ID: 1091678539

View in Genome Browser
Species Human (GRCh38)
Location 12:2509638-2509660
Sequence CTGTGTCACTATGCGTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091678539_1091678546 4 Left 1091678539 12:2509638-2509660 CCCTCCTACGCATAGTGACACAG 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1091678546 12:2509665-2509687 GCACTTCAGCATTATGCTTGGGG 0: 2
1: 40
2: 80
3: 129
4: 260
1091678539_1091678545 3 Left 1091678539 12:2509638-2509660 CCCTCCTACGCATAGTGACACAG 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1091678545 12:2509664-2509686 GGCACTTCAGCATTATGCTTGGG 0: 1
1: 6
2: 50
3: 109
4: 248
1091678539_1091678544 2 Left 1091678539 12:2509638-2509660 CCCTCCTACGCATAGTGACACAG 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1091678544 12:2509663-2509685 CGGCACTTCAGCATTATGCTTGG 0: 1
1: 5
2: 40
3: 86
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091678539 Original CRISPR CTGTGTCACTATGCGTAGGA GGG (reversed) Intronic
900907044 1:5566583-5566605 CGGTGTCATTATTTGTAGGATGG + Intergenic
906607114 1:47180332-47180354 ATGTGTCACTCTGAGTATGACGG + Intergenic
909264812 1:73543294-73543316 CTGTGAAAGTATGCGTTGGATGG - Intergenic
918070059 1:181128130-181128152 CTGTCTCACTATGGGCAGGGTGG + Intergenic
1067800121 10:49353038-49353060 CTGTGTCACCATGTGTATGAGGG - Intergenic
1067967610 10:50930312-50930334 CTGTGTCATAATACGTTGGATGG + Intergenic
1069475416 10:68727866-68727888 CTGTCTCACTCTGCCTAGGCTGG + Intronic
1072029968 10:91509650-91509672 CTGTGTTAGTTTGCTTAGGATGG - Intronic
1073300251 10:102466848-102466870 CTCTGTCACTATCCTTAGCAGGG - Intronic
1074252738 10:111768874-111768896 ATGTGTCACTAGACCTAGGAGGG - Intergenic
1078471371 11:11589665-11589687 CTGTGTCACTCTCCCCAGGAGGG - Intronic
1085905421 11:80755265-80755287 CTGTGTCACTCTTCATAAGACGG + Intergenic
1089038574 11:115423444-115423466 CTCTGTCACCATGCATAGTAAGG - Intronic
1089226564 11:116928420-116928442 CTGTCTCAGGATGCTTAGGATGG - Intronic
1091678539 12:2509638-2509660 CTGTGTCACTATGCGTAGGAGGG - Intronic
1092564488 12:9649742-9649764 CTGTCTCAGTATTAGTAGGAGGG + Intergenic
1093500746 12:19809369-19809391 CTGTGTTAATTTGCTTAGGATGG - Intergenic
1094057165 12:26279361-26279383 CTTTGCCACTATGAGGAGGATGG + Intronic
1102347396 12:112168753-112168775 CAGTTTCCCTATGTGTAGGATGG + Intronic
1108526613 13:51291011-51291033 CTGTGTCCCTATTCAGAGGAGGG + Intergenic
1111320436 13:86620995-86621017 CTGTGTTACTTTGCTCAGGATGG - Intergenic
1111642447 13:90986080-90986102 CTTTATCACGATGTGTAGGACGG + Intergenic
1114455340 14:22850034-22850056 CTGTGTCACTGTGTGTTGTAAGG - Intergenic
1117025702 14:51617812-51617834 CTGTTTCACTATCTGTAGAAGGG + Intronic
1117824799 14:59690218-59690240 CTGTGTCATTATGTGTGAGATGG - Intronic
1118308182 14:64673593-64673615 CTGTGTCTCTAGGGGTGGGAAGG - Intergenic
1130915747 15:88303213-88303235 CTGAGTCACTGCGCATAGGAGGG - Intergenic
1135089833 16:19504617-19504639 CTGTGACACTATGCTGAGCAAGG - Intronic
1135526366 16:23216306-23216328 CTGTGTCACTTTGGGTGGGGAGG + Exonic
1139572963 16:67824862-67824884 GTGTGTCACTCTCCGTAGAAAGG - Intronic
1142398740 16:89848165-89848187 CTCTGTCACTGTGCCCAGGAGGG + Intronic
1150046384 17:61917503-61917525 CTGTGTTAATTTGCCTAGGATGG - Intronic
1153309711 18:3666154-3666176 CTGGGTCTTTCTGCGTAGGAAGG - Intronic
1159695056 18:71546678-71546700 CTGTGTCAGTTTGCTGAGGATGG - Intergenic
1161212238 19:3073254-3073276 CTGTGTCACTGTGCATAGCTGGG + Intergenic
1161692361 19:5743772-5743794 CTGTCTCACTATCCCTAGGTGGG + Intronic
929131070 2:38572363-38572385 GTGAGTCACTATGCGTGGGAGGG - Intronic
935601804 2:104929644-104929666 CTCTGTCACTAAGTGAAGGAGGG + Intergenic
937819168 2:126288360-126288382 CTGTGTCACTGTGGCAAGGAGGG + Intergenic
945920416 2:215749680-215749702 CTGTGTCACTATGGAGAAGAAGG - Intergenic
1169261535 20:4142320-4142342 CTGAATCACTATGTGGAGGAAGG + Intronic
1170393395 20:15900752-15900774 CTGTTTCTCTATGGGTATGAGGG - Intronic
1170993046 20:21322912-21322934 CTGAGTAACAATGCCTAGGAAGG - Intronic
1173390945 20:42632133-42632155 GTGTGTGACAATGCATAGGAAGG - Intronic
1175298084 20:57923184-57923206 CTTTGTCACTTTGGGTAGGCGGG - Intergenic
1182786888 22:32915486-32915508 CTGTGTTATTCTGGGTAGGATGG + Intronic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
950235818 3:11319440-11319462 CTGTGTCCTCATGTGTAGGATGG + Intronic
951993013 3:28697035-28697057 ATCTTTCACCATGCGTAGGATGG + Intergenic
955498112 3:59557519-59557541 CTGTGAAACTCTGCGTATGAGGG + Intergenic
956749154 3:72332543-72332565 CTGGGTCATTGTGAGTAGGAAGG - Intergenic
959533104 3:107456034-107456056 CTGTTTCACTATGTCTGGGACGG - Intergenic
961050330 3:123740126-123740148 CTGTGTCACTATGGATACTATGG + Intronic
962048318 3:131785035-131785057 CTGTGTCTATATGTGTAGAATGG + Intronic
969293473 4:6255319-6255341 CTGAGTCACCATGTGGAGGAAGG - Intergenic
970133280 4:12894372-12894394 CTGTGTCCCTGTGCCTAGCATGG + Intergenic
977402976 4:96557962-96557984 CTGTCTCACTATGTGTAGTAGGG + Intergenic
977746340 4:100552113-100552135 TTTTGTCACTATGTGTATGAGGG + Intronic
980861025 4:138499859-138499881 CTGTGGTACTATAGGTAGGATGG + Intergenic
988426008 5:31065475-31065497 CTATGTCACTATGCACAGGATGG + Intergenic
998150014 5:139751438-139751460 CTGTGTGAGTATGTGTAGGTGGG - Intergenic
998821329 5:146060265-146060287 CTGAGACACTATGCATAGTACGG - Intronic
1003191302 6:3877742-3877764 CTGTGTCCTTATGTGGAGGAAGG + Intergenic
1005368593 6:25106033-25106055 CAATAGCACTATGCGTAGGAAGG - Intergenic
1005889697 6:30127157-30127179 CTGTTTCCCTATCCGTAGAATGG + Intergenic
1007250449 6:40491462-40491484 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007250476 6:40491654-40491676 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007250529 6:40492048-40492070 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1010262417 6:73831760-73831782 ATGTGTAACTTTGGGTAGGAAGG + Intergenic
1017038693 6:150290021-150290043 CTGTGACACCATGCTTAAGAGGG + Intergenic
1018188398 6:161287712-161287734 CGATGTCACTATGAATAGGAGGG + Intergenic
1018716090 6:166533649-166533671 CTGAGTCACTGTGTGGAGGATGG + Intronic
1024695658 7:51854273-51854295 CTGTGTCACTTTTCATTGGATGG + Intergenic
1027998935 7:85466504-85466526 CTGAGTCACTAGGGGTAGGGTGG + Intergenic
1030910867 7:115247219-115247241 CTGTGTTACTTTGCTGAGGAGGG + Intergenic
1034193953 7:149231611-149231633 CTTTGACACTATATGTAGGATGG - Intergenic
1034358711 7:150475149-150475171 CTGTGTTAGTCTGCTTAGGATGG + Intronic
1038000728 8:23389241-23389263 CTGAGTCAGTCTGCCTAGGAAGG + Intronic
1038148492 8:24920271-24920293 CTGTGTCACTTTGCGTGTCATGG - Intergenic
1043245903 8:78000727-78000749 GTGTGTCACCATGCGGTGGAAGG + Intergenic
1045209906 8:100086434-100086456 CTGTGTTAATTTGCTTAGGAGGG - Intronic
1045718878 8:105082194-105082216 GTGTGTCACTCTGAGTAGCACGG + Intronic
1046899433 8:119508151-119508173 CTGTGTAACAAGGGGTAGGAAGG + Intergenic
1052677277 9:31643629-31643651 CTATGTCACTATACATAGAAAGG + Intergenic
1053507826 9:38659814-38659836 CTGTGTCAGTTTGGGGAGGAAGG + Intergenic
1191940471 X:66474915-66474937 CTATGTTACCATGCTTAGGAGGG - Intergenic
1197620332 X:128740875-128740897 CTGTATCACTTAGCGAAGGAAGG - Intergenic
1200853905 Y:7916745-7916767 TTGTGTCACTTTGAGTAGCATGG - Intergenic