332 13:24395254-24395276 CTGGAGAGGAGGAGAGGGGTTGG - Intergenic
1106168658 13:27270749-27270771 GAGACGAGGAGGAGCTGGGACGG + Exonic
1106180572 13:27365901-27365923 CTCAGGAGGATGAGGTGGGAGGG - Intergenic
1106389964 13:29325511-29325533 AGGAGGAGGAGGAGGGAGGAAGG + Intronic
1106767866 13:32933372-32933394 CTGAGGAAGAGGTGTGGGGAAGG + Intergenic
1106898973 13:34334921-34334943 CTGAGGAAGAGGAGAGTGCAGGG + Intergenic
1106925275 13:34606876-34606898 TTGAGGATGAGGGTCGGGGAGGG + Intergenic
1107145860 13:37059721-37059743 CGGAAGGGGAGGAGCCGGGAGGG + Intergenic
1107374858 13:39792551-39792573 CTGAGGAGGAGGAGAAAGGGGGG + Intergenic
1107433706 13:40362972-40362994 CCGAGGAGGAGGAGGAGGGCTGG - Intergenic
1107851667 13:44577415-44577437 CGGAGGAGGAGGAGGGAAGATGG + Intergenic
1107890062 13:44906261-44906283 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1107906005 13:45061848-45061870 GTGAAGAGGAGAAGAGGGGAAGG - Intergenic
1108192775 13:47959472-47959494 GGGCGGAGGAGGAGGGGGGAAGG + Intronic
1108383008 13:49872203-49872225 CTCAGGAGCAGAAGCAGGGAAGG + Intergenic
1108447794 13:50526833-50526855 CTGAGGAGGATGGGCTGAGAGGG + Intronic
1108477090 13:50831102-50831124 GTAAGGAGGAGGAGAGGGGAGGG + Intronic
1108687718 13:52835271-52835293 ATGGGGAGGGGGAGGGGGGAAGG + Intergenic
1109041992 13:57350598-57350620 GTGAGGAGGAGGAGAAGGAAGGG - Intergenic
1109268845 13:60231820-60231842 GTGGGTGGGAGGAGCGGGGAGGG + Intergenic
1110519236 13:76455853-76455875 AGGAGGAGGAGGAGAAGGGAAGG + Intergenic
1111087827 13:83400160-83400182 GTGGGGTGGGGGAGCGGGGAAGG - Intergenic
1111942495 13:94625515-94625537 CAGAGGAGGGGGAGCTGGGCAGG - Intronic
1112333045 13:98491315-98491337 ATTAGGAAAAGGAGCGGGGAGGG + Intronic
1112489612 13:99849753-99849775 AAGAGGAGGAAGAGAGGGGAAGG + Intronic
1112535899 13:100254976-100254998 CTGAGGAGGCTGAGGTGGGAGGG + Intronic
1112913967 13:104523078-104523100 CAGAGGAGGAGAAGCAGGGTGGG - Intergenic
1113098213 13:106688903-106688925 CTGAGGAGGAGCAGCTGGAGAGG + Intergenic
1113120236 13:106917570-106917592 CGGAGGAGGACGCGCGGGGCCGG + Intergenic
1113179805 13:107612122-107612144 GAGGGGAGGAGGAGTGGGGAGGG + Intronic
1113440160 13:110322498-110322520 CTCAGGAGGAGGACAGGGGATGG + Intronic
1113460411 13:110478542-110478564 CTGGAGCAGAGGAGCGGGGAGGG + Intronic
1113521644 13:110946159-110946181 CTGAGTGGGAGGTGCTGGGATGG + Intergenic
1113680835 13:112243757-112243779 CTGTGGAGAAGGAGCAGGGCAGG + Intergenic
1113748928 13:112765224-112765246 GTGAGGAGGAGCAGCAGGGGTGG + Intronic
1113768315 13:112894271-112894293 CGGAGGGGGAGGGGCGGAGAGGG - Intergenic
1113924334 13:113931950-113931972 CAGAGGAGCAGGAGGGTGGAGGG - Intergenic
1114003869 14:18289846-18289868 CGGAGGAGGAGGAGCCAAGATGG - Intergenic
1114525496 14:23365213-23365235 GGCAGGAGGAGGAGCGGGGCGGG + Exonic
1114533265 14:23408372-23408394 CAAAGGAGGAGGAGCCAGGAGGG - Intergenic
1114581959 14:23769314-23769336 CTGGGGAGGCGGCGGGGGGATGG + Intergenic
1114777333 14:25498659-25498681 CTGGGGTGGGGGAGGGGGGATGG + Intergenic
1114880040 14:26773237-26773259 CGGAGGAGTAGAAGCAGGGATGG - Intergenic
1115055530 14:29121589-29121611 TGGGGTAGGAGGAGCGGGGAGGG + Intergenic
1115094540 14:29618971-29618993 ATGAGGAGGAGGAAGGGGGAGGG + Intronic
1115238292 14:31229723-31229745 CTGGGGAGGAGCAGAGGGGTGGG - Intergenic
1115307072 14:31944403-31944425 ATGAGGAGGAGGAGGAGAGATGG - Intergenic
1116665125 14:47764851-47764873 CTGAGGAGGAGGAGGAGGAAGGG + Intergenic
1118207631 14:63738153-63738175 CTGAGGAGGCTGAGGTGGGAAGG - Intergenic
1118317895 14:64736927-64736949 CGGGGGAGGAGGAGGGAGGAGGG + Intronic
1119178904 14:72590867-72590889 CTGAGGATCAGGACTGGGGAAGG + Intergenic
1119424861 14:74528598-74528620 CCGAGGAGGAGGAACTGGCAAGG - Exonic
1119605717 14:76014655-76014677 CTGAGGAGAAGGAGAGGTCAAGG - Intronic
1119757228 14:77127724-77127746 ATGTGGAGGAGGGGCTGGGAGGG + Intronic
1120614425 14:86685527-86685549 CTCAGGAGGAAGAGGTGGGAGGG - Intergenic
1120669442 14:87347299-87347321 CTGAGGAGTGGGGGTGGGGATGG + Intergenic
1120876668 14:89381841-89381863 CAGAGAAGGAGGGGAGGGGAGGG + Intronic
1121078373 14:91088040-91088062 AGGAGGAGGAGGAGCTGGGCAGG + Intronic
1121338403 14:93090947-93090969 ATGAGGAGGAAGAGCAGGGGAGG - Intronic
1121620782 14:95346864-95346886 GTGGGGAGGTGGAGCTGGGAGGG - Intergenic
1121997280 14:98612991-98613013 CTGAGGCGCAGGCTCGGGGAAGG + Intergenic
1122081700 14:99271328-99271350 CAGAGGAGGAGGTGCGGCGGCGG - Intronic
1122426248 14:101607755-101607777 TGGAGGAGGAGGAGAGGTGAAGG - Intergenic
1122558247 14:102592819-102592841 CTGAGGAGGGGGCGCCGAGACGG - Exonic
1122688524 14:103521141-103521163 AGGAGGAGGAGGAGGAGGGAGGG - Intronic
1122760392 14:104020627-104020649 CGGAGGAGGCGGAGCGGGTCAGG + Intronic
1122907164 14:104807065-104807087 CTCAGGAGGCTGAGTGGGGAGGG - Intergenic
1122919653 14:104874747-104874769 CTGCAGAGGAGGACCGGGGGTGG - Intronic
1122972431 14:105157896-105157918 CTGAGGATGAGGAGGGTGGTGGG - Intronic
1123001221 14:105295498-105295520 CTCAGGAGGCTGAGCTGGGAGGG + Intronic
1123033329 14:105461417-105461439 CTGAGGTGGAGGTACAGGGAAGG - Intronic
1202906015 14_GL000194v1_random:72884-72906 CTTCCGAGGAGGAGCGGGGCGGG + Intergenic
1123474995 15:20582914-20582936 CGGCAGAGGAGGAGCGGGGCGGG - Intergenic
1123643016 15:22417443-22417465 CTGCAGAGGAGGAGCGGGGCGGG + Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1123726702 15:23110237-23110259 CTCAGAAGGAGGAGCAGGGCAGG + Intergenic
1124587492 15:31023213-31023235 CCAAGGAAGAGGAGCAGGGAAGG + Intronic
1124816783 15:33001702-33001724 AGGAGGAGGAGGAGGGGGAAGGG - Intronic
1125521460 15:40350159-40350181 AGGAGGAGGAGGAGGAGGGAAGG + Intergenic
1125542075 15:40475370-40475392 GTGAGGAAGAGGAGAGGAGAGGG + Intergenic
1125589893 15:40847540-40847562 CTGGGGAGGAGGAGAGGTGGGGG - Intronic
1125759173 15:42085270-42085292 CTTTGCAGGAGGAGAGGGGAGGG + Intronic
1125796860 15:42409764-42409786 CTGAGGAGGAAGGGAGAGGAGGG - Intronic
1126292669 15:47099678-47099700 CTGAGGAGCAGGAGCATGGGAGG - Intergenic
1126483973 15:49158931-49158953 CTGAGGAGGCTGAGATGGGAAGG - Intronic
1126697907 15:51341451-51341473 CTGCGGAGGAGGGGCTGGCAGGG - Intergenic
1126776190 15:52102607-52102629 GTGAGGAGGAGGAGCCTTGAAGG - Intergenic
1126778549 15:52119422-52119444 GGGAGGAGGAGGAGATGGGAGGG + Exonic
1126789586 15:52209009-52209031 CAGAGGACGAGGAGAGAGGATGG + Intronic
1126822581 15:52519502-52519524 CTCAGGAGGCTGAGCTGGGAGGG + Intronic
1126950720 15:53877598-53877620 GGGAGGAGGAGGAGGGGTGAAGG + Intergenic
1127058075 15:55152706-55152728 CTCAGGAGGCTGAGGGGGGAGGG + Intergenic
1127500908 15:59553447-59553469 CTGAGAGGGAGGAGAGGAGATGG + Intergenic
1127707704 15:61563425-61563447 CAGAAGAGAAGGAGCTGGGACGG + Intergenic
1127856174 15:62955473-62955495 CTGAGGAGGAGGAAGGGGGATGG + Intergenic
1128072832 15:64807989-64808011 CTGCGGGGGAGGAGTGGAGATGG + Intergenic
1128082644 15:64865567-64865589 CAAGGGAGGAGCAGCGGGGATGG - Exonic
1128087215 15:64894582-64894604 TTGAGGAGGGGGAGAGGGAAGGG + Intronic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128310805 15:66630902-66630924 CTGCGGAGGAGTACTGGGGAGGG + Intronic
1128375873 15:67075428-67075450 CTGGGGAGCAGGAGAGGGGGAGG + Intronic
1128495847 15:68198100-68198122 CCGTGGAGGAGGGGCTGGGATGG - Intronic
1128589325 15:68880740-68880762 CTGATGAGAAGGAGGGGGGCAGG + Intronic
1128726238 15:69990618-69990640 CTGTGCATGAGGAGCTGGGATGG + Intergenic
1129510275 15:76116481-76116503 GTGAAGAGGAGGAGAGGGGGAGG - Intronic
1129674244 15:77623684-77623706 CTGAGGAGGAGGAGGGGAAAGGG - Intronic
1129705489 15:77791827-77791849 CTTGGGAGGAGCAGCTGGGAGGG + Intronic
1129742519 15:77996357-77996379 CTGAGGAGGTGCAGCAGGAATGG - Exonic
1129842958 15:78755099-78755121 CTGAGGAGGTGCAGCAGGAATGG + Intergenic
1130039655 15:80395500-80395522 GTGAGAAGGAGGAGCAGGAATGG + Intronic
1130203434 15:81854097-81854119 CTCAGGAGGCTGAGCTGGGAGGG + Intergenic
1130651467 15:85764343-85764365 CTGAGGAGGGGCTGCGCGGAGGG + Intronic
1130721100 15:86386257-86386279 AGGAGGAGGAGGAGGGAGGAGGG - Intronic
1130879411 15:88042410-88042432 CGGAGGAGGCAGAGAGGGGAGGG - Intronic
1130908552 15:88256175-88256197 AAGAGGAGGAGGAGAGGAGAGGG + Intronic
1131048144 15:89329111-89329133 CTGAGGAGGAGGAGGAGAAAAGG + Intronic
1131090672 15:89622695-89622717 CTGGGGAGGTGGAGCGGGGAGGG - Intronic
1131119632 15:89814452-89814474 CTGGGGAGGACGGACGGGGAGGG - Intronic
1131139826 15:89968116-89968138 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1131139834 15:89968129-89968151 GGGAGGAGGGGGAGGGGGGAAGG + Intergenic
1131229166 15:90647470-90647492 GTGTGGAGGAGGAGGGGTGAGGG - Intergenic
1131367643 15:91853656-91853678 CGGAGGAGGAGGCCAGGGGAGGG + Intergenic
1131499909 15:92952321-92952343 CTGGGGAGGAGGGAGGGGGATGG + Intronic
1131584944 15:93683138-93683160 AAGAGGAGGAGGAGAGGGAAAGG - Intergenic
1131615863 15:94016823-94016845 CCGAGGTGGAGGAGGGTGGAAGG + Intergenic
1131828627 15:96340706-96340728 AGGAGGAGGGGGAGCGGGGTTGG - Intergenic
1131846584 15:96495352-96495374 CAGAGAAGGAGGAGGGTGGAAGG + Intergenic
1131896196 15:97032639-97032661 CTGAGGAGGAAGAGGAGGAAGGG - Intergenic
1132053774 15:98633957-98633979 AGGAGGAGGAGGAGGAGGGAGGG - Intergenic
1132127154 15:99237873-99237895 TTGAAGAGGAGGAATGGGGAGGG - Intronic
1132163776 15:99565832-99565854 CTGATGGGGAGAAGCGAGGAAGG + Exonic
1132320066 15:100919292-100919314 CTGAGGCGGGCGGGCGGGGAGGG - Exonic
1132692325 16:1187185-1187207 CTGAGAATGAGGGGCCGGGAGGG + Intronic
1132829003 16:1918484-1918506 CGGGGGAGGGGGAGGGGGGAGGG - Intergenic
1132871256 16:2116732-2116754 CTGAGGAGGAGGGGCTGGTGGGG - Intronic
1132891239 16:2205794-2205816 CTGCGGAGGTGGGGGGGGGACGG + Intronic
1132915571 16:2341603-2341625 CTGAGGAGGTGGTCCGGAGAGGG + Intergenic
1132989995 16:2787452-2787474 GTGAGGACGAGGAGGGGTGAAGG - Intronic
1133059434 16:3164809-3164831 CCGAGGAGGTGGTGCAGGGATGG - Intergenic
1133520249 16:6549432-6549454 GGGAGGAGGAGGAGGGAGGAGGG + Intronic
1133953977 16:10423748-10423770 CTGATGAGGAGGAGGAAGGAGGG - Intronic
1133984346 16:10656846-10656868 CTCAGGAGGTGGAGGTGGGAGGG - Intronic
1134036636 16:11036266-11036288 ATGAGGTGGAGGATGGGGGAAGG - Intronic
1134076077 16:11292460-11292482 CTGAGGAGGAGCAGCTAGGAAGG + Intronic
1134086156 16:11358780-11358802 CTGAGGAGGAGAAGAAAGGAAGG + Intergenic
1134122722 16:11596483-11596505 GGGAGGAGGGGGAGGGGGGAAGG + Intronic
1134187858 16:12098614-12098636 CAAAAGAGGAGGAGAGGGGAGGG - Intronic
1134202866 16:12213325-12213347 CTGAGCAGGAGGGGAGGCGAGGG + Intronic
1134449397 16:14354219-14354241 GGGAGGAGGAGGAAGGGGGAGGG + Intergenic
1134449558 16:14354598-14354620 AGGAGGAGGCGGAGCGGAGAGGG + Intergenic
1134521270 16:14920162-14920184 CTGAGGAGGAGGGGCTGGTGGGG + Intronic
1134523322 16:14928123-14928145 GAGAGGAGGAGGAGGGGAGAGGG - Intronic
1134649584 16:15898154-15898176 TTGAGGAGGAGGAGGAGGGCTGG - Intergenic
1134708945 16:16318813-16318835 CTGAGGAGGAGGGGCTGGTGGGG + Intergenic
1134716155 16:16358847-16358869 CTGAGGAGGAGGGGCTGGTGGGG + Intergenic
1134795813 16:17035776-17035798 GAGAGGAGGAGGGGAGGGGAGGG + Intergenic
1134799546 16:17071630-17071652 CGGGAGGGGAGGAGCGGGGAGGG - Intergenic
1134950660 16:18349832-18349854 CTGAGGAGGAGGGGCTGGTGGGG - Intergenic
1134958598 16:18393312-18393334 CTGAGGAGGAGGGGCTGGTGGGG - Intergenic
1134993641 16:18722478-18722500 AAGAGGAGGAGGAGAGGAGATGG + Intergenic
1134993654 16:18722497-18722519 ATGGGGAGGGGGAGGGGGGAGGG + Intergenic
1135066529 16:19314869-19314891 AGAAGGAGGAGGAGAGGGGAAGG + Intronic
1135175111 16:20221090-20221112 TGGAGGAGGAGGAGAGAGGAGGG + Intergenic
1135674650 16:24405100-24405122 CTCAGAAGGGAGAGCGGGGATGG - Intergenic
1135929097 16:26721625-26721647 ATGAGGAGGAGGGTCGGGGGAGG - Intergenic
1136040618 16:27575966-27575988 CTGAGGTAGAGGAGCAGGGATGG + Intronic
1136112208 16:28070779-28070801 CTGAGGAGGGAGAACGAGGAAGG + Intergenic
1136128320 16:28201482-28201504 GGAAGGAGGAGGAGTGGGGAAGG + Intronic
1136366553 16:29811814-29811836 CTGCAGAGGAGGAGCAGGGTGGG - Intronic
1136367874 16:29817122-29817144 CGGGGGAGGAGGAACGGGCAGGG + Intronic
1136390612 16:29962028-29962050 GCGAGGAGGAGGGTCGGGGACGG + Intronic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136539906 16:30923525-30923547 AGGAGGAGGAGGAGGAGGGAAGG + Intronic
1136922380 16:34343824-34343846 CTGAGGAGCAGCAGATGGGAAGG - Intergenic
1136982193 16:35067982-35068004 CTGAGGAGCAGCAGATGGGAAGG + Intergenic
1136997008 16:35197633-35197655 CTGAGCAGGAGCACTGGGGATGG + Intergenic
1137569656 16:49557330-49557352 CCGGGGAGGAGGAGCGGGCAGGG - Intronic
1137617530 16:49856334-49856356 CTGAGGAGGGGGAACGGGGCTGG + Intronic
1137639699 16:50017817-50017839 CTGGGGAGGTGGTGGGGGGATGG - Intergenic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1137942491 16:52702603-52702625 CAGGGGAGGAGGAGGGTGGATGG - Intergenic
1138439789 16:57027027-57027049 GAGTGGAGGAGGACCGGGGAGGG + Intronic
1138577959 16:57920566-57920588 CTGAGCAGGCTGAGCCGGGAGGG + Intronic
1138673812 16:58636496-58636518 CAGAGGAAGAGTGGCGGGGAGGG + Intergenic
1138889847 16:61128843-61128865 CGGTGGGGGAGGGGCGGGGAAGG + Intergenic
1139010794 16:62631458-62631480 GTGAGGTGGAGGAGGGGGAAGGG - Intergenic
1139363622 16:66419288-66419310 GGGAGGAGGAGGGGAGGGGAGGG + Intergenic
1139374365 16:66487571-66487593 GTGAGGAGGAGGAGCTGGATGGG - Intronic
1139492065 16:67291525-67291547 GTGAGGAGGGGGAGAGGGGTAGG + Intronic
1139511978 16:67432718-67432740 CTGAGGCAGAGTAGGGGGGAAGG + Intronic
1139582552 16:67881978-67882000 CTGAGGGGCAGCAGCGGGGAGGG + Exonic
1139645525 16:68326836-68326858 CTGAGGAGAAGGAGGTGTGAAGG + Intronic
1139845066 16:69914999-69915021 CCCAGGAGGAGGAGAAGGGAAGG + Intronic
1140037432 16:71382045-71382067 AGGAGGAGGAGGAGAGGGGGAGG + Intronic
1140552679 16:75884311-75884333 CTGAGGTGGAGGAGCGAACAGGG + Intergenic
1140903635 16:79392439-79392461 GAGAGGAGGAGGAGAAGGGAAGG + Intergenic
1141053914 16:80798412-80798434 CTGAGGAGGAGGAGGAGGAAGGG - Intronic
1141107580 16:81246191-81246213 CAGAGGAGGAGGTGTGAGGATGG - Intronic
1141579672 16:84988599-84988621 CGCAGGAGCAGGAGCGGGGTGGG + Intronic
1141638467 16:85328212-85328234 CTGTGGAGGAGGAGCGGAAAGGG - Intergenic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141675238 16:85514184-85514206 AAGAGGAGGAAGAGAGGGGAGGG - Intergenic
1141775759 16:86121749-86121771 AGGAGGAGGAGGAGGGAGGAAGG - Intergenic
1141997000 16:87641976-87641998 CTGTGGAGGAGGGGTGGGGCTGG + Intronic
1142006005 16:87689877-87689899 CGGTGGACGAGGAGCGGGGCGGG + Exonic
1142125965 16:88410895-88410917 TGGAGGAGGAGGAGGTGGGAGGG - Intergenic
1142209951 16:88804137-88804159 CTGAGGCGGAGGGACGGGGGCGG + Intronic
1142234538 16:88915520-88915542 GTGTGGAGGGGGAGCGTGGAGGG + Intronic
1142234577 16:88915630-88915652 GTGTGGAGGAGGAGCGTGGAGGG + Intronic
1142237145 16:88927703-88927725 CTGGGGAGGAGGAGGCGGAAGGG - Intronic
1142269166 16:89080162-89080184 CTGAGGAGGAGGAGTGTGGTGGG + Intergenic
1142269368 16:89081205-89081227 CTGTGGAGGAGCAGGTGGGAGGG + Intergenic
1142290774 16:89192817-89192839 GGGAGGAGGAGGAGCTGGGGAGG - Intronic
1142290792 16:89192873-89192895 CGGAGGAGGAGGAGCTGGGGAGG - Intronic
1142352650 16:89587147-89587169 CTGAGGGGGCGGGGCGGGGCGGG - Intronic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142752702 17:1998201-1998223 CTTTGGGGGAGGGGCGGGGAGGG + Intronic
1143134547 17:4704174-4704196 CTGGGGAGGGGGCGTGGGGAGGG + Exonic
1143274475 17:5699933-5699955 CTGGAGAGGAGGAGAGGGAAGGG - Intergenic
1143391422 17:6561262-6561284 AAGAGGAGGAGGAGGGGAGAAGG - Intergenic
1143495872 17:7312308-7312330 GGGAAGAGGAGGAGAGGGGAGGG + Exonic
1143583209 17:7838328-7838350 AGGAGGAGGAGGAGGAGGGAGGG + Intergenic
1143735607 17:8910117-8910139 CTGGGGCAGAGGAGCAGGGAGGG + Intronic
1143754964 17:9060181-9060203 CTGAGGAGGAGAGGAGGGGTGGG - Intronic
1144026292 17:11278875-11278897 CTGAGGAGGCGGGGCAGGGCAGG + Intronic
1144077481 17:11732467-11732489 GTGGAGAGGAGGAGAGGGGAGGG - Intronic
1144097733 17:11917070-11917092 GTGAGGAGGAGAAGCGGGGATGG + Intronic
1144764108 17:17723689-17723711 GGGAGGAGGAGGAGGGGGCAGGG - Intronic
1145254944 17:21317276-21317298 CTGAGGTGGGGGAATGGGGATGG + Intergenic
1145321658 17:21770689-21770711 CTGAGGTGGGGGAATGGGGATGG - Intergenic
1145857607 17:28177128-28177150 CTGAGGAGGAAGAGAAAGGAGGG + Intronic
1146034127 17:29390919-29390941 GTGAGGAGGAGGAGGGGGCCCGG - Exonic
1146426478 17:32744337-32744359 CAGATGAGGAGGGGCTGGGAAGG - Intronic
1146652105 17:34613384-34613406 CTAAGCAGGAGCAGCGGGGGAGG - Intronic
1146683969 17:34827967-34827989 CTGAGCAGGTGGAGGGGTGATGG + Intergenic
1146744398 17:35314674-35314696 CTGGTGAGGAGCAGTGGGGATGG + Intergenic
1146762558 17:35491131-35491153 CTCAGGAGGAGCAGCAGGGGAGG - Intronic
1147137912 17:38444682-38444704 CTGAGGAGGTGCAGTGGAGAAGG + Intronic
1147314618 17:39613702-39613724 CTGAGGAGGTGGACTTGGGATGG + Intergenic
1147403697 17:40195697-40195719 CTGAGGGAGGGGAGAGGGGATGG + Intergenic
1147476313 17:40715030-40715052 CTAAGGGGTAGGAGCCGGGATGG - Intergenic
1147710918 17:42463992-42464014 CTGAGGAGGAGGAAGGGGAGGGG + Intronic
1147936632 17:44014990-44015012 CAGAGAAGCAGGCGCGGGGATGG + Exonic
1147967489 17:44200709-44200731 ATTAGGACGAGGGGCGGGGAGGG - Intergenic
1147971200 17:44219793-44219815 GGGAGGAGGAGGAGCGGGAGGGG + Intronic
1148090536 17:45020326-45020348 CTGAGGCAGAGGAGCTAGGAAGG + Intergenic
1148127226 17:45243082-45243104 GTGAGGAGGCGGAGCTGGGTGGG - Intronic
1148289475 17:46431591-46431613 CTGTGGAGGAGGAGAGTGCAGGG + Intergenic
1148311644 17:46649163-46649185 CTGTGGAGGAGGAGAGTGCAGGG + Intronic
1148389736 17:47262772-47262794 CTGAGGTGGAGGCGAGGGGATGG + Intronic
1148562442 17:48613675-48613697 CGGCGGAGGAGGAGGGGCGAGGG + Intronic
1148621766 17:49039874-49039896 CTGAGGAGGGGTAGTGGGGTGGG + Intronic
1148855776 17:50578632-50578654 CTCAGGAGGAGGGGTGCGGAGGG - Intronic
1149270102 17:54968377-54968399 CGCAGGAGGAGGAGCGGCGGCGG - Exonic
1149315189 17:55431972-55431994 GAGTGGAGGGGGAGCGGGGAGGG + Intergenic
1149325723 17:55527984-55528006 CAGAGGAGGAAGAACGGGAAAGG - Intergenic
1149642512 17:58212997-58213019 CGGAGGAGGAGGAGCGGGAACGG - Exonic
1150001020 17:61440063-61440085 CTGAGGAGGAGCAGTGGGACTGG + Intergenic
1150229667 17:63543259-63543281 CTGAGGAGGGGGAGAGGGGATGG - Intronic
1150255587 17:63741770-63741792 CTGAGGAGGCGGAGCCAAGACGG - Exonic
1150964178 17:69948493-69948515 AGAAGGAGGAGGAGAGGGGAGGG + Intergenic
1151158792 17:72147193-72147215 AGGAGGAGGAGGAGGAGGGAAGG + Intergenic
1151264624 17:72945239-72945261 CTGAGGAGCAGCAGCAGTGACGG - Intronic
1151267477 17:72967969-72967991 CTGGGGTGGAGGAGAGGGGGTGG - Intronic
1151347565 17:73511535-73511557 CTGGGGAGGAGGAGAGGGAAGGG + Intronic
1151361708 17:73593096-73593118 GTGGGGAGGAGGAGGAGGGACGG - Intronic
1151495793 17:74457427-74457449 CTGAGAAGGAGGCACGGGGCTGG + Intergenic
1151520977 17:74629318-74629340 GTGGGGAGGGGGAGGGGGGAGGG + Intergenic
1151670503 17:75569339-75569361 CTGGGGAGGGGGAGCTGGGGAGG + Intronic
1151720934 17:75855637-75855659 CTGAAGAGGCGGGGTGGGGATGG - Intronic
1151750516 17:76034650-76034672 CTTGGGAGGAGGACCTGGGAGGG - Intergenic
1151761076 17:76103589-76103611 CTGGGGAGGAGGTGAGGGAAAGG - Intronic
1151763330 17:76119756-76119778 AGGAGGAGGAGGGGCGAGGAAGG + Intronic
1151829438 17:76540918-76540940 CAGAGGAGGAGGAGGGGGAAGGG - Intronic
1151833381 17:76568895-76568917 CTGAGCGGTAGGAGCGGGGCTGG + Intronic
1151852497 17:76699251-76699273 CTTAGGAGGCTGAGGGGGGAGGG - Intronic
1151860837 17:76760374-76760396 TTGAGAAGGAGGAGGAGGGAGGG + Intronic
1151961356 17:77407658-77407680 CTGGGGCGGAGGAGCAGGCAGGG - Intronic
1152024552 17:77800282-77800304 CTGCGGAGGTGGGGCGGGGCGGG + Intergenic
1152035484 17:77869695-77869717 CTGAGGTGGAGGAGAGGTTAAGG - Intergenic
1152039541 17:77894117-77894139 CTGACGAGGAGGAGGAGAGAGGG - Intergenic
1152075827 17:78158989-78159011 GGGAAGAGGAGGAGAGGGGAGGG + Intronic
1152103452 17:78315838-78315860 AGGAGGAGGAGGAGCAGGGCAGG - Intergenic
1152124553 17:78438432-78438454 AGGAGGAGGAGGAGGGAGGAGGG + Intronic
1152263376 17:79279117-79279139 AGGAGGAGGAGGAGAGGAGAGGG + Intronic
1152438438 17:80289982-80290004 CTTAGGAGGTGGAGGGGGGTGGG + Intronic
1152533318 17:80934464-80934486 CTGGGGAGGAAGAGGTGGGAGGG - Intronic
1152701444 17:81821851-81821873 CCGGGGAGGAGGAGCAGGGGAGG - Intergenic
1152714033 17:81889782-81889804 TTGAGTAGGAGGAGAGGGAAAGG - Intronic
1152750740 17:82061355-82061377 TGTGGGAGGAGGAGCGGGGAAGG + Intronic
1152913076 17:83016603-83016625 CTGAAGAGGAGGGGGGAGGAGGG + Intronic
1152945442 17:83195262-83195284 CTTAGGGGCTGGAGCGGGGAGGG + Intergenic
1153164535 18:2247164-2247186 CTGAGGGGGAGGAGCCAAGATGG + Intergenic
1153219971 18:2853019-2853041 CTGAGGAAGAGGAGAAGGAAAGG + Intronic
1153265172 18:3262372-3262394 CTGAGAAGGGGGCGCGGGGCCGG + Intronic
1153658128 18:7303492-7303514 CTGGGGAGGAGAAGAGAGGATGG - Intergenic
1153874590 18:9357820-9357842 ATAAGGAGGAGGAGCAGGGAAGG + Intronic
1154025732 18:10705656-10705678 CTGAGCAGGAGGAGGAGGCAGGG - Exonic
1154041430 18:10859858-10859880 CTGTGCTGGAGGAGAGGGGAGGG + Intronic
1154141204 18:11826239-11826261 AGGAGGAGGAGGAGCGGGGAGGG + Intronic
1154141216 18:11826271-11826293 AGGAGGAGGAGGAGCGGGGAGGG + Intronic
1154141238 18:11826335-11826357 AGGAGGAGGAGGAGCGGGGAGGG + Intronic
1154281209 18:13004929-13004951 TTAAGGAGGAGGAGAGGGTATGG + Intronic
1154303028 18:13211359-13211381 TGGGGGAGGAGGAGTGGGGAGGG + Intergenic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1154496357 18:14963976-14963998 CAGAGGAGGAGGAGCAGCAAAGG - Intergenic
1155066209 18:22271214-22271236 AGGAGGAGGAGGAGTGGGGGAGG + Intergenic
1155066535 18:22273761-22273783 TGGAGGAGGAGGAGGGAGGAGGG - Intergenic
1155121315 18:22822647-22822669 CTGAAGAGGAGGAGCAGGTTGGG - Intronic
1155154812 18:23149387-23149409 CTGAGGAGGCTGAGGTGGGAAGG - Intronic
1155350032 18:24897335-24897357 AGGAGGAGGAGAAGGGGGGAAGG - Intergenic
1155491744 18:26406894-26406916 CTGAGGAAGGGGAGCAGGAAGGG + Intergenic
1155933524 18:31730935-31730957 ATGAGGAGGAGGAGAGAGTAGGG - Intergenic
1156111418 18:33731843-33731865 GTGAGGAGGAGGAAGGGGGAAGG - Intronic
1156190239 18:34710577-34710599 CGGAGGTGGAGGAGCTAGGAGGG - Intronic
1156227904 18:35127342-35127364 CTGAGGAGCAGGGGAGGGGAAGG - Intronic
1156257432 18:35411119-35411141 ATGAGGAGGAGGAGATGGAAGGG + Intergenic
1156401550 18:36744614-36744636 GTGGGGAGCAGGAGCCGGGAGGG - Intronic
1156468383 18:37362273-37362295 AGGAGGAGGAGGAGCGGGGCTGG - Intronic
1156472206 18:37384384-37384406 CTGGGGATGAGGACAGGGGAGGG + Intronic
1156783461 18:40880732-40880754 CAGAGAAGGAGGTGGGGGGAGGG - Intergenic
1157098279 18:44707100-44707122 CAAAGGAGGAGGAGCTGGAAGGG + Intronic
1157108932 18:44801131-44801153 TGGGGTAGGAGGAGCGGGGAGGG + Intronic
1157166051 18:45359370-45359392 CAGAGGAGGAGGAGGGGTGCTGG - Intronic
1157307564 18:46528309-46528331 CTGAGGAGCAAGGGCGGGGAGGG + Intronic
1157322663 18:46646485-46646507 GTGAGCAGGACGAGTGGGGAAGG - Intronic
1157445519 18:47743759-47743781 CTGAGGAGGAGGAAGAGGAAGGG - Intergenic
1157481912 18:48060565-48060587 CTGAGGAGGCGGAATGGGCAAGG - Intronic
1157549558 18:48572065-48572087 AGGAGGAGGAGGAACGGTGAGGG - Intronic
1157604642 18:48918259-48918281 CGGCGGAGGAGGGGCAGGGAGGG - Intergenic
1157608539 18:48941394-48941416 CTGAAGAGGAGAGCCGGGGAGGG + Intronic
1157713549 18:49866504-49866526 CAGCAGATGAGGAGCGGGGATGG - Intronic
1157723511 18:49944850-49944872 CTGAGGAGGAGCGGCGTGGAAGG - Intronic
1157898675 18:51492589-51492611 CTGAGGCGTAGCAGCGTGGAAGG - Intergenic
1157914857 18:51654946-51654968 ATGGGGAGGCGGAGTGGGGAAGG - Intergenic
1158070957 18:53470017-53470039 CTGAGGAGGAGCAGCCAGAAGGG - Intronic
1158452758 18:57581521-57581543 CTTAGGAGGAGGAGGGCAGAAGG - Intronic
1159050543 18:63417484-63417506 CTGAGAAGGAGGAGCCAGAATGG - Intronic
1159079792 18:63724253-63724275 CAGAGGAGGAGGAGGAGGAAGGG - Intronic
1159180603 18:64897790-64897812 CCGAGGAGGGGGAGAGAGGAAGG + Intergenic
1159947901 18:74457402-74457424 CTGGGGCGGAGGTGCGGGGAGGG + Intronic
1160074120 18:75655590-75655612 CTCTGGAGGAGGAGCGGGAGGGG + Intergenic
1160236028 18:77087652-77087674 CGCAGGAGGAGGGGAGGGGAGGG + Intronic
1160255966 18:77249558-77249580 CTGGGGAGGAGGAGGAGGAAAGG + Intergenic
1160337732 18:78057532-78057554 AGGAGGAGGAGGAGGAGGGAAGG + Intergenic
1160394018 18:78559015-78559037 CTGGGGAGGAGGGGGTGGGAGGG - Intergenic
1160582870 18:79897624-79897646 ATGTGGAGGAGGAGGAGGGAAGG - Intronic
1160632966 18:80258957-80258979 CTCAGCAGGAGGAATGGGGAAGG + Intergenic
1160705130 19:525957-525979 GGGAGGAGGAGGGGAGGGGAAGG + Intergenic
1160741073 19:686095-686117 CTGAGGAGGCTCAGCGGGGAGGG - Intronic
1160819712 19:1052345-1052367 TTGAGGAGGAGGAGGGGGAGGGG + Intronic
1160853497 19:1205914-1205936 TGGAGGAGGCGGAGCGGCGAGGG - Intronic
1160932638 19:1577938-1577960 CTGTAGAGGACGAGCGTGGAGGG + Exonic
1160969086 19:1759485-1759507 AGGAGGAGGAGGAGAGGGAAGGG + Intronic
1160970709 19:1766595-1766617 GTGAGGAGGAGGAGAGGGGATGG + Intronic
1160975355 19:1790127-1790149 GGGAGGAGGAGGAAAGGGGAGGG - Intronic
1161030742 19:2056736-2056758 GGGGGGAGGAGGAGAGGGGAGGG - Intergenic
1161103972 19:2434240-2434262 GTGAGGAGGAGGGGCAGGGCAGG - Intronic
1161207139 19:3047106-3047128 GAGAGGAGGGGGAGAGGGGAAGG - Intronic
1161207168 19:3047173-3047195 ATGAGGCGGAGGACGGGGGAGGG - Intronic
1161226154 19:3146905-3146927 GTGAGGAGGGGGAGAGAGGAAGG - Intronic
1161243567 19:3236297-3236319 CTGAGTAGGTGGAGAAGGGAGGG + Intronic
1161350077 19:3786416-3786438 CCGCGGAGGCGGGGCGGGGAGGG - Intronic
1161415625 19:4145139-4145161 AGGAGGAGGAGGAGGAGGGAGGG + Intergenic
1161505776 19:4642723-4642745 GTGAGGAGGAGGAGAGAGGGAGG + Intronic
1161528231 19:4770615-4770637 GTGAGAAGGAGGAGCTGGGCAGG + Intergenic
1161576716 19:5058454-5058476 CTCAGGAGCAGGGGCGGGAAGGG + Intronic
1161607357 19:5222450-5222472 AGGAGGAGGAAGAGGGGGGAGGG + Intronic
1161624116 19:5316023-5316045 CTGAGGAGGCTGAGGTGGGAGGG - Intronic
1161649873 19:5477923-5477945 GTGAGGAGGAGGAGAGGGCAGGG - Intergenic
1161756429 19:6137460-6137482 GTGAGGAGGGGGAGGGAGGAAGG + Intronic
1161767766 19:6216514-6216536 CTGGGGAGGCGGGGCAGGGAGGG + Intronic
1161918716 19:7250258-7250280 ATGGGAAGGAGGAGAGGGGAAGG + Intronic
1162054172 19:8052949-8052971 CTGAGGAAGAGGAGGGGAGTGGG - Intronic
1162145537 19:8610740-8610762 CAGGGGAGGGGGCGCGGGGAAGG + Intergenic
1162315910 19:9937706-9937728 CAGAGGTGGAGGAGGGGGGCGGG + Intergenic
1162378189 19:10317171-10317193 CGGAGGAGGAGATGGGGGGAGGG + Exonic
1162520326 19:11175821-11175843 CTGAGGATGAGGAGAGGCCACGG + Intronic
1162784184 19:13023921-13023943 GGGAGGAGGAGGAGCAGGGGAGG - Intronic
1162790066 19:13058123-13058145 CAGAGAAGCAGGAGCTGGGAGGG - Intronic
1162982490 19:14248614-14248636 CTGGGGAGGGGGAGAGGGGATGG - Intergenic
1163029850 19:14537086-14537108 CTGAGGAGGAGGAGGGGGCAGGG + Intronic
1163061228 19:14763749-14763771 AGGAGGAGGAGGAGAGGAGAAGG - Intronic
1163153031 19:15425836-15425858 GGGAGGAGGAGGAGGGAGGAGGG + Intronic
1163286604 19:16352342-16352364 CCGAGGAGGAGGAGGAGGAAGGG - Intergenic
1163465950 19:17468830-17468852 CAGAGGAGGGGGAGCTGGAAGGG + Intronic
1163600907 19:18248422-18248444 TGGAGGGGGAGGGGCGGGGAGGG + Intronic
1163687142 19:18718148-18718170 CTGGGGAGGAGAGGAGGGGAGGG - Intronic
1163779753 19:19240065-19240087 ATGAGGAGCAGGAGGGAGGAGGG - Intronic
1164188312 19:22892760-22892782 AAGAGGAGGAGGAGGGGGGAGGG - Intergenic
1164249665 19:23465922-23465944 CAGAGGAGGAGGAGAGGGGAAGG - Intergenic
1164249929 19:23467531-23467553 AGAAGGAGGAGGAGTGGGGAAGG - Intergenic
1164250084 19:23468437-23468459 AGGAGGAGGAGGAGAGGAGACGG - Intergenic
1164292152 19:23878610-23878632 GAGAGGAGGAGGAGAGGAGAAGG + Intergenic
1164324719 19:24181196-24181218 AGGAGGAGGAGGAGAGGAGAAGG + Intergenic
1164579969 19:29428978-29429000 CAGAGCAGTAGGAGAGGGGAAGG + Intergenic
1164672941 19:30083191-30083213 ATAAGGAGGAGGAGAGGGCAGGG - Intergenic
1164690514 19:30207548-30207570 CAGAGGAGGTGGAGCGGAAAGGG + Intergenic
1164879063 19:31715482-31715504 CTGGGGAGGGGGCGCCGGGAAGG - Intergenic
1165157100 19:33795639-33795661 CCGAGGAGGAGGAGGAGGCACGG + Intergenic
1165205619 19:34182916-34182938 AAGAGGAGGGGGAGAGGGGAGGG - Intronic
1165427300 19:35753240-35753262 CTGAGGATGAGGAGGTGGGATGG + Exonic
1165829440 19:38723265-38723287 CTGAGGAGGGGTAGGGGGCAGGG - Intronic
1165829582 19:38723863-38723885 GTGAGCAGGAGGGGTGGGGAGGG - Intronic
1165849864 19:38843555-38843577 CTGAGGATGAGGCGTGGGGGCGG - Intronic
1166146853 19:40843978-40844000 CTGAGGAGGAGAGGCGGGAGGGG + Intronic
1166151014 19:40875875-40875897 CTGAGGAGGAGAGGCGGGAGGGG + Intronic
1166155509 19:40908654-40908676 CTGAGGAGGAGAGGCGGGAGGGG + Intergenic
1166203216 19:41252307-41252329 GTGAGGAGGAGGGGAGGAGAGGG - Intronic
1166239315 19:41478970-41478992 CTGAGGATGAGGAGCTGGACTGG - Intergenic
1166241969 19:41500473-41500495 CTGAGGATGAGGAGCCGGACTGG - Intergenic
1166266832 19:41689662-41689684 CTGAGGAGGAGGAAAGGAGAGGG - Intronic
1166340096 19:42132295-42132317 CTGAGGAGGAGGGGCAGGCAGGG + Intronic
1166402955 19:42497237-42497259 CAGAGGAGAAGGAGCAGGAATGG - Intergenic
1166700218 19:44878040-44878062 AGGAGGAGGAGGAGGGGGGTGGG - Intronic
1166743691 19:45129789-45129811 GGGAAAAGGAGGAGCGGGGAGGG + Intronic
1166788784 19:45385417-45385439 CCGAGGAGGAGGATGAGGGATGG - Intronic
1166829455 19:45630047-45630069 CTAAAGAGGAGGAGAGAGGAGGG + Intronic
1166840695 19:45695378-45695400 CTGGGGAGGAGGTGGGGAGAAGG - Intronic
1166993992 19:46710667-46710689 CCTAGGAGGTGGAGCTGGGAGGG - Intronic
1167130524 19:47582282-47582304 AAGAGGAGGAGGAGGGGGAAAGG - Intergenic
1167189959 19:47979162-47979184 AGGAGGAGGAGGAGGGAGGAAGG - Intronic
1167191199 19:47991441-47991463 AGGAGGAGGAGGAGAGGAGAAGG - Intronic
1167253871 19:48415681-48415703 CAGAGGAGGAGGGGCCAGGAGGG + Intronic
1167295507 19:48646717-48646739 GCGGGGAGGAGGAGCCGGGAGGG + Intergenic
1167446761 19:49542574-49542596 CTGGGGAGGAGGAGCCGGCGTGG + Exonic
1167476586 19:49704984-49705006 CTGGGGACCAGGAGAGGGGATGG - Intronic
1167511212 19:49896183-49896205 CTGGGGTGGAGGAGAAGGGAGGG + Intronic
1167594004 19:50418089-50418111 CTGAGGATGAGGGGCGGTGCGGG - Intronic
1167627755 19:50603936-50603958 AGGAAGAGAAGGAGCGGGGAAGG - Intergenic
1167649933 19:50723632-50723654 CCCAGGAGGAGGAGCGGGAGAGG + Exonic
1168063981 19:53909257-53909279 CTGCGGAGGAGGGGAGGGGCGGG - Intergenic
1168068841 19:53937592-53937614 CCGAGAAGGAGGGGAGGGGAGGG - Intronic
1168115139 19:54218143-54218165 CAGAGGATGAGGAGCAGGAAGGG + Intronic
1168120836 19:54251835-54251857 CAGAGGATGAGGAGCAGGAAGGG + Intronic
1168124414 19:54275732-54275754 CAGAGGATGAGGAGCAGGAAGGG + Intronic
1168177571 19:54635806-54635828 CAGAGGATGAGGAGCAGGAAGGG - Intronic
1168181853 19:54666946-54666968 CAGAGGATGAGGAGCAGGAAGGG - Intronic
1168187318 19:54708548-54708570 CTGGGAATGAGGAGCGGGGGAGG + Intergenic
1168411272 19:56141617-56141639 CTGAGGGAGAGGACGGGGGAGGG + Intronic
1168416764 19:56174323-56174345 AGGAGGAGGAGGAGTGGGCAGGG - Intergenic
1168530215 19:57121088-57121110 GTGAGGGAGCGGAGCGGGGATGG - Intronic
1202647012 1_KI270706v1_random:152494-152516 CTTCGGAGGAGGAGAGGGGCGGG - Intergenic
1202704558 1_KI270713v1_random:13524-13546 TGGAGGAGGAGCAGCAGGGAGGG - Intergenic
1202711959 1_KI270714v1_random:23814-23836 CTGAGGCTGAGGCGCGGGGTGGG - Intergenic
924985332 2:264674-264696 CGGAGGAGGAGGAGCTGCGGGGG - Intronic
925132647 2:1504419-1504441 CCCAGGAGGAGGAGAGGTGATGG - Intronic
925149188 2:1602904-1602926 CCCTGGGGGAGGAGCGGGGAAGG - Intergenic
925364208 2:3300384-3300406 CTGACGAGAAGGAGAGGGGGCGG - Intronic
925611226 2:5705318-5705340 CTGGGGAGGAGGAGCTGAGAAGG + Intergenic
925611333 2:5705654-5705676 CCGAGGTGGAGGAGCAGGGGAGG + Intergenic
925611384 2:5705801-5705823 CTGGGGAGGAGGAGCTGGGGAGG + Intergenic
925694261 2:6558245-6558267 CTGAGGAGGCTGAGGTGGGAGGG + Intergenic
926025327 2:9537926-9537948 GAGAGGGGGAGGAGAGGGGAAGG + Intronic
926115388 2:10209981-10210003 CTGGGCAGCAGGAGCAGGGATGG - Intronic
926198249 2:10776400-10776422 CTGAGGACGAGGAGCCGAGCTGG + Intronic
926215173 2:10901841-10901863 ATGAGGAGAAGGAGCGGGGGTGG + Intergenic
926230751 2:11002118-11002140 CTGGGGAGGAGGAGCCAAGATGG - Intergenic
926233905 2:11025102-11025124 CGGAGGAGGAGGTGCGGTGCGGG - Intergenic
926311163 2:11677280-11677302 CTGAGGAGCTGGAGTGGGGAGGG + Intergenic
926370273 2:12171888-12171910 TTGATGAGGAGGACCGGGAAGGG - Intergenic
927148254 2:20180745-20180767 CTGAGGAGGGGGAGTGGGAGTGG - Intergenic
927432840 2:23041595-23041617 CTAAGGACAAGGAGCAGGGATGG + Intergenic
927438455 2:23090593-23090615 GAGGGGAGGAGGAGAGGGGAGGG + Intergenic
927497372 2:23559903-23559925 CTGAGAAGGAGCAGCCGAGAGGG + Intronic
927561695 2:24077808-24077830 CTGAGGAGGATGAGGAGGGCAGG - Intronic
927603161 2:24462270-24462292 CTGAGGAGGAGGACTGAGGTTGG + Intergenic
927799312 2:26083395-26083417 CTGAGGGGGAAGGGAGGGGAGGG - Intronic
927863125 2:26572799-26572821 CCGAGGAGGAGAAGGAGGGAGGG + Intronic
928096260 2:28406912-28406934 CTGAGGAGGTGGGGAGGGGAGGG + Intronic
928359912 2:30654731-30654753 CTGAAGAGGAGGAGAGGGGAGGG - Intergenic
929043236 2:37767276-37767298 CTGGGGAAGAGGAGCAGAGAAGG - Intergenic
929279358 2:40061257-40061279 GTGAGGAGGAGGATTGAGGACGG - Intergenic
929474081 2:42227685-42227707 CAGAGGAGGAGGAAGGGGGCGGG - Intronic
929533850 2:42768298-42768320 CTCAGGAGGAGGAGGGGACAAGG + Intronic
929701572 2:44167901-44167923 CTGGGGAGGTGTTGCGGGGAGGG - Intergenic
929776981 2:44935931-44935953 CAGGGGAGGAGGCGAGGGGAGGG - Intergenic
929983923 2:46707102-46707124 TAGAGGAGGAGAAGTGGGGAAGG + Intronic
930023168 2:47013510-47013532 CTGAGGGGGTGTAGCGGGGGAGG + Intronic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930136310 2:47906402-47906424 CTGACGAGGAGGAGGAGGAAAGG - Intergenic
930198258 2:48530026-48530048 CAGGGGAGGAGGGGCGGGGGCGG + Intronic
930364631 2:50424127-50424149 CGGAGGAGGAGGAGGAGGGGGGG + Intronic
930364632 2:50424130-50424152 AGGAGGAGGAGGAGGGGGGGAGG + Intronic
930374747 2:50551088-50551110 AGGAGGAGGAGGAGGAGGGAGGG + Intronic
932331454 2:70900521-70900543 CTGAGGAGGAGGAGTCGAGCGGG + Intergenic
932369834 2:71177754-71177776 CTGGGGAGGAGGAGTCAGGAAGG + Intergenic
932429418 2:71665196-71665218 AAGAGGTGGAGGAGCTGGGAGGG - Exonic
932635630 2:73385821-73385843 AGGAGGAGGAGGAGGGGGGGAGG - Exonic
932635631 2:73385824-73385846 CAGAGGAGGAGGAGGAGGGGGGG - Exonic
932702949 2:74003295-74003317 CTGAGGGGGAGGGGCGGCGGGGG + Intronic
932902491 2:75715468-75715490 CTGAGGTGGAGGGTGGGGGATGG + Intergenic
932929073 2:76012428-76012450 TGGAGTAGGGGGAGCGGGGAGGG - Intergenic
933219987 2:79677292-79677314 GTGAGGAGGAGGGTTGGGGATGG + Intronic
933800352 2:85955469-85955491 AGGAGGAGGAGGAGCGGAGAAGG - Intergenic
934500586 2:94857633-94857655 CTTCCGAGGAGGAGCGGGGCGGG - Intergenic
934538636 2:95157426-95157448 CTGAGAAGGGGAAGCTGGGAAGG + Exonic
934650032 2:96085419-96085441 CTGAGGGGCAGGGGTGGGGATGG + Intergenic
934883489 2:98004684-98004706 GAGAGGAGGAGGAGGAGGGAGGG - Intergenic
934946908 2:98549035-98549057 CACAGGAGGAGGTGTGGGGATGG - Intronic
935054356 2:99552695-99552717 CAGAGGAGGAGGAGCAGGTAGGG + Intronic
935106761 2:100052034-100052056 CTGAGGAGGAGGACTGCAGAGGG + Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935592168 2:104853854-104853876 CGGCGGGGGAGGGGCGGGGAGGG + Intergenic
935712420 2:105910952-105910974 CTGAGAAGGCTGAGTGGGGAGGG + Intergenic
935725965 2:106024294-106024316 TTGGGGAGTAGAAGCGGGGAGGG + Intergenic
936245218 2:110820543-110820565 CTGAGGAGAGGGAGTGGGGGTGG + Intronic
936726817 2:115329577-115329599 TTGGGTAGGGGGAGCGGGGAGGG - Intronic
936751756 2:115650802-115650824 AGGAGGAGGAGGAGCGGAAAAGG + Intronic
936872967 2:117156031-117156053 TTGAGGAGGAGGAGCCAAGATGG + Intergenic
936964132 2:118110436-118110458 CTGAGGAGGAGGAGGAGGAGGGG + Intronic
937264167 2:120605704-120605726 CTGAGGAGGAGGTGGGGTGGCGG - Intergenic
937309802 2:120895048-120895070 CTGATGGGGAGGGGAGGGGAGGG + Intronic
937418924 2:121738703-121738725 CTGAGGTGGAGGCCCTGGGAGGG + Intronic
937642747 2:124231871-124231893 ATGAGGAGGAGGAGAAGGAAAGG + Intronic
937873964 2:126806297-126806319 CTGAGAAAGAGGAGCCAGGAGGG - Intergenic
937878822 2:126849934-126849956 AGGAGGAGGAGGAGCAGGAAGGG + Intergenic
938218194 2:129541051-129541073 GTGGGGGGGAGGAGGGGGGAGGG + Intergenic
939081568 2:137668893-137668915 CTGAGGAGGAGGAGGAAGAAAGG + Intronic
939219829 2:139287437-139287459 CTCAGGAGAAAGAGCGGGGGTGG + Intergenic
939333918 2:140800248-140800270 TAGGGGAGGAGGAGCGGGGAGGG + Intronic
939397913 2:141655100-141655122 CTGGGGAGGAGGAAGAGGGACGG + Intronic
939553749 2:143648582-143648604 GTGAGGAGGAGGTGTGGGGAGGG - Intronic
939984701 2:148817856-148817878 CTGAGGAGGAGGCCCAGGTATGG - Intergenic
940099382 2:150016555-150016577 AGCAGGAGGAGGAGTGGGGATGG + Intergenic
940764274 2:157772939-157772961 CTGAGTAGTAGAAACGGGGAAGG - Intronic
940954445 2:159712464-159712486 GGGGGGAGGAGGAGCAGGGAGGG + Intronic
941384992 2:164841546-164841568 AAAAGGAGGAGGAGCGGGGCCGG + Intronic
941629249 2:167865968-167865990 ATGGGGAGGAGGATGGGGGAGGG - Intergenic
942306395 2:174611503-174611525 ATCAGGAGGAGGAGGAGGGAGGG + Intronic
942454895 2:176130686-176130708 ATGCGGAGGAGGAGGGGGGGCGG - Exonic
942507356 2:176657069-176657091 GGGAGGAGGAGGAGGGAGGAAGG + Intergenic
943682876 2:190786384-190786406 GTGGGGAGGAGGGGCGGGGGGGG - Intergenic
944145368 2:196502624-196502646 CTGAGGAGTAGTAGAAGGGAGGG - Intronic
944271231 2:197786447-197786469 CTCAAGTGGAGGAGAGGGGAAGG - Exonic
944412401 2:199457570-199457592 GGGAGGAGGAGGAGAGGGAAAGG + Exonic
944606811 2:201359086-201359108 CTGAGGAGCAGCAGTGGGGATGG + Intergenic
944710847 2:202333788-202333810 TGGAAGAGGAGGGGCGGGGAGGG + Intergenic
945251696 2:207769952-207769974 CTGAGGGGGCGGAGCCGGGGCGG - Intergenic
946137530 2:217659904-217659926 CTGAGGGGGAGGAGGTGGAATGG + Intronic
946139594 2:217678216-217678238 GTGGGGTGGGGGAGCGGGGAGGG + Intronic
946175271 2:217918746-217918768 CCGAGGAGGGCGGGCGGGGAGGG - Intronic
946189978 2:218003028-218003050 GGGAGGAGGAGGAGGAGGGAGGG - Intergenic
946409592 2:219509504-219509526 CTGGGGAAGGGGAGCGGGGGTGG - Intergenic
946855267 2:223944755-223944777 CTGAGCAGGAGGGGCGAGGTGGG + Intronic
947119370 2:226799654-226799676 AGGAGGAGGAGGAGGGAGGAGGG - Exonic
947795261 2:232890365-232890387 CTGGGAAGGAGCAGCGGTGAGGG - Intronic
947830239 2:233134398-233134420 TGGAGAAGGAGGAGCTGGGAGGG + Intronic
947849686 2:233275635-233275657 CTTTGGAGGAGGAGTTGGGATGG + Intronic
948048073 2:234958621-234958643 CAGTGGAGGAGCAGCTGGGATGG + Intronic
948091837 2:235301905-235301927 GAGAGGAGGAGGAGAGAGGAGGG - Intergenic
948223203 2:236289658-236289680 GTGAGAAGGAGGAGGGTGGAGGG + Intergenic
948558552 2:238835224-238835246 AAGAGGAGGAGGAGGAGGGAGGG - Intergenic
948690113 2:239696744-239696766 CTGGGGAGGCAGAGCGGGGTTGG - Intergenic
948800202 2:240430022-240430044 CTGGGGAGGGGGATGGGGGAAGG - Intergenic
948924084 2:241082681-241082703 CTGAGGAAGAGAAGAGAGGAAGG - Intronic
948963657 2:241359339-241359361 ATCAGGAGGATGGGCGGGGAAGG - Intronic
1169013502 20:2271956-2271978 CTGGGGCGCAGGAGAGGGGAGGG + Intergenic
1169164198 20:3407974-3407996 CAGAGGCGGAGGGGCGGGGCCGG - Intergenic
1170756782 20:19212436-19212458 CAGAGGAGGAGGAGCGGGGAAGG - Intergenic
1170756850 20:19212604-19212626 GCGAGGAGGAGGAGGAGGGAGGG + Intergenic
1170779631 20:19412618-19412640 AGGAGGAGGAGGAGGGGGGGAGG + Intronic
1170951782 20:20943249-20943271 CTGAGGAGGAAAGGCGGGAAAGG - Intergenic
1171093229 20:22306000-22306022 CTGAGGGGCTGGAGCGGGAAAGG + Intergenic
1171123439 20:22583834-22583856 CTGAGGAGGAGAAGATGGGTAGG - Intronic
1171399071 20:24860005-24860027 GTGAGGAAGAGGAACGGGGATGG - Intergenic
1171429156 20:25069611-25069633 CTGAGGAGTGGGAGAGGGGATGG + Intergenic
1171456651 20:25276266-25276288 CTGAGGAGGGGAGGCGCGGAGGG + Intronic
1171486389 20:25489456-25489478 GTAAGGAGAAGGAGGGGGGATGG - Intronic
1171891809 20:30724335-30724357 CTTCCGAGGAGGAGCGGGGTGGG - Intergenic
1171958285 20:31475862-31475884 CTGAGGAGGAAGAGGCAGGAGGG - Intronic
1172038260 20:32025692-32025714 TTGAGGATCAGGAGAGGGGAGGG + Intronic
1172043019 20:32059342-32059364 AGGAGGAGGAGAAGGGGGGAAGG - Intronic
1172114044 20:32563221-32563243 GTGAGGAGGGAGAGTGGGGAGGG + Intronic
1172411381 20:34726057-34726079 CTGAGGAGGAGCAGCTGGAGAGG + Intronic
1172560567 20:35884352-35884374 AGGAGGAGGAGGAGCTGGGAGGG + Intronic
1172589255 20:36105930-36105952 CTGGGGAGGAGGGGAGGAGAGGG - Intronic
1172662060 20:36574487-36574509 CGGAGGGGGAGGGGAGGGGAAGG - Intronic
1172783672 20:37451966-37451988 CTGAGGATGGGGAGCTGGGCAGG - Intergenic
1173145545 20:40521100-40521122 AAGAGTAGGAGGAGCAGGGAGGG - Intergenic
1173146039 20:40525146-40525168 CTAAGGAAGTGGAGTGGGGAGGG - Intergenic
1173453854 20:43188875-43188897 CAGAGTAGGGGGAGCGGGGGCGG - Intronic
1173618030 20:44415537-44415559 CTGGGGAAGAGGAGCTGGGCTGG + Intronic
1173808269 20:45940374-45940396 CTAAGGAGTAGGAGCAGGGGTGG + Intronic
1173907968 20:46642558-46642580 CTGAGCAGGGGGAGAGGGCAAGG - Intronic
1174209153 20:48863442-48863464 TTGTGGAGAAGGAGCGGGGAGGG - Intergenic
1174292565 20:49519486-49519508 GTGAGGAGGAGGGGCCAGGAAGG - Intronic
1174372339 20:50099988-50100010 CTCAGGAGGCTGAGAGGGGAGGG + Intronic
1175026506 20:55907960-55907982 CTGAGGAGGAGGGGGGTTGAAGG + Intergenic
1175035172 20:55993364-55993386 GTGGGGTGGGGGAGCGGGGAGGG + Intergenic
1175226152 20:57445066-57445088 AGGAGGAGGAGGAGGAGGGAGGG - Intergenic
1175402983 20:58711114-58711136 GGGAGGAGGAGGAGAGGGGGAGG - Intronic
1175657802 20:60787016-60787038 AGGAGGAGGAGGAGGGGGAAAGG - Intergenic
1175681774 20:60994643-60994665 CTGAGGTAGAGGAGGTGGGAGGG - Intergenic
1175752484 20:61508907-61508929 CTGTGGAGGCAGAGTGGGGAGGG - Intronic
1175757400 20:61538488-61538510 CAGAGTAGGAGGAGAGAGGAGGG - Intronic
1175763339 20:61576011-61576033 CTGAGTAGGAGGAAAAGGGAGGG + Intronic
1175874302 20:62222147-62222169 CAGGGGAGGAGGGGTGGGGAGGG - Intergenic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1176028569 20:62999055-62999077 AGGAGGAGGAGGAGTGGGGAGGG + Intergenic
1176115242 20:63429296-63429318 CTGAGGAGGCGGAGTGGAGGGGG - Intronic
1176199892 20:63855486-63855508 TAGAGGAGGAGGGGAGGGGAGGG - Intergenic
1176205860 20:63887772-63887794 CTGACGAGGAAGAGCTGGTAGGG + Intronic
1176285319 21:5016246-5016268 CTGAGGAGGAGGAGGAGGAGGGG + Intergenic
1176362067 21:6006184-6006206 AGGAGGAGGAGGAGGGGGGGGGG + Intergenic
1176554026 21:8245313-8245335 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176572948 21:8428337-8428359 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176582361 21:8543374-8543396 CTGAGGAGCAGGAGCATGGGAGG - Intergenic
1176604857 21:8820280-8820302 CTTCGGAGGAGGAGAGGGGCGGG + Intergenic
1176625370 21:9087640-9087662 CTTCCGAGGAGGAGCGGGGTGGG + Intergenic
1177156942 21:17510373-17510395 TTTAGGAGGAGGAGGGGGGGGGG - Intergenic
1177301322 21:19249271-19249293 CTCAGGAGGAAAAGGGGGGAAGG - Intergenic
1177507229 21:22034749-22034771 AGGAGGAGGAGGAGGGGGAAGGG - Intergenic
1177758319 21:25373723-25373745 AGGAGGAGGAGGGGAGGGGAGGG - Intergenic
1177758341 21:25373777-25373799 AGGAGGAGGAGGAGGGGGAATGG - Intergenic
1177943411 21:27438899-27438921 CTGAGAAAGAGGAGAGGAGAAGG - Intergenic
1178000431 21:28156463-28156485 CTGAGGAGGAGGAGGAAGAAAGG - Intergenic
1178044976 21:28682896-28682918 CTGTGTAGGGGGAGCGGGGAGGG + Intergenic
1178162946 21:29939719-29939741 AGGAGGAGGAGGAGCCGTGATGG - Exonic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178481492 21:32983168-32983190 GGGAGGGGGAGGAGAGGGGAGGG - Intergenic
1178533345 21:33393055-33393077 CCGTGGAGGAGGGGTGGGGATGG + Intergenic
1178596981 21:33963101-33963123 CTGAGGAGGAGGTGGTGGGGAGG - Intergenic
1178719815 21:34998413-34998435 CTGAGGAGGAGGATGAAGGATGG - Intronic
1178724988 21:35043327-35043349 CTGATGGGGAGGAGCAGGGGAGG + Intronic
1178982145 21:37273571-37273593 TGGAGAAGGAGGAGGGGGGAGGG + Intergenic
1179026532 21:37683446-37683468 CAGAGGAGGAGGAGGGGAGAAGG - Intronic
1179116686 21:38499745-38499767 GAGAGGAGGAGGAGGAGGGAGGG + Intronic
1179164051 21:38921398-38921420 CTGAGGTGGAGGAGTAGGGGAGG + Intergenic
1179316121 21:40245812-40245834 GCCAGGAGGAGGAACGGGGATGG + Intronic
1179358322 21:40682662-40682684 CGGAGGGGGAGGGGAGGGGAGGG + Intronic
1179565062 21:42242391-42242413 CTGAGGAGGCTGAGCGGGGAGGG + Intronic
1179717060 21:43294014-43294036 TGGAGGAGGAGGGGCTGGGATGG - Intergenic
1179761451 21:43532361-43532383 AGGAGGAGGAGGAGGGGGGGGGG - Intronic
1179804698 21:43829839-43829861 CGGAGGAGGAAAAGTGGGGAGGG - Intergenic
1179871862 21:44247229-44247251 CTGAGGAGGAGGAGGAGGAGGGG - Intronic
1179904944 21:44418021-44418043 CTGAGGAGGATGAAGGGGGGCGG - Exonic
1179953825 21:44727064-44727086 CTGGGGAGGAGGAGCGGGTGTGG - Intergenic
1180127546 21:45802594-45802616 CGGAGGAGGAGGACCGGGCTGGG + Intronic
1180177391 21:46097564-46097586 CTGAGGGTGGGGAGCCGGGAGGG - Intergenic
1180228883 21:46414520-46414542 AGGAGGAGGAGGAGCAGGGTGGG - Intronic
1180228904 21:46414592-46414614 AGGAGGAGGAGGAGCAGGGTGGG - Intronic
1180228922 21:46414661-46414683 AGGAGGAGGAGGAGCAGGGTGGG - Intronic
1180228962 21:46414817-46414839 AGGAGGAGGAGGAGCAGGGTGGG - Intronic
1180237516 21:46472586-46472608 TGGAGAAGGAGGAGCGGGGATGG + Intronic
1180265196 22:10520422-10520444 CTGAGGAGCAGGAGCATGGGAGG - Intergenic
1180347147 22:11711885-11711907 CTTCGGAGGAGGAGAGGGGCGGG + Intergenic
1180354895 22:11829975-11829997 CTTCGGAGGAGGAGAGGGGCGGG + Intergenic
1180383356 22:12162356-12162378 CTTCGGAGGAGGAGAGGGGCGGG - Intergenic
1180917228 22:19497693-19497715 CTGAGCAGCAGGAGTGGGGAAGG - Intronic
1180974715 22:19842023-19842045 CTGATGAGCAGGAGGTGGGAGGG - Intronic
1181004844 22:20008399-20008421 CTTAGGAGGGGGAGCTGGGAGGG - Intronic
1181050157 22:20234551-20234573 CTGAGGTGGAGGGGTGGGGTTGG + Intergenic
1181062453 22:20288168-20288190 CAGAGGGGCAGGAGCGAGGAGGG - Intergenic
1181093749 22:20492266-20492288 CTGAGATGGAGGAGAGGTGAAGG - Intronic
1181130030 22:20725786-20725808 CTTGGGAGGGGTAGCGGGGAAGG + Intronic
1181236817 22:21451937-21451959 CCTAGGAGGAGGAGCAGGGGTGG + Intergenic
1181361793 22:22343330-22343352 TGGAGGAGGAAGAGCAGGGATGG - Intergenic
1181543525 22:23587495-23587517 CTGAGGACCAGGACCAGGGACGG + Intergenic
1181919249 22:26307314-26307336 CTGAGGGGTAGGAGAGGGTAGGG + Intronic
1182045923 22:27274045-27274067 CTGAGGAGGAGGTGGGGGCCAGG + Intergenic
1182102982 22:27670728-27670750 CTCAGGAGGGGGAAGGGGGAAGG - Intergenic
1182158277 22:28096699-28096721 CTCAGGAGGTGGAGCAGAGATGG - Intronic
1182776938 22:32838245-32838267 TTGAGGAGAAGGAGGGGGGGTGG + Intronic
1183349750 22:37328445-37328467 CTAAGGAGGAGAAACAGGGAGGG - Intergenic
1183366865 22:37411454-37411476 GTGAGGAGGGGAAGCGGAGAAGG + Intronic
1183385414 22:37511397-37511419 GTGAGGAGGAGGAGGGGAGGAGG + Intronic
1183438631 22:37810004-37810026 CTGAGGTGAAGGAGAGGAGATGG - Exonic
1183458025 22:37933230-37933252 CAGAGGAGGAGGTGCGGGGCAGG + Intronic
1183532732 22:38371424-38371446 TTGAGTAGGGGGAGGGGGGAGGG - Intronic
1183804693 22:40198474-40198496 CTGAGTAGGATGAGGAGGGAGGG + Intronic
1184173517 22:42772970-42772992 TAGAGCAGGAGGAGCGGGGATGG - Intergenic
1184206792 22:43009664-43009686 CAGAGGGGGAGGAGCGTGGATGG - Intronic
1184254817 22:43280846-43280868 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254847 22:43280967-43280989 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254876 22:43281085-43281107 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254905 22:43281203-43281225 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254935 22:43281324-43281346 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254978 22:43281493-43281515 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184255007 22:43281596-43281618 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184561637 22:45267254-45267276 GTGGGGTGGAGGAGAGGGGAGGG + Intergenic
1184744999 22:46451045-46451067 CTGGGGAGGAGGAGAGGGAGTGG - Intronic
1184802415 22:46769630-46769652 CTGGGGAGGAGGGGCATGGAGGG + Intronic
1184931015 22:47681444-47681466 CTGAGGATGAGTACAGGGGATGG + Intergenic
1185023096 22:48391970-48391992 GTCAGGAGGAGAAGAGGGGAGGG + Intergenic
1185047614 22:48536957-48536979 CAGAGGAGCAGGACCTGGGACGG + Intronic
1185272513 22:49935649-49935671 GGGAGGAGCAGGGGCGGGGACGG + Intergenic
1203259031 22_KI270733v1_random:162351-162373 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
950028119 3:9834539-9834561 CTCTGGAGGAGGAACCGGGAGGG + Intronic
950195506 3:11006537-11006559 GTGGGGAGGAGGAGAGGAGAGGG - Intronic
950365455 3:12480339-12480361 CTTAGGAGGAGGAGAGGAGGAGG - Intergenic
950531242 3:13553413-13553435 CTGAGGAGGAAGAGCTGGGACGG + Intronic
950556493 3:13699207-13699229 CTGACGGGGAGGGGCGAGGAGGG - Intergenic
950712057 3:14819832-14819854 CTGAGAAGGAGGAGCTGGCCGGG + Exonic
951246509 3:20347912-20347934 CTGAGGAGGCTGAGAAGGGAGGG - Intergenic
951527951 3:23671775-23671797 CTGAGGAGGAGGCGCTGCCAGGG - Intergenic
951704361 3:25528632-25528654 CTCAGGAGGAGGTAAGGGGAAGG - Intronic
951719173 3:25679715-25679737 CAGAGGAGGGGGAGAGAGGAGGG + Intergenic
951881523 3:27484658-27484680 CTGAGGAGGTGGCACGGGGGAGG - Intergenic
952282141 3:31934225-31934247 CTCAGGAGGCTGAGCGGGGGAGG + Intronic
952382640 3:32817054-32817076 GTGAGGAGGAGGAGGGGCGCAGG + Intergenic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
952640922 3:35594451-35594473 TGGGGTAGGAGGAGCGGGGAGGG + Intergenic
953020335 3:39108978-39109000 CTGAGGAGGAGCAGGGGATAGGG + Intronic
953203356 3:40797843-40797865 CTGAGTAGCAGGAGGGTGGATGG + Intergenic
953256042 3:41291434-41291456 GAGAGAAGGAGGAGAGGGGAGGG + Intronic
953299103 3:41753622-41753644 CTCAGAAGGAGGAGCAGGGCAGG - Intronic
953936494 3:47048690-47048712 CTGGCGAGGAGGAGGGAGGAGGG - Intronic
953997801 3:47534091-47534113 CTGGGGAGGAGGAGCCAGGCTGG + Intergenic
954392504 3:50274989-50275011 CTGAGAGGGAGGAGGGGCGACGG - Intronic
954444479 3:50539491-50539513 GTGGGGAGGAGGAGAGGGAAAGG + Intergenic
954999199 3:54911312-54911334 GGGAGGAGGAGAAGCGGGGAGGG - Intronic
955148543 3:56344313-56344335 ATGAGGAGGAGGAGGAGGGAAGG - Intronic
955161455 3:56468382-56468404 AAGAGGAGGAGAAGCGGGGCGGG + Intergenic
955309475 3:57870687-57870709 CTGAGGTGGACGAGAGGGGAAGG + Intronic
955382550 3:58451464-58451486 CTGAGGAGGAGGAAGAGGAAGGG + Intergenic
955966823 3:64397397-64397419 CAGAGGAGGAGGAACGGCTAAGG - Intronic
956166003 3:66398704-66398726 CTGCGCAGCAGGAGGGGGGAGGG + Intronic
956724310 3:72144746-72144768 TTGAGGAGGAGGAAAAGGGAAGG - Intergenic
957715584 3:83926388-83926410 CTGCGGAGGAGGAGAGGGGGTGG - Intergenic
957724264 3:84044542-84044564 CTGAGAAGGGAGAGTGGGGAGGG - Intergenic
958524340 3:95235647-95235669 TAGAGGAGGAGGGGAGGGGAAGG - Intergenic
959260859 3:104077722-104077744 GTGGGGAGGAGGGGAGGGGAGGG + Intergenic
959538624 3:107515256-107515278 GTGGGGAGGAGGTGCGGTGAGGG - Intergenic
959586549 3:108030556-108030578 CTCAGGAGGATGAGGTGGGAGGG + Intergenic
959787378 3:110316767-110316789 CTGAGGGGGAGGGGAGGGGAGGG + Intergenic
960418347 3:117412755-117412777 ATGAGGAGGAGGAGAGGAGAAGG - Intergenic
960702214 3:120450422-120450444 GCGGGGAGGAGGAGAGGGGACGG - Intronic
960840819 3:121956797-121956819 AGGAGGAAGAGGAGCGGGAAGGG - Intergenic
960893394 3:122475922-122475944 CTGAGGAGGAGGGAAGAGGAAGG + Intronic
960953185 3:123012752-123012774 AGGAGGAAGAGGAGGGGGGAAGG - Intronic
960963113 3:123085689-123085711 CTGGGGAGAAGGAAAGGGGAAGG - Intronic
960987070 3:123287658-123287680 CTGATGAGGAGGGTCGTGGAAGG - Intronic
961049757 3:123736479-123736501 CTGAGGAGGGAGTGCAGGGATGG - Intronic
961101449 3:124202597-124202619 AGGAGGAGGAGGAGGAGGGAGGG - Intronic
961381103 3:126497091-126497113 CTGTGGAGGAGGAGGCGGGCAGG - Intronic
961460899 3:127049701-127049723 CAGAGGAGGAGCTGCAGGGAGGG + Intergenic
961617565 3:128194982-128195004 CCAAGAAGGAGGAGCGAGGAGGG - Intronic
961636688 3:128337434-128337456 ATGGGGAGGAGGAGGGGGAAGGG + Intronic
961672045 3:128540298-128540320 CTGAGGAGGAGTAACGTGGGTGG - Intergenic
961742393 3:129040839-129040861 CAGAGGAGGAGGTGGAGGGAGGG + Intergenic
961957557 3:130819532-130819554 GTGAGGAGGAGAAGAAGGGAGGG - Intergenic
962058490 3:131900045-131900067 CTGGGTAGGTGGAGTGGGGAGGG + Intronic
962168414 3:133075576-133075598 CTAAGGAGGAGGAGTGATGAAGG - Intronic
962183455 3:133233181-133233203 GTGGGGTGGCGGAGCGGGGAGGG - Intronic
962230142 3:133658221-133658243 CAGAGGAGGCCGAGCGGGGGTGG + Intronic
962449773 3:135503293-135503315 CTGAAGTGGAGGAGGTGGGAAGG + Intergenic
962760093 3:138503698-138503720 CTGAGGAGGAGGAGGAGGCAAGG - Intronic
963100245 3:141595133-141595155 TTTGGGAGGAGGAGAGGGGATGG - Intronic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963732650 3:148987696-148987718 GGGAGGAGGAGGAGCCGGGCGGG - Intergenic
963808772 3:149753638-149753660 GTGTGGAGGAAGAGAGGGGAAGG + Intergenic
963850678 3:150207510-150207532 TGGAAGAGGAGGAGCGGGAAGGG - Intergenic
963987774 3:151617157-151617179 AGGAGGAGGAAGAGAGGGGAGGG - Intergenic
964000204 3:151762192-151762214 CAGAGGAGGAGGAGCTGGCATGG - Intergenic
964290973 3:155179599-155179621 CTTAGCAGGAGGAGAAGGGAAGG + Intronic
964441720 3:156718173-156718195 CTGAGGAGGAGGAGGAAGGGGGG + Intergenic
964568156 3:158081029-158081051 GTGAGGATGAGGAGAAGGGAAGG + Intergenic
964718985 3:159753052-159753074 ATGAGGAGCAGAAGTGGGGAAGG - Intronic
965682122 3:171262297-171262319 CAGAGGAGGTGGAGTGGGGTGGG - Intronic
965890649 3:173509503-173509525 CTGAGGAGGCTGAGTTGGGAGGG + Intronic
966087357 3:176084743-176084765 AGGAGGAGGAGGAGGGAGGAAGG + Intergenic
966683808 3:182671949-182671971 CTGAGGAGGCAGAGGAGGGAAGG - Intergenic
966711858 3:182980255-182980277 CCGAGGAGGCGGAGCGGAGCCGG - Intronic
966864300 3:184248713-184248735 CCGAGGGGGAGGGGAGGGGAGGG - Intronic
966882098 3:184356290-184356312 CTGAGGATTGGGAGTGGGGAGGG - Intronic
966886514 3:184380340-184380362 CCGAGGAGCAGCAGCGGGGCCGG - Exonic
966995246 3:185273717-185273739 GTGGGGTGGGGGAGCGGGGAGGG - Intronic
967055305 3:185825028-185825050 CGGAGGAGGAGGAGAGACGAGGG - Exonic
967296772 3:187973143-187973165 CTGAGAAGTAGGAGAGGGGCTGG - Intergenic
967653347 3:192014495-192014517 CTCAGGAGGTGGAGGTGGGAGGG - Intergenic
967984242 3:195083488-195083510 CTGAGGAGGAGATGAGGAGAAGG - Intronic
968225150 3:196968636-196968658 CAGAGGAGCGGGTGCGGGGAGGG - Intronic
968353372 3:198080884-198080906 CTTCGGAGGAGGAGCGGGGCGGG - Intergenic
968353554 3:198081517-198081539 CTGCGGTGGAGGAGTGGGGCGGG - Intergenic
968426309 4:525838-525860 GTGAGGAAGCGGAGGGGGGACGG + Intronic
968452454 4:681781-681803 CGCGGGAGGGGGAGCGGGGAGGG - Intronic
968592414 4:1465678-1465700 CTGAGGAGGAGGAGGCGGGGAGG + Intergenic
968660252 4:1795840-1795862 CTGCAGAGGAGGAGTGGGGGAGG - Intronic
968876317 4:3269603-3269625 CTGCGAAAGGGGAGCGGGGAGGG + Intronic
968938333 4:3624974-3624996 CTGGGGAGGAGCAGCTGGGAGGG + Intergenic
968938346 4:3625025-3625047 CTGGGGAAGAGCAGCTGGGAGGG + Intergenic
968962240 4:3751537-3751559 GTGAGGAAGAGGAGCGAGGATGG - Intergenic
969052554 4:4383679-4383701 CTGAGGAGAGGGAGCAGGGTAGG + Intronic
969143873 4:5102930-5102952 GAGAGGAGGGGGAGGGGGGAGGG - Intronic
969184203 4:5463411-5463433 CTGAGGAGGAGCAGCAGGCCAGG - Intronic
969327719 4:6453405-6453427 CTGAGGAGGCAGAGCTGGGGTGG - Intronic
969450217 4:7268723-7268745 GAGTGGAGGAGGAGCAGGGAGGG + Intronic
969511282 4:7619468-7619490 CTGAAGAGGTGGAGTGGGCAGGG - Intronic
969627738 4:8316346-8316368 ATGAGGAGAAGGAGCTGGGCAGG - Intergenic
970639830 4:18051647-18051669 CTGAGAAGCAGGAGCGCTGATGG - Intergenic
971422911 4:26490363-26490385 CTGCCGTGGAGGAGCAGGGAGGG + Exonic
972285927 4:37648234-37648256 CTGGGAAGGAGGAGAGGGGGAGG + Intronic
972292555 4:37703425-37703447 CTGGGCAGGAGGGGCGGGGTGGG + Intergenic
972698189 4:41468332-41468354 AGGAGGAGGAGGGGAGGGGAGGG - Intronic
972902971 4:43708001-43708023 TTGAAGAGGAGGGGAGGGGAGGG + Intergenic
972913898 4:43852239-43852261 CTGAGGAGGAGGAAGAGGCAGGG + Intergenic
973373266 4:49270657-49270679 CTTCGGAGGAGGAGAGGGGCAGG - Intergenic
973387740 4:49524551-49524573 CTTCGGAGGAGGAGAGGGGCAGG + Intergenic
973575380 4:52282779-52282801 CTGAGGAGGAGGAATGGGAGGGG - Intergenic
973829909 4:54748168-54748190 CTGTGGAGGAAGAGCTGGGCAGG - Intergenic
974013422 4:56627467-56627489 CTCAGGAGGTGGAGAGGGAAAGG - Intergenic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
974839882 4:67287279-67287301 AGGAGGGGGAGGAGAGGGGAGGG + Intergenic
975710096 4:77153085-77153107 CTGAGGAAGAGAAACAGGGAAGG - Intergenic
976003416 4:80399690-80399712 TTGAGGTGGGGGAGGGGGGAGGG + Intronic
976127275 4:81847447-81847469 CTGAGGAGGAGATGTGGGCAGGG - Intronic
976691838 4:87876804-87876826 CTGAGGAGGCTGAGGTGGGAGGG - Intergenic
976695801 4:87918709-87918731 AGGAGGAGGAGGAGGAGGGAAGG + Intergenic
976777161 4:88719480-88719502 AGGAGGAGGAGGAGAAGGGAAGG - Intergenic
977536400 4:98260785-98260807 CTGAGGAGGGGCCGCCGGGAGGG - Intergenic
977731096 4:100352923-100352945 AGGAGGAGGAGGAGGAGGGAAGG + Intergenic
977929229 4:102733459-102733481 CTCAGGAGGCTGAGCTGGGAGGG - Intronic
978828171 4:113049614-113049636 AGGAGGAGGAGGGGTGGGGAAGG - Intronic
979602994 4:122606614-122606636 TGGAGCAGGAGGAGCGGGCAGGG - Intergenic
979896393 4:126163248-126163270 AAGAGGAGGAGAAGTGGGGAAGG + Intergenic
980448755 4:132944405-132944427 CAGAGGAGGAGGAGCCAAGATGG + Intergenic
980977954 4:139629166-139629188 TAAAGGAGGAGGAGGGGGGAGGG - Intergenic
980981426 4:139657580-139657602 AAGAGGAGGAGGAGAAGGGAGGG + Intergenic
981254391 4:142644263-142644285 AGGAGGAGGAGGAGTGGGGGAGG + Intronic
981270925 4:142846586-142846608 AGGAGGAAGAGGAGCGGGGAGGG - Intronic
981342308 4:143635519-143635541 AGGATGAGGAGGAGCAGGGAGGG - Intronic
981626683 4:146764390-146764412 GTGGGGAGGAGGAGAGAGGAGGG + Intronic
982039777 4:151385255-151385277 CTGGGGTGGAGGTGGGGGGATGG + Intergenic
983608876 4:169620466-169620488 CGGAGGAGGAGGTGTTGGGACGG + Intronic
983759210 4:171384740-171384762 TGAAGGAGGAGGAGGGGGGAAGG - Intergenic
984781976 4:183534217-183534239 CCTCGGAGGAGGAGCGGGGATGG - Intergenic
984999649 4:185471193-185471215 CTGGGGCGGGGGGGCGGGGAGGG + Intronic
985117277 4:186604817-186604839 GTGAGGAGGAAGAGGGAGGAGGG + Intronic
985117419 4:186605499-186605521 GGGAAGAGGAGGAGTGGGGAGGG + Intronic
985147033 4:186903787-186903809 CTTAGGAGCAGGAGTCGGGAAGG + Intergenic
985211864 4:187604074-187604096 GAGGGGAGGAGGAGAGGGGAGGG - Intergenic
985269906 4:188184041-188184063 ATGGGGAGGTGGAGAGGGGATGG - Intergenic
985309802 4:188585535-188585557 CTTAAGAAGAGGAGAGGGGAGGG + Intergenic
985634073 5:1027490-1027512 CAGAGGAGAGGGAGCGGGGAGGG - Intronic
985889432 5:2704317-2704339 CTGAGGATGGGGAGCGCTGATGG + Intergenic
985996796 5:3601406-3601428 CACAGCAGCAGGAGCGGGGAGGG - Intergenic
986167091 5:5283462-5283484 CTGGGGGGGAGGTGGGGGGAGGG - Intronic
986601053 5:9473626-9473648 CTGAAGAGGAGGGGCTGGGGAGG + Intronic
986613877 5:9597109-9597131 CAGAGGAGGAGGAAGGGGAAGGG - Intergenic
986916963 5:12632454-12632476 CTCAGGAAGAGGAGCAGGTAAGG - Intergenic
986978165 5:13416494-13416516 CCGAGGAGGAGGAGCCAAGATGG + Intergenic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989690354 5:44136168-44136190 GTGGGGTGGAGGAGGGGGGAGGG - Intergenic
990362192 5:55031705-55031727 CTGAGGAGGAGGGAGGGGCATGG + Intronic
990461791 5:56037556-56037578 CTGAGGATGAGGTTGGGGGAGGG + Intergenic
991248741 5:64535478-64535500 CTGAAGAGGTGGGGCTGGGAGGG - Intronic
991418747 5:66418875-66418897 AGGAGGAGGAGGAGAGAGGAGGG - Intergenic
991481985 5:67090438-67090460 GGGAGGGGGAGAAGCGGGGAGGG - Intronic
991481992 5:67090454-67090476 GGGAGGGGGAGAAGCGGGGAGGG - Intronic
992002047 5:72445304-72445326 CTGAGGAGGAGCAACAGGAAGGG + Intronic
992086340 5:73281314-73281336 CTGAGGCGATGGAGCGGGGGCGG + Intergenic
992195815 5:74337832-74337854 CTGAAGAGGAAGGGCTGGGAGGG - Intergenic
992349728 5:75916435-75916457 AGGAGGAGGAGGAGAGGAGAAGG - Intergenic
992636620 5:78730945-78730967 CTGAGGGGGAGGTGAGGGGAAGG + Intronic
992652412 5:78872665-78872687 GTGGGGAGGGGGAGGGGGGAGGG + Intronic
992715218 5:79503841-79503863 CTGAGGAGGAAGAGGAGGAAGGG + Intronic
992809517 5:80372472-80372494 CTGAGGATGATGAGTGGGGGTGG - Intergenic
992912339 5:81408171-81408193 AGGAGGAGGAGGTGGGGGGAAGG + Intergenic
993276186 5:85862061-85862083 CTGAGGAGGAGGAGCAGAAAAGG - Intergenic
993503293 5:88684998-88685020 AGGAGGAGGAGGAGGAGGGATGG + Intergenic
994205709 5:97033288-97033310 GTGAGGGGGAGGGACGGGGAAGG + Exonic
994414624 5:99454079-99454101 GTGGGGTGGAGGAGGGGGGAGGG - Intergenic
994709972 5:103255331-103255353 CTGAGGAGGAGAAAGGTGGAAGG - Intergenic
994877848 5:105448443-105448465 TTGAGGGAGAGGAGTGGGGAGGG + Intergenic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
995602815 5:113816745-113816767 GTGAAGGGGAGGAGAGGGGAGGG + Intergenic
996171690 5:120300602-120300624 TTGAGGAGGTGGAATGGGGATGG + Intergenic
997075083 5:130664586-130664608 GTGGGGTGGGGGAGCGGGGAGGG + Intergenic
997302930 5:132819687-132819709 GTTAGGAGGAGCAGCGGGGGCGG + Intergenic
997666001 5:135629913-135629935 ATGAGGAGGAGAAACGGGCAAGG + Intergenic
998130396 5:139648776-139648798 CCGAGGGGGAGGGGCGGGGCAGG - Exonic
998135316 5:139671382-139671404 TGGAGGAGGAAGAGAGGGGATGG - Intronic
998162262 5:139820232-139820254 CTGGGGAGTAGGAGTTGGGATGG + Intronic
998359634 5:141573807-141573829 CAAAGGAGGAGGTGGGGGGATGG + Exonic
998494462 5:142575498-142575520 CAGAGGAAGAGGAGAGAGGAGGG - Intergenic
998991579 5:147823213-147823235 AGGAGGAGGAGGAGGGGGAAAGG - Intergenic
999203660 5:149833410-149833432 AGGAGGAGGAGGAGTGGGGCAGG + Exonic
999261560 5:150241781-150241803 GAGAGGAGGAGGAGAGGAGAGGG - Intronic
999328017 5:150655468-150655490 CTTAGGGAGAGGAGCTGGGAGGG - Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
1000932708 5:167271195-167271217 ATGGTGAGGAGGAGTGGGGAGGG + Intergenic
1000968802 5:167691578-167691600 CTGAGGGACAGAAGCGGGGAAGG - Intronic
1001023825 5:168206528-168206550 CTGGGGTGGAGGAGGGGGCATGG + Intronic
1001173016 5:169439267-169439289 CTGAAGAGGAGGAGCCAGAAAGG + Intergenic
1001542101 5:172546738-172546760 CAGAGGAGGAGGGGAGGTGATGG + Intergenic
1001690792 5:173631272-173631294 ATGAGGAGGAGGAGGGGGGTAGG - Intergenic
1001690801 5:173631297-173631319 ATGAGGAGGAGAAGGGGGGTAGG - Intergenic
1001690809 5:173631322-173631344 ATGAGGAGGAGGAGGGGGGTAGG - Intergenic
1001690818 5:173631347-173631369 ATGAGGAGGAGAAGGGGGGTAGG - Intergenic
1001690826 5:173631372-173631394 ATGAGGAGGAGAAGGGGGGTAGG - Intergenic
1001690834 5:173631397-173631419 ATGAGGAGGAGAAGGGGGGTAGG - Intergenic
1001690842 5:173631422-173631444 ATGAGGAGGAGGAGGGGGGTAGG - Intergenic
1001963767 5:175896021-175896043 CTGAGCTGGGGGAGGGGGGAAGG - Intergenic
1002166396 5:177350156-177350178 GAGAGGAGGAGCAGAGGGGACGG + Intronic
1002196224 5:177503071-177503093 CTGAGGTGGAGTTGCGGTGAGGG + Intronic
1002322102 5:178382415-178382437 CAGAGGAGGAGGAGGGCGAAGGG - Intronic
1002338662 5:178499296-178499318 CTGAAAAGGAGGAGAAGGGAGGG + Intronic
1002430863 5:179203142-179203164 CTGAGGAGGAGGTGAGGTGGTGG - Intronic
1002526501 5:179818626-179818648 CTGAGGTGGAAGAGTGGGGAGGG - Intronic
1003139249 6:3457083-3457105 AGGAGGAGGAGGAGTGGGGCCGG - Intergenic
1003291807 6:4786143-4786165 CTAAGGAGGTGGAGGTGGGAGGG + Intronic
1003406753 6:5832552-5832574 AGGAGGAAGAGGAGGGGGGAGGG + Intergenic
1003493399 6:6642859-6642881 CTCCGGAGGAGGAGGAGGGAGGG - Intronic
1003562706 6:7196042-7196064 GTGAGCAGGAGGAGGGGGAAGGG - Intronic
1003829181 6:9987817-9987839 CTGAGGTGGGGGAGCGAAGATGG + Intronic
1003901485 6:10659607-10659629 GTGAGGAGGGGGAGAGGAGAGGG + Intergenic
1004377892 6:15106483-15106505 TTCAGGAGGAGGAGGGAGGATGG + Intergenic
1005018946 6:21399545-21399567 CTAGGGAGGAGGGGAGGGGAGGG + Intergenic
1005222077 6:23598233-23598255 CTGGGGTGGGGGAGGGGGGAAGG + Intergenic
1005255378 6:23997269-23997291 CAGAGGTGGAGGAGGGGGAAGGG - Intergenic
1005255394 6:23997318-23997340 CTGAGGAGGAGGAGAAGACAAGG - Intergenic
1005300205 6:24463037-24463059 CTCAGCAGGTGGAGCGGGGAGGG - Intronic
1005705464 6:28447220-28447242 CGCAGGAGGAGGAGCGGCGGGGG + Intergenic
1005773542 6:29103146-29103168 GTGTGTAGGGGGAGCGGGGAGGG + Intergenic
1005830639 6:29668570-29668592 CTCGGGAGGAGGAGCTGTGAAGG - Intronic
1005956203 6:30665209-30665231 CTGGGGAGGAGCAGCGGCGCTGG - Exonic
1006108647 6:31731004-31731026 CTGAGGATGGGGAGAGGAGAGGG + Intronic
1006211196 6:32396344-32396366 CTGACGAGGATGGGCTGGGAAGG + Exonic
1006404874 6:33839079-33839101 CTGGGGAAGAGGAGTGGGGGTGG - Intergenic
1006520494 6:34568470-34568492 GGAAGGAGGAGGATCGGGGAGGG + Intergenic
1006640621 6:35487916-35487938 CTGGGGAGGAGGAGCTGACAGGG - Intronic
1006670365 6:35726516-35726538 TGGAGGAGGAGGAGATGGGAGGG - Intronic
1006983623 6:38163909-38163931 CTGCTGAGCAGGTGCGGGGAAGG + Intergenic
1007175030 6:39890214-39890236 CTGAGGAGGAGGAAGAGGAATGG + Intronic
1007207594 6:40165173-40165195 CTGAGGAGGTGGTGGGGTGACGG - Intergenic
1007207903 6:40167490-40167512 CTGAGGAAGAAGAGTGGAGAAGG - Intergenic
1007407942 6:41645460-41645482 CTGGGGGTGAGGAGCAGGGAGGG - Intronic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007616397 6:43182179-43182201 CTGAGGAGGCGGGGCCAGGACGG + Exonic
1007780109 6:44247748-44247770 CGGTGGAGGAGGGGCGGGGAGGG + Intronic
1008646419 6:53519235-53519257 CTGAGGAGGAAGTGCAGGTATGG - Intronic
1008649055 6:53544922-53544944 GGGAGGAGGAGCAGCGGGGAGGG - Exonic
1010046232 6:71447308-71447330 CTGGGGAGAAGGGGCAGGGAGGG + Intergenic
1010319925 6:74495279-74495301 ATGAGGTGGGGGAGGGGGGAGGG - Intergenic
1010398564 6:75421567-75421589 GTGAGGAGGAGTAGTGAGGAAGG - Intronic
1011107992 6:83803752-83803774 CTTAGGAGGAGGAGCCAAGATGG - Intergenic
1011716375 6:90109391-90109413 CAGAGGAGGAGGAGCAGAGGAGG - Intronic
1012286853 6:97401014-97401036 CTGAGGAGGAGGAAGGGGAGAGG + Intergenic
1012450564 6:99349528-99349550 CAGAGGAGGAGGAGGAGGAAGGG + Exonic
1013117747 6:107115380-107115402 CTGAGGGGGAGGGGCGGGCCGGG - Intergenic
1013265563 6:108494164-108494186 GGGAGCAGGGGGAGCGGGGATGG - Intronic
1013869784 6:114743156-114743178 GTGTGGAGGGGGAGTGGGGAGGG - Intergenic
1014041996 6:116838750-116838772 CTGGGGTGGAGGAGGGGGGAGGG + Intergenic
1014089854 6:117391435-117391457 GTGAGGAGGAGAAGCTGGGGTGG + Intronic
1014101918 6:117520472-117520494 CTAGGGAGGAGGATGGGGGAGGG - Intronic
1014340336 6:120197647-120197669 TTGAGGAGGAGGAGGGATGATGG - Intergenic
1014472517 6:121834104-121834126 CACAGGAGAAGGAGCAGGGAAGG - Intergenic
1014700883 6:124686445-124686467 CAGAGCAGGAGGAAAGGGGAGGG + Intronic
1015826187 6:137314436-137314458 GTGAGGGGGAGGGGCGGGGGCGG - Intergenic
1015999443 6:139028723-139028745 TGGAGGAGGAGGAGCAGGGTAGG - Exonic
1016509092 6:144819852-144819874 CGGAGGAGGAGAAGGGGAGAAGG - Intronic
1016772819 6:147870810-147870832 GGGAGGAGGAGGGGAGGGGAGGG + Intergenic
1016861377 6:148721933-148721955 CTAAGGAGAGGGAGCAGGGAAGG - Intergenic
1016923453 6:149317831-149317853 CGGAGGGGGCTGAGCGGGGAGGG + Intronic
1017259675 6:152371684-152371706 GGGAGGGGGAGGAGAGGGGAAGG + Intronic
1017539991 6:155391158-155391180 CTGGGGAAGGGTAGCGGGGAGGG + Intergenic
1017646412 6:156543492-156543514 GAGAGGAGGAGGAGGAGGGACGG - Intergenic
1017877460 6:158536601-158536623 CCGAGGAGGAGGAGCAGGTGCGG - Exonic
1017910703 6:158790316-158790338 TTGAGGAGGTGGAGATGGGAGGG + Intronic
1018188092 6:161285568-161285590 GTGAGAAGGTGGAGCAGGGAAGG - Intergenic
1018220201 6:161570494-161570516 AGGAGGAGGAGGAGGGGGAAGGG - Intronic
1018717182 6:166542474-166542496 TTTGGGAGGAGGAGCTGGGACGG + Intronic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019306869 7:339807-339829 CTGGGGAGGAGGGGCTGGTATGG - Intergenic
1019551754 7:1606707-1606729 AAGAGGAGGAGGAGGGGGAAGGG - Intergenic
1019888259 7:3924239-3924261 CTGAGGAGCAGTTGCGTGGAAGG + Intronic
1019930504 7:4219822-4219844 ATATGAAGGAGGAGCGGGGAGGG - Intronic
1020253990 7:6491524-6491546 CTGAATTGGAGGAGTGGGGAGGG + Intergenic
1020533566 7:9364877-9364899 CTCAGGAAAAGGAGCAGGGAGGG - Intergenic
1020705494 7:11538811-11538833 CTAAGGAGGAGGCTTGGGGAGGG - Intronic
1020792484 7:12643774-12643796 CTGAGGGGGAGCAGCTGAGACGG - Intronic
1021452888 7:20798407-20798429 GGAAGGAGGAGGAGCGGGGCGGG - Intergenic
1021500539 7:21328490-21328512 CTGAGGAGGAGAATAGGGTATGG - Intergenic
1021629814 7:22633653-22633675 ATGATGAAGAGGAGAGGGGATGG + Intergenic
1021717159 7:23470559-23470581 AGGAGGAGGAGGAGGGAGGAAGG + Intergenic
1021785864 7:24152075-24152097 CTGGGGAGAAGGAGAAGGGATGG - Intergenic
1021884531 7:25125569-25125591 GTGTGCTGGAGGAGCGGGGAGGG + Intergenic
1022202094 7:28126765-28126787 GTGAGGAAGAGGAGAGGGAAAGG + Intronic
1022747904 7:33191137-33191159 CTGAGAAGCAGGACTGGGGAGGG + Intronic
1022908708 7:34879781-34879803 CTGAGGAGGGTGAGTGGCGATGG - Intergenic
1022969689 7:35505620-35505642 TTGAGGAGGGGGTGCTGGGATGG + Intergenic
1023134049 7:37033226-37033248 CGGAGCAGGAGGAGCGCAGACGG + Intronic
1023196923 7:37651258-37651280 CTGTGGGGTTGGAGCGGGGAGGG - Intergenic
1023872257 7:44269505-44269527 GGGAGGAGGAGGGGCTGGGAGGG - Intronic
1023956600 7:44891650-44891672 CTGAGGCTGAGGAGAGGAGAGGG + Intergenic
1023974930 7:45021702-45021724 CTGAGGAGGAGAATGGGGCAGGG + Intronic
1023996049 7:45159427-45159449 CTCAGGAGGACCAGCAGGGAGGG + Intronic
1024237690 7:47410262-47410284 CTAAGGAGGAGGACCTGGGCTGG - Intronic
1024317775 7:48036878-48036900 TTGAAGTGGAGGAGAGGGGAAGG + Intronic
1024353973 7:48395605-48395627 CTGAGGAGGAGGAGGAGGAAGGG - Intronic
1024639384 7:51316936-51316958 CTGAGCAGGCGGGGCGGGGCGGG - Intergenic
1024677252 7:51647775-51647797 ATGAGGAGGAGGAGGAAGGAGGG - Intergenic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1024999554 7:55303675-55303697 AGGAGGAGGAGGAGCAGGGGAGG + Intergenic
1026021936 7:66715088-66715110 TGGAGGAGGAGGAGAGGAGAAGG - Intronic
1026068080 7:67093057-67093079 CTGAGGAGGCAGAGGTGGGAGGG + Intronic
1026360981 7:69600202-69600224 CTGTGGAGGGGGTGCAGGGAGGG - Intronic
1026517282 7:71084080-71084102 GGGAGGAGGAGGGGAGGGGAGGG - Intergenic
1026638636 7:72105773-72105795 AGGAGGAGGAGGAGGGGGGAGGG + Intronic
1026688187 7:72530556-72530578 CTGAGGAGGCCGAGGTGGGAGGG - Intergenic
1026708844 7:72719253-72719275 CTGAGGAGGCAGAGGCGGGAGGG - Intronic
1026723413 7:72852405-72852427 CTGAGGAGGCCGAGGTGGGAGGG - Intergenic
1026800650 7:73397871-73397893 GTGAGGAGGAGGCGGGGGGAGGG + Intergenic
1026804065 7:73418575-73418597 AGGAGGAGGAGGAGGAGGGAGGG - Intergenic
1026816985 7:73521472-73521494 GGGAGGAGGAGGCGTGGGGAGGG - Intronic
1027199317 7:76053097-76053119 ATGAAGAGGAGGAGCGGGTTGGG + Intronic
1027364513 7:77443646-77443668 CTCAGGAGGCTGAGCTGGGAAGG + Intergenic
1028037709 7:86005295-86005317 CTGAGGAGGAGGAGTGAGATGGG + Intergenic
1028424287 7:90669114-90669136 TGGAGGAGGAGGAGATGGGATGG - Intronic
1029379538 7:100203998-100204020 CTGAGGGGAAAGAGTGGGGAAGG - Intronic
1029406076 7:100374664-100374686 CTGAGGAGTGGGGGCGGGGCTGG - Intronic
1029438963 7:100577043-100577065 CATAGGAAGAGGAGTGGGGAGGG + Intronic
1029459344 7:100686321-100686343 GTGAAGAGGAGGGGCGGGGAGGG - Exonic
1029493056 7:100882711-100882733 AGGAGGAGGAGGAGCAGGAAGGG - Intronic
1029549742 7:101231457-101231479 CTGAGGCGGGGGAGGGGGGGTGG - Intergenic
1029714362 7:102317903-102317925 CAGGGGAGGAGGAGCTGGGCTGG + Intronic
1029887830 7:103891568-103891590 CTGAGGTGGAGTAGAGGAGAAGG - Intronic
1030093316 7:105876629-105876651 CGGCGGAGGAGGAGGGGAGAGGG + Intergenic
1030380007 7:108800845-108800867 GAGAGGAGGAGGAAAGGGGAGGG - Intergenic
1031070551 7:117156673-117156695 CTGAGCAGGAGCAGCTGGAAAGG + Intronic
1031222188 7:118982193-118982215 AGGAGGAGGAGGAGGGGGGGAGG + Intergenic
1031461129 7:122050432-122050454 TTGAAGGGGAGGAGAGGGGAGGG + Intronic
1032065778 7:128769300-128769322 GAGAGGAGGAGGAATGGGGACGG - Exonic
1032695537 7:134332907-134332929 AGGAGGAGGAGAGGCGGGGAGGG - Intergenic
1032834737 7:135662434-135662456 CTGAGTGGGAGGAGCGGGGCGGG + Intergenic
1033023827 7:137753964-137753986 AGGAGGAGGAGGAGCGTGGAGGG + Intronic
1033036382 7:137879755-137879777 CTGGGGAGGAGAAGCTGGGGAGG + Exonic
1033134592 7:138773983-138774005 GGGAGGAGAAGGAGCCGGGAGGG - Intronic
1033649393 7:143329388-143329410 CTGAAGAGGAGGATTGGGGATGG + Intronic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1034254066 7:149714911-149714933 CCGAGGGGGAGGGGCGGGGGTGG - Intronic
1034324912 7:150221043-150221065 GGGCGGAGGAGGAGCTGGGACGG + Intergenic
1034350675 7:150412868-150412890 ATAAGGAAGAGGAGCAGGGAAGG - Intergenic
1034439870 7:151081137-151081159 CTGGTGAAGGGGAGCGGGGAGGG - Exonic
1034504105 7:151472340-151472362 CTGAGCAGGGGTGGCGGGGAAGG - Intronic
1034527728 7:151676237-151676259 CTGAGGAGGGGGAGGGGGAGGGG + Intronic
1034536836 7:151730654-151730676 GTGAGGAGGAGCAGGGGGGCTGG + Intronic
1034720723 7:153290068-153290090 CTGAGGAGGAGGGGGGGAGGGGG + Intergenic
1034768283 7:153748190-153748212 GGGCGGAGGAGGAGCTGGGACGG - Intergenic
1034945471 7:155259118-155259140 GGGAGGAGGAGGAGGAGGGAAGG - Intergenic
1035232923 7:157477087-157477109 CTGCGGAGGATGCGCAGGGAGGG + Intergenic
1035249175 7:157585748-157585770 GAGGGGAGGAGGAGTGGGGATGG + Intronic
1035371779 7:158384215-158384237 CACAGGAGGAGGAGCTGGTAAGG + Intronic
1035382426 7:158448390-158448412 CTGGGGAGGAGGAGGGAGGTTGG + Intronic
1035416886 7:158696719-158696741 CTTAGGAGGAGGAGGGTGGCAGG - Intronic
1035732058 8:1860318-1860340 GAGAGGAGGAGGAGGGGGGAAGG - Intronic
1035732080 8:1860385-1860407 GAGAGGAGGAGGAGGGGGGAAGG - Intronic
1036950339 8:13133553-13133575 CGGCGGAGGAGGCGCGGGGCGGG - Intronic
1037568863 8:20141622-20141644 GGGAGGAGGAGGAGGGGGGAGGG + Intergenic
1037760416 8:21738172-21738194 GGGAGGAGGAGGAACGGGGGAGG - Intronic
1037861136 8:22406395-22406417 TTGGGGGGGAGGAGCGGGGCCGG + Intronic
1037877224 8:22554165-22554187 GTGAGGAGGAGGGGAGGGGCTGG - Intronic
1038150948 8:24942114-24942136 GGGAGGAGGAGGAGGGAGGAGGG - Intergenic
1038483689 8:27918972-27918994 AAGAGGAGGAGGAGGGGAGAAGG + Intronic
1038647354 8:29372884-29372906 CCGGGGAGGAGGAGAAGGGAAGG + Intergenic
1038658952 8:29480019-29480041 CTGGGGAGGAGGGGCAGGAAAGG - Intergenic
1038740562 8:30213139-30213161 CTCAGAGGGAGGAGCAGGGATGG + Intergenic
1038760854 8:30383918-30383940 CTCAGGAAGCGAAGCGGGGAAGG + Intergenic
1038900841 8:31841990-31842012 ATGGGGAGGAGGAGGAGGGAAGG - Intronic
1039799158 8:40939228-40939250 CTGAGGAGCAGGAAAGGTGACGG - Intergenic
1039984280 8:42435084-42435106 ATGAGGAGGAGGAAGTGGGACGG + Intronic
1040076979 8:43246691-43246713 CTGCGGCGGAGGAGCGGGGCGGG + Intergenic
1040690958 8:49937865-49937887 CTCAGAAGGAGGAGGGAGGAAGG - Intronic
1041169769 8:55129628-55129650 CTGAGGACCAGAAGAGGGGATGG + Intronic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1041360325 8:57046191-57046213 CTGAGGAGGAGGAAAAGGAAGGG + Intergenic
1041525818 8:58804365-58804387 CTGAGGAGGAGGAGGAAGAAGGG - Intergenic
1041739109 8:61139652-61139674 CTCAGGGGGAGGCACGGGGAGGG + Intronic
1041746187 8:61211470-61211492 AAGAGGAGGAGGAGAGGGGGAGG - Intronic
1042052426 8:64725687-64725709 GTTAGGAGGAGGAGCAGGGAGGG + Intronic
1042176527 8:66042703-66042725 GCGAGGAGGGGGAGGGGGGAGGG - Intronic
1042281202 8:67058294-67058316 TTGAGGAGAAGGAGATGGGAAGG - Intronic
1042649727 8:71025996-71026018 CAGAGGATGAGGAGAGGAGATGG - Intergenic
1042785019 8:72537119-72537141 CTGAGGAGGAAGAGGGGGAGGGG + Intergenic
1043033874 8:75172183-75172205 CTCAGGAGGATGAGGTGGGAAGG + Intergenic
1043303340 8:78762458-78762480 CTGAGGAGGCGGGGAGGGGAGGG - Intronic
1043383092 8:79723484-79723506 GTGAGGAGGAAGAGAGAGGAAGG - Intergenic
1043746926 8:83886132-83886154 CTGAGGAGGAGGAAAAGGAAGGG + Intergenic
1044619102 8:94171978-94172000 GGGAGGAGGGGGAGGGGGGAGGG - Intronic
1044831152 8:96250682-96250704 AGGAGGAGGAGGAGGGGGGGAGG + Intronic
1045061986 8:98418717-98418739 CAAGGGAGGAGGAGCGGGGTGGG + Intronic
1045113272 8:98953482-98953504 CTGAGGAGTAGGGGTAGGGATGG + Intergenic
1045380149 8:101616054-101616076 GGGAGGAGGAGGGGAGGGGAGGG - Intronic
1045495027 8:102700845-102700867 CTGGGGAGGAGGAGCCTGGCTGG - Intergenic
1045523025 8:102919761-102919783 GTGAGGGGGATGAGCGGGGTTGG + Intronic
1046130103 8:109956117-109956139 CTGAGTGGGGGGAGGGGGGAGGG - Intergenic
1046797358 8:118387457-118387479 ATGAGGAGGAGGAGGGGAGTAGG - Intronic
1047084801 8:121504935-121504957 AGGAGGAGCAGGAGTGGGGATGG - Intergenic
1047329013 8:123868107-123868129 GAGGGGAGAAGGAGCGGGGAAGG - Intronic
1047381986 8:124372462-124372484 CTGAGGAGGAGCGGCGCGGGCGG + Exonic
1047633307 8:126731786-126731808 TTGAGGTGGGGGAGGGGGGAGGG - Intergenic
1047819877 8:128507190-128507212 CTGAGGAGGCGTGGAGGGGAAGG + Intergenic
1049035527 8:140072574-140072596 AGGAGGAGGAGGAGAAGGGAAGG + Intronic
1049035539 8:140072612-140072634 AGGAGGAGGAGGAGCGGTGGTGG + Intronic
1049083134 8:140457917-140457939 GGGAGGAGGAGGAGGGAGGAGGG + Intronic
1049127827 8:140808325-140808347 ATGAGGAGGAGGAGTGTGGCAGG + Intronic
1049283482 8:141762304-141762326 CTGGGGAGGGTGAGAGGGGAGGG + Intergenic
1049306578 8:141907211-141907233 GCGTGGAGGAGGAGAGGGGAGGG + Intergenic
1049310488 8:141931381-141931403 CTGAGGAGGAGGTGAGGAGGGGG + Intergenic
1049376140 8:142290050-142290072 CTGAGGAGGAAGCTCGGGGCAGG + Intronic
1049735629 8:144203074-144203096 CTGTGGAGGGGGGGCGGGGGGGG + Intronic
1049830894 8:144700239-144700261 CTCAGGAGAAGGAGCGGCTAAGG - Intergenic
1049977822 9:876637-876659 CTCAGGAGGCTGAGTGGGGAAGG - Intronic
1050351197 9:4741874-4741896 CAGAGGAGGAGGAGGAAGGAGGG - Intronic
1050486038 9:6135554-6135576 CTTAGGAGGAGGAGAGGGAGAGG - Intergenic
1050747393 9:8892173-8892195 CTGAGGAAAAGCAGCGTGGATGG - Intronic
1051414588 9:16825612-16825634 CTGGGGAGGAGGAGGAGGGGAGG + Intronic
1051438077 9:17053942-17053964 CTCAGGAGGCTGAGCTGGGAGGG + Intergenic
1052915596 9:33922600-33922622 CTGAGGAAGAGGAGAAGGGAAGG + Intronic
1053003655 9:34590968-34590990 CTGAGGGCGAGGAGAAGGGAGGG + Intergenic
1053090193 9:35268198-35268220 CCCAGGAGGTGGAGAGGGGAAGG + Intronic
1053382467 9:37660158-37660180 CTGGGGAGGAGAGGCGGGGAGGG + Intronic
1053401746 9:37830529-37830551 CTGGGGAGGAAGAGAAGGGAAGG + Intronic
1053489194 9:38487091-38487113 CATCGGAGGAGGAGCTGGGAAGG + Intergenic
1053503378 9:38620807-38620829 CTTCGGAGGAGGAGCGGGTCGGG - Intergenic
1053656586 9:40222915-40222937 CTTCTGAGGAGGAGCGGGGCGGG + Intergenic
1053885926 9:42645213-42645235 CTGAGCAGTAGGAGGGGGGCTGG + Intergenic
1053906940 9:42852137-42852159 CTTCCGAGGAGGAGCGGGGTGGG + Intergenic
1054224944 9:62452662-62452684 CTGAGCAGTAGGAGGGGGGCTGG + Intergenic
1054357005 9:64071362-64071384 CTTCCGAGGAGGAGCGGGGCGGG + Intergenic
1054368690 9:64369137-64369159 CTTCCGAGGAGGAGCGGGGCGGG + Intergenic
1054452868 9:65412785-65412807 CTGGGGAAGAGCAGCTGGGAGGG - Intergenic
1054528029 9:66153370-66153392 CTTCCGAGGAGGAGCGGGGCGGG - Intergenic
1054673797 9:67833528-67833550 GTGACGAGGAGGAGAAGGGAGGG + Intergenic
1054676319 9:67858889-67858911 CTTCTGAGGAGGAGCGGGGCGGG + Intergenic
1054850663 9:69843498-69843520 AGGAGGAGGAGGAGGGGGGGAGG - Intronic
1054918705 9:70520460-70520482 CTGTGGAGGAGGATGGGCGAGGG + Intergenic
1054935904 9:70687253-70687275 TTGAGGATGAGGAGCAGGAAGGG + Intronic
1056240100 9:84636736-84636758 AAGAGGAGGAGGAGGAGGGAGGG - Intergenic
1056552628 9:87664196-87664218 CTGAAGGGGAGAAGAGGGGAAGG - Intronic
1056817429 9:89811821-89811843 GTGGGGAGGAGGGCCGGGGATGG + Intergenic
1056834394 9:89942882-89942904 CTGAGGAAGCGCAGCGGGGCTGG + Intergenic
1057152757 9:92809103-92809125 CTTTGGAGGAGGAGCGGGGCGGG + Intergenic
1057211808 9:93204588-93204610 CTGAGGGGCAGGGGTGGGGAAGG + Intronic
1057489353 9:95509241-95509263 AAGAGGAGGAGGGGAGGGGAGGG + Intronic
1057497383 9:95571874-95571896 GGGAGGAGGAGGAGAGGGGGAGG + Intergenic
1057509945 9:95669692-95669714 TTGAGGAGGGTGAGAGGGGAGGG + Intergenic
1057669548 9:97076405-97076427 CATTGGAGGAGGAGCTGGGAAGG + Intergenic
1057844055 9:98508274-98508296 CTGGGGAGGAGGAGCCAAGATGG + Intronic
1058228741 9:102399218-102399240 CTGAAGAGGGGGAGTGGGGAAGG + Intergenic
1058695600 9:107556619-107556641 CTGAGGAGGAGGAGGAAGCAGGG - Intergenic
1059384165 9:113950976-113950998 CTGAGGAGGAGGAGTGGGAGGGG + Intronic
1059426934 9:114227111-114227133 CTAAGGAGGAAGAGCAGGGCAGG + Intronic
1059609761 9:115879643-115879665 ATTAGAGGGAGGAGCGGGGAAGG - Intergenic
1059767094 9:117393869-117393891 AGGAGGAGGAGGAGATGGGAAGG + Intronic
1060225303 9:121786661-121786683 ATGTGGAGGATGAGCAGGGAAGG - Intergenic
1060658396 9:125388362-125388384 CTGGGGAGGAGGTGCTGGGAGGG - Intergenic
1060819341 9:126652284-126652306 CTGAGGAGGAGAAGGGGGGGGGG + Intronic
1060926236 9:127457263-127457285 CTGAGGAAGAGCAGCAGGCAGGG - Intronic
1061217454 9:129230026-129230048 ATGAAGAGGAGGAACTGGGAAGG + Intergenic
1061222139 9:129258493-129258515 CGGAGCAGGAGGGGCCGGGAGGG - Intergenic
1061374487 9:130215932-130215954 GGGAGGAGGAGGATGGGGGAGGG - Intronic
1061437064 9:130570612-130570634 CTCAGGAGGATGAGGTGGGAGGG + Intergenic
1061625477 9:131838554-131838576 CAGAGGCTGAGGAGTGGGGAAGG - Intergenic
1061716240 9:132520133-132520155 CTGAGTGAGAGGAGAGGGGAGGG - Intronic
1061947165 9:133914785-133914807 GAGAGGAGGAGGAGAGGGGAAGG + Intronic
1062024098 9:134332514-134332536 CTGTGGAGGAGGGGTGGGGGAGG + Intronic
1062074763 9:134579830-134579852 AGGGGGAGAAGGAGCGGGGAGGG + Intergenic
1062194135 9:135263887-135263909 GGAAGGAGGAGGAGAGGGGAAGG - Intergenic
1062302016 9:135879087-135879109 ATGAGGAGGAGGGGAGTGGAGGG + Intronic
1062380376 9:136284109-136284131 CCCAGCAGGAGGAGAGGGGAGGG + Intronic
1203696978 Un_GL000214v1:108660-108682 CTTCGGAGGAGGAGAGGGGCGGG - Intergenic
1203748544 Un_GL000218v1:58101-58123 CTTCCGAGGAGGAGCGGGGCGGG + Intergenic
1203475222 Un_GL000220v1:144360-144382 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1203366287 Un_KI270442v1:260012-260034 GTGAGGTGGGGGAGGGGGGAAGG + Intergenic
1203552235 Un_KI270743v1:172369-172391 CTTCGGAGGAGGAGAGGGGCAGG + Intergenic
1203561176 Un_KI270744v1:59919-59941 CTTCCGAGGAGGAGCGGGGCGGG - Intergenic
1185449521 X:275096-275118 GGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1185449569 X:275242-275264 GGGAGGAGGAGCAGGGGGGAGGG + Intergenic
1185459824 X:328859-328881 GAGAGGAGGGGGAGGGGGGAGGG - Intergenic
1185523726 X:761075-761097 AAGAGGAGGAGGAGGAGGGAAGG - Intergenic
1185640964 X:1588800-1588822 CGAAGGGGGAGGAGAGGGGAGGG - Intergenic
1185662049 X:1735643-1735665 AGGAGGAGGGGGAGGGGGGAAGG - Intergenic
1185953332 X:4460824-4460846 AGGAGGAGGAGGAGAGGGGAAGG - Intergenic
1186363746 X:8870391-8870413 ATGTGGAGGAGGAGCAGGAAAGG + Intergenic
1186410667 X:9342456-9342478 CGGAGGAGGAGGGGGGAGGAGGG - Intergenic
1186414884 X:9374563-9374585 CTGAGGAGGCTGAGGTGGGAGGG - Intergenic
1186653892 X:11592150-11592172 CAGAGGAGGAAGATGGGGGAAGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187358269 X:18599559-18599581 CTCAGGAGGATGAGGTGGGAGGG - Intronic
1187365432 X:18662443-18662465 GTGGGGTGGGGGAGCGGGGAGGG - Intronic
1187464581 X:19515563-19515585 CGGCGGGGCAGGAGCGGGGAGGG + Intergenic
1187811059 X:23177378-23177400 CTGAGGATTAGGATTGGGGATGG + Intergenic
1188296331 X:28454159-28454181 GTGGGGTGGGGGAGCGGGGAGGG + Intergenic
1188348099 X:29093323-29093345 CAGAGCAGGAGGAGGGGGGTGGG + Intronic
1188539952 X:31238699-31238721 CTGTAGCGGAGAAGCGGGGAAGG - Intronic
1188732953 X:33674554-33674576 CTTGGGAGGAAGAGTGGGGATGG - Intergenic
1189171213 X:38911489-38911511 GTGGGGTGGGGGAGCGGGGAGGG + Intergenic
1189256323 X:39642508-39642530 ATGAGGAGGAGGAGTAGGGAGGG + Intergenic
1189280465 X:39817242-39817264 TTGAGGTGGTGGAGCCGGGAGGG + Intergenic
1189348495 X:40260207-40260229 CAGAGGAGGCGGGGCGGGGGAGG - Intergenic
1189578676 X:42382866-42382888 TTGGGGAGGAAGAGCAGGGATGG + Intergenic
1189668118 X:43379118-43379140 ATGAGAGGGAGGAGAGGGGAGGG + Intergenic
1189746091 X:44170428-44170450 CAGAGGAGGAGGAGGAGGCAGGG + Intronic
1189935363 X:46062506-46062528 CTGGGGAGCAGGAATGGGGAAGG - Intergenic
1190509660 X:51162594-51162616 CAGAGGAGGAGCAGGGAGGAAGG - Intergenic
1190597974 X:52065764-52065786 CTGTGGGGGAAGAGCGGGCATGG - Intronic
1190610850 X:52188309-52188331 CTGTGGGGGAAGAGCGGGCATGG + Intronic
1190733761 X:53241752-53241774 CTGTGGGGGAGGAGATGGGAGGG - Intronic
1190789045 X:53682856-53682878 CTGAGGGGGAGGAATGAGGAAGG + Intronic
1190813609 X:53908538-53908560 CTCAGGAGGCTGAGCTGGGAGGG + Intergenic
1190881636 X:54495945-54495967 CGGGGGCGGAGGAGAGGGGAGGG + Exonic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191037887 X:56047407-56047429 GTGAGGTGGGGGAGGGGGGAGGG - Intergenic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1191675126 X:63785248-63785270 CTGTGGAGGAGGGGCGGCGGAGG - Intronic
1192142390 X:68656857-68656879 GTGGGGTGGAGGAGGGGGGAGGG + Intronic
1192172388 X:68865145-68865167 CTGAGGTGGGGGAGAGGGGAGGG - Intergenic
1192205195 X:69091230-69091252 CTGAGGTGTAGGAGTGGGTATGG - Intergenic
1192589404 X:72347346-72347368 GTAAGGAGGAGGAGGAGGGAAGG - Intronic
1193896050 X:87116303-87116325 CAGAGGAGGAGGAGCCAAGATGG + Intergenic
1193952741 X:87821404-87821426 CTCAGGAGGAGGAGCCAAGATGG + Intergenic
1194095810 X:89637278-89637300 TTGAGTGGGGGGAGCGGGGAGGG - Intergenic
1194558549 X:95393105-95393127 CTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1194992905 X:100564048-100564070 AGGAGGAGGAGGAGTGGGGGAGG + Intergenic
1195455506 X:105064767-105064789 CTGAGGAGGAGGAAAAGGGAAGG + Intronic
1195696230 X:107669608-107669630 AGGAGGAGGAGGAGGGGGAAGGG - Intergenic
1195873636 X:109514581-109514603 CTGAGGAGGAGGAAGAGGAAGGG + Intergenic
1195875384 X:109535236-109535258 AGGAGGAGGAGGGGAGGGGAGGG + Intergenic
1196230837 X:113219117-113219139 CTGAGGTGGAGGAGGAGAGAAGG - Intergenic
1196828405 X:119758496-119758518 AGGAGGAGGAGGAGGAGGGAGGG - Intergenic
1196852355 X:119949501-119949523 CTGTGGAGGTGGAGTGGGGCAGG - Intergenic
1196862291 X:120039716-120039738 CTGAGGAGGAGGAGCAAGGTGGG - Intergenic
1196880811 X:120196628-120196650 CTGAGGAGGAGGAGCAAGGTGGG + Intergenic
1197515606 X:127423973-127423995 CTGAGGAGGAGGAGGACAGAGGG - Intergenic
1198221088 X:134603196-134603218 CTGAGGAGTGGGACTGGGGATGG + Intronic
1198267289 X:135021749-135021771 CTGGTGAGGAGGAGGGGGGTTGG + Exonic
1198638688 X:138730185-138730207 GTGGGGTGGAGGAGGGGGGAAGG + Intronic
1198807452 X:140505370-140505392 CTGAGGAGGTGACGGGGGGAGGG + Exonic
1199599776 X:149535056-149535078 ATGAGGAGGAGGAGAGGAGAAGG - Intergenic
1199650863 X:149945191-149945213 ATGAGGAGGAGGAGAGGAGAAGG + Intergenic
1199747682 X:150784256-150784278 GAGGGGAGGAGAAGCGGGGAGGG - Intronic
1199973799 X:152879622-152879644 GTGAGGAGGAGGTGCAGGGCTGG + Intergenic
1200072324 X:153535410-153535432 CTGAGGAGGAGAGGAGGAGAGGG - Intronic
1200120534 X:153788169-153788191 CTGCTGAGGTGGGGCGGGGATGG - Intronic
1200145684 X:153925639-153925661 CTGAGGGGGAGCAGAGGCGAGGG - Intronic
1200223336 X:154402930-154402952 CCGAGGAGGAGGTGAAGGGATGG - Exonic
1200762125 Y:7049022-7049044 GTGGGGTGGGGGAGCGGGGAGGG - Intronic
1200897146 Y:8387918-8387940 GTGGGGTGGGGGAGCGGGGAAGG - Intergenic
1200977149 Y:9225610-9225632 GTGAGGTGGGGGAGGGGGGAGGG - Intergenic
1201415085 Y:13740862-13740884 GTGAGGTGGGGGAGGGGGGAGGG - Intergenic
1201461743 Y:14233035-14233057 ATGAGGAGGAGGAGGGGGAGGGG - Intergenic
1201567748 Y:15384456-15384478 CTCAGGAGGAGGAAGGAGGATGG - Intergenic
1202196924 Y:22306665-22306687 CAGAGGCAGAGGAGCGGGAAGGG - Intergenic
1202274381 Y:23100271-23100293 AAGAGGAGGAGGAGGAGGGAGGG - Intergenic
1202291646 Y:23320400-23320422 AAGAGGAGGAGGAGGAGGGAGGG + Intergenic
1202296563 Y:23364650-23364672 CTAAGGAGGAGGAGAAGGAAGGG - Intergenic
1202427374 Y:24734022-24734044 AAGAGGAGGAGGAGGAGGGAGGG - Intergenic
1202443417 Y:24936072-24936094 AAGAGGAGGAGGAGGAGGGAGGG + Intergenic
1202574244 Y:26305947-26305969 CTAAGGAGGAGGAGAAGGAAGGG + Intergenic