ID: 1091678788

View in Genome Browser
Species Human (GRCh38)
Location 12:2511255-2511277
Sequence CTTTATGGTGAGATGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 392}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091678788_1091678793 12 Left 1091678788 12:2511255-2511277 CCCAACTCCATCTCACCATAAAG 0: 1
1: 0
2: 3
3: 35
4: 392
Right 1091678793 12:2511290-2511312 GAAATTAGTGCTCTCCCAAGTGG 0: 1
1: 0
2: 0
3: 7
4: 106
1091678788_1091678794 18 Left 1091678788 12:2511255-2511277 CCCAACTCCATCTCACCATAAAG 0: 1
1: 0
2: 3
3: 35
4: 392
Right 1091678794 12:2511296-2511318 AGTGCTCTCCCAAGTGGCACAGG 0: 1
1: 0
2: 1
3: 12
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091678788 Original CRISPR CTTTATGGTGAGATGGAGTT GGG (reversed) Intronic
900268409 1:1773028-1773050 TTTTTTTTTGAGATGGAGTTTGG - Intronic
901003881 1:6162373-6162395 TTTTTTTTTGAGATGGAGTTTGG - Intronic
901200909 1:7466958-7466980 CTTGCTGGTGAGATGGAGAAAGG - Intronic
901719164 1:11181511-11181533 ATTTATTTTGAGATGGAGTCTGG - Intronic
902165906 1:14571627-14571649 CTTTATAGGGGGATGGAGTGGGG - Intergenic
903201119 1:21739921-21739943 CTTTTTTTTGAGATGGAGTTTGG + Intronic
903428738 1:23275061-23275083 CTTTGTTTTGAGATGGAGTCTGG - Intergenic
903616623 1:24664005-24664027 TTTTTTGTTGAGATGGAGTCTGG + Intronic
903814728 1:26056768-26056790 TTTTTTTTTGAGATGGAGTTTGG + Intronic
903955864 1:27025156-27025178 ATTTATTTTGAGATGGAGTCTGG + Intergenic
904997702 1:34643829-34643851 CTTGATGATGAGGTGGACTTAGG - Intergenic
906918227 1:50034925-50034947 CTTTATGGGGTGATGGAGCCAGG - Intergenic
907431770 1:54416358-54416380 CCTTATGGTGAGGTGGAGGGTGG - Intergenic
907439427 1:54469905-54469927 TTTTATTTTGAGATGGAGTCTGG + Intergenic
907862342 1:58365665-58365687 GTTGATGTTGAGACGGAGTTTGG - Intronic
908265962 1:62379558-62379580 ATTTATTTTGAGATGGAGTTTGG - Intergenic
909070842 1:70991697-70991719 CTTAATGATGAGTTAGAGTTAGG - Intronic
909784012 1:79586678-79586700 CTTTAAGGTGAGATGGGAATGGG + Intergenic
910091102 1:83465279-83465301 GTTGTTGTTGAGATGGAGTTTGG + Intergenic
910388247 1:86707657-86707679 TTTTTTTTTGAGATGGAGTTTGG + Intronic
910959596 1:92747700-92747722 TTTTTTGGTGAGATGGAGTCTGG - Intronic
912367285 1:109144729-109144751 TTTTTTATTGAGATGGAGTTTGG - Intronic
914791921 1:150885878-150885900 TTTTTTTGTGAGATGGAGTCTGG + Intergenic
914818363 1:151080202-151080224 TTTTTTTTTGAGATGGAGTTTGG - Intronic
914999182 1:152572680-152572702 TTTGAGGGTGACATGGAGTTTGG - Intronic
914999621 1:152577090-152577112 CTTTCAGGTGATATGCAGTTAGG + Intronic
915883770 1:159701582-159701604 CTTGAGGGTGAGATGGAGCAGGG + Intergenic
917734086 1:177904695-177904717 CTTCATGGGGACATGGAGGTAGG - Intergenic
917877102 1:179295814-179295836 TTTTTTTTTGAGATGGAGTTTGG + Intronic
918270975 1:182898846-182898868 TTTTTTGGGGAGATGGAGTTTGG - Intergenic
918300748 1:183201473-183201495 TGTTATGGGGAAATGGAGTTAGG - Intronic
918313969 1:183307315-183307337 TTTTTTTTTGAGATGGAGTTTGG + Intronic
918494772 1:185122431-185122453 TTTTTTTTTGAGATGGAGTTTGG + Intronic
918501889 1:185205982-185206004 TTTTTTTTTGAGATGGAGTTTGG + Intronic
921126008 1:212178737-212178759 GTTTTTGGTGAGAGGGAGGTGGG - Intergenic
922332754 1:224591756-224591778 CTTTAGAGTCAGATGGATTTGGG + Intronic
923702494 1:236313338-236313360 TTTTTTGGTGAGATGGAGTCTGG - Intergenic
923707332 1:236354813-236354835 CTTTAAACTGAGATGGAATTTGG - Intronic
923712398 1:236397653-236397675 CTTTAGAGAGAGATGGATTTGGG + Intronic
923812220 1:237331512-237331534 CTTTTTTTTGAGATGGAGTCTGG + Intronic
923890842 1:238213818-238213840 ATTAATGCTGAAATGGAGTTTGG - Intergenic
924747220 1:246847276-246847298 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1063482436 10:6387739-6387761 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1065047460 10:21757252-21757274 CTGTAGGGTGGGATGGAGGTGGG - Intronic
1065154340 10:22854045-22854067 CTTTGTGATGAGATGCAGTGAGG + Intergenic
1065903032 10:30225005-30225027 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
1065950674 10:30647856-30647878 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1066599658 10:37091306-37091328 CTTTTTAGTAGGATGGAGTTAGG - Intergenic
1069361388 10:67646582-67646604 CTTTTTTGTGAGATGGATGTGGG - Intronic
1069441012 10:68428019-68428041 TTTTTTTCTGAGATGGAGTTTGG - Intronic
1069802002 10:71087544-71087566 CGTTTTGGTGAGAGGGAGTGAGG + Intergenic
1070233280 10:74595163-74595185 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1070353387 10:75614918-75614940 CTCCCTGGGGAGATGGAGTTAGG + Intronic
1070958826 10:80484493-80484515 CTTTTTGTAGAGATGGTGTTTGG + Intronic
1072558314 10:96543344-96543366 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1073145684 10:101280012-101280034 TTTTTTAGTGAGATGGGGTTTGG + Intergenic
1073401756 10:103263159-103263181 CTATATGGTGATACGGAGTTTGG - Intergenic
1074099754 10:110345568-110345590 CTTGAGGGTAGGATGGAGTTGGG - Intergenic
1074131706 10:110585021-110585043 TTTTTTTTTGAGATGGAGTTTGG + Intronic
1074724287 10:116291579-116291601 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1075200652 10:120400972-120400994 CTTTATGGTGAGATTGTTCTGGG - Intergenic
1075416250 10:122266728-122266750 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1075843047 10:125520638-125520660 ATTGATGAGGAGATGGAGTTTGG + Intergenic
1076579121 10:131495078-131495100 CTTTATGGAGAGAAGGTGTATGG + Intergenic
1077055531 11:590712-590734 TTTTTTTTTGAGATGGAGTTTGG + Intronic
1078405601 11:11067699-11067721 CTCTCTGGTGGGATGGGGTTGGG + Intergenic
1079319524 11:19440369-19440391 CTTCAGGATGAGTTGGAGTTAGG + Intronic
1081323272 11:41716630-41716652 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
1082824089 11:57565540-57565562 CTTTTTGTAGAGATGGGGTTTGG + Intronic
1083303611 11:61751840-61751862 TTTTTTTTTGAGATGGAGTTCGG - Intergenic
1083355611 11:62063938-62063960 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
1083791841 11:64990800-64990822 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1084283000 11:68111399-68111421 TTTTTTCTTGAGATGGAGTTTGG - Intronic
1085052974 11:73389175-73389197 CCTTATGGTGAGCTGGGGATGGG + Exonic
1085387603 11:76165906-76165928 TTTTATTTTGAGATGGAGTAGGG + Intergenic
1086258856 11:84913374-84913396 CTTTGAGATGAGATGCAGTTGGG - Intronic
1086989809 11:93290481-93290503 CTTTCTTGTGGGAAGGAGTTGGG + Intergenic
1087448919 11:98292523-98292545 CATTATGGGGAGATGGAGTTTGG - Intergenic
1088299600 11:108342532-108342554 CTTGATGGTGGGAGGGACTTAGG + Intronic
1089330558 11:117686166-117686188 CTATGTGGAGAGATGGAGCTGGG + Intronic
1089575812 11:119442193-119442215 CTTTATGGAGTGATACAGTTTGG - Intergenic
1090126974 11:124096576-124096598 GATTATGGTGGGATGGAGATGGG + Intergenic
1090798080 11:130152698-130152720 TTTTATTTTGAGATGGAGTTTGG - Intergenic
1090986482 11:131771184-131771206 CTTTATGGTGAGATGGAGGCAGG - Intronic
1091544592 12:1493029-1493051 CTTTATGGTGACATTGGTTTGGG - Exonic
1091678788 12:2511255-2511277 CTTTATGGTGAGATGGAGTTGGG - Intronic
1092052161 12:5479691-5479713 TTTTGGGGAGAGATGGAGTTAGG - Intronic
1092368365 12:7895932-7895954 TTTTATTTTGAGATGGAGTCTGG + Intergenic
1092740869 12:11628202-11628224 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1092778277 12:11962753-11962775 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
1092916502 12:13194334-13194356 CTTTAAGGTGAAATGGAGGCAGG + Intergenic
1093126257 12:15331770-15331792 CTTTGTGGTGACATGAATTTGGG + Intronic
1095461528 12:42449409-42449431 CTGCATGGTGAGATGAAGTGAGG - Intronic
1096203661 12:49704697-49704719 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1096280571 12:50249267-50249289 CTTTAAGGTGAGACAGACTTCGG + Intronic
1096645529 12:53032676-53032698 TTTTTTTTTGAGATGGAGTTTGG + Intronic
1099538549 12:83875837-83875859 ATTTATTTTGAGATGGAGTTTGG + Intergenic
1100281379 12:93121265-93121287 TTTTTTTGTGAGATGGAGTCTGG - Intergenic
1101388057 12:104275265-104275287 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1101824574 12:108210128-108210150 CTGTATGGCGGGCTGGAGTTCGG + Exonic
1102335390 12:112074328-112074350 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1102672064 12:114628581-114628603 CTTTGTGGGGAGATTGAGATAGG + Intergenic
1102691067 12:114761575-114761597 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
1103878509 12:124148082-124148104 TTTTGTTTTGAGATGGAGTTTGG + Intronic
1104710928 12:130985559-130985581 GTTTTTTTTGAGATGGAGTTTGG + Intronic
1105375756 13:19842947-19842969 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1105439499 13:20403463-20403485 CTCTATGGTCAGATGATGTTTGG - Intergenic
1105500260 13:20965672-20965694 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1105601661 13:21893261-21893283 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1106770308 13:32955255-32955277 TTTTTTGGTGAGACGGAGTCTGG + Intergenic
1106866326 13:33968137-33968159 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1106950575 13:34879391-34879413 CTATGTGGCGGGATGGAGTTGGG + Intergenic
1107177105 13:37411615-37411637 CTTGGTGGTCAGTTGGAGTTTGG + Intergenic
1107301510 13:38971042-38971064 TTTTTTTTTGAGATGGAGTTTGG + Intronic
1110214177 13:73007796-73007818 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1110526385 13:76543233-76543255 CATCATGGTGATATGGAGTGGGG - Intergenic
1110757463 13:79192395-79192417 CTTTGTGGTGGGATGGAATTTGG + Intergenic
1111960127 13:94801147-94801169 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
1112190046 13:97167974-97167996 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
1112413945 13:99188942-99188964 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
1113290370 13:108899410-108899432 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1113663726 13:112126167-112126189 CTTTTTGTTGAGACGGAGTTTGG - Intergenic
1114231244 14:20785159-20785181 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
1115213246 14:30989470-30989492 ATTTATTTTGAGATGGAGTCTGG + Intronic
1115256924 14:31412861-31412883 ATTTTTTTTGAGATGGAGTTTGG - Intronic
1115509709 14:34127576-34127598 TTTTTTGGTGAGATGGAGTCTGG - Intronic
1115533978 14:34355253-34355275 ATTAATGTTGAGATGGAGCTAGG - Intronic
1115994240 14:39178746-39178768 ATTTTTTTTGAGATGGAGTTTGG + Intronic
1116660693 14:47706747-47706769 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1116894840 14:50306061-50306083 TTTTTCGGTGAGATGGAGTCTGG + Intronic
1117416469 14:55501042-55501064 GTAGATGCTGAGATGGAGTTAGG + Intergenic
1119241402 14:73063159-73063181 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1120211019 14:81633964-81633986 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1120934180 14:89877049-89877071 TTTTTTTTTGAGATGGAGTTTGG + Intronic
1121199375 14:92104909-92104931 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1121407059 14:93725462-93725484 CTTGATGGAGGGGTGGAGTTGGG - Intronic
1122061595 14:99139893-99139915 CTTCCTGGTGGGATGGGGTTGGG - Intergenic
1122494926 14:102146479-102146501 CATGATGCTGAGATGAAGTTGGG + Intronic
1122669230 14:103357502-103357524 TTTTATGGGGAGATGGATCTGGG - Intergenic
1123461484 15:20476253-20476275 TTTTTTGGGGAGATGGAGTTTGG - Intergenic
1123656574 15:22524128-22524150 TTTTTTGGGGAGATGGAGTTTGG + Intergenic
1124310485 15:28619305-28619327 TTTTTTGGGGAGATGGAGTTTGG + Intergenic
1124395029 15:29293763-29293785 CTTAATGGAGAGATGGAGTGTGG + Intronic
1125673590 15:41490681-41490703 CTTTGTTTTGAGATGGAGTCTGG + Intergenic
1125955851 15:43790773-43790795 ATTTATTTTGAGATGGAGTCTGG + Intronic
1126641416 15:50830863-50830885 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
1126742954 15:51796784-51796806 CTGTATGATGAGATGAAGTGAGG + Intronic
1126760573 15:51966563-51966585 TTTTATGTTGGGATGGACTTTGG - Intronic
1126784400 15:52164614-52164636 ATTTATTTTGAGATGGAGTCTGG - Intronic
1127221433 15:56885224-56885246 CTTTATTGTGAGATGGAGGGAGG + Intronic
1127426368 15:58862837-58862859 CTTTATTTTGAGACAGAGTTTGG - Intergenic
1127878030 15:63128753-63128775 ATTTATTTTGAGATGGAGTCTGG + Intronic
1128052576 15:64676763-64676785 ATTTATTTTGAGATGGAGTCTGG + Intronic
1129114285 15:73356633-73356655 CTTTTTGATGGGATGGAGCTTGG + Intronic
1129233753 15:74211409-74211431 TTTTTTTTTGAGATGGAGTTTGG + Intronic
1129542156 15:76359216-76359238 CCTTATGGAGAGATGGGGCTGGG - Intronic
1129586545 15:76873237-76873259 CTTTTTCGGGAGATGGAGTCTGG - Intronic
1130337440 15:82968791-82968813 CTTTATTTTGAGAGGGAGTGTGG + Intronic
1131587584 15:93712869-93712891 CTATTTGGTGAAAAGGAGTTGGG + Intergenic
1132455845 16:22430-22452 CTTTTTTTTGAGATGGAGTTTGG + Intergenic
1133806529 16:9129595-9129617 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
1134351898 16:13445285-13445307 CTTTGTGCTGAGATTGTGTTAGG - Intergenic
1134470589 16:14521789-14521811 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1134604652 16:15560779-15560801 TTTTATTTTGAGATGGAGTCTGG - Intronic
1134825736 16:17282631-17282653 CTTTAAGGAGAGAAGGAGCTGGG + Intronic
1135685994 16:24498793-24498815 TTTGATGGTGAGGTGGAGATTGG - Intergenic
1136557546 16:31016685-31016707 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1137317176 16:47337721-47337743 GTGTATGGTGAGATGCAGTGGGG + Intronic
1137884701 16:52090212-52090234 ATTTATGGAGAGAGAGAGTTGGG - Intergenic
1138187659 16:54988694-54988716 CTATTAGGTGAGAGGGAGTTTGG + Intergenic
1139196441 16:64924181-64924203 CTTTCTTGTGGGATGGAGTTAGG - Intergenic
1139838459 16:69859373-69859395 TTTTTTGTTGAGATGGGGTTTGG - Intronic
1140472056 16:75221369-75221391 TTTTTTCTTGAGATGGAGTTTGG + Intronic
1143197041 17:5083876-5083898 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1143828355 17:9630972-9630994 CTTTTTTTTGAGATGGAGTCTGG - Intronic
1144183716 17:12776232-12776254 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
1144886605 17:18467333-18467355 CTTTATGCTGAGATGGGATGAGG + Intergenic
1145025336 17:19464002-19464024 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
1145145607 17:20476975-20476997 CTTTATGCTGAGATGGGATGAGG - Intergenic
1147689599 17:42307261-42307283 CTTTATGGTCTGCTGGAGTGTGG + Intronic
1147973989 17:44237326-44237348 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1149242495 17:54666552-54666574 CTATATGGTAAGATGAAGTGAGG + Intergenic
1150663097 17:67103148-67103170 TTTTATGGAGGGATGGACTTTGG - Intronic
1150666332 17:67142327-67142349 TTTTTTGTAGAGATGGAGTTTGG - Intronic
1151263361 17:72934652-72934674 TTTTATTTTGAGATGGAGTGTGG - Intronic
1153203491 18:2670947-2670969 TTTTTTTTTGAGATGGAGTTTGG + Intronic
1154465590 18:14640992-14641014 GTTTTTGGGGAGATGGAGGTTGG - Intergenic
1155285957 18:24289431-24289453 TTTTTTTTTGAGATGGAGTTGGG + Intronic
1156518113 18:37698288-37698310 CTTTATTGTGAGAAGGACCTAGG - Intergenic
1156752405 18:40474930-40474952 TTTTCTCGAGAGATGGAGTTAGG - Intergenic
1157323111 18:46649154-46649176 CTTGCTGGTGAGCTGGAGCTTGG + Intronic
1158858842 18:61572040-61572062 ATTTATTTTGAGATGGAGTCAGG - Intergenic
1161094952 19:2384968-2384990 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
1161737416 19:5999993-6000015 TTTTTTCTTGAGATGGAGTTTGG + Intronic
1161970081 19:7573636-7573658 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
1163136699 19:15316578-15316600 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1163567040 19:18058134-18058156 CTTTTTTCTGAGACGGAGTTTGG - Intergenic
1164802766 19:31091357-31091379 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
1165004885 19:32796572-32796594 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1165498957 19:36172176-36172198 ATTTATTTTGAGATGGAGTCTGG - Intergenic
1166375615 19:42325459-42325481 CTTTATGGAGGGTTGGGGTTGGG + Intergenic
1166403903 19:42505445-42505467 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1167063490 19:47166563-47166585 CTATATGATGAAACGGAGTTGGG - Intronic
1167351556 19:48978234-48978256 GTTTATTTTGAGACGGAGTTTGG + Intronic
1167388697 19:49180181-49180203 ATTTGTCGTGACATGGAGTTAGG - Intronic
1167531920 19:50023194-50023216 CTTTTTTTTGAGATGGAGTTTGG + Intronic
1168091875 19:54091009-54091031 CTTTTTTATGAGATGGAGCTTGG + Intergenic
1168157036 19:54480078-54480100 ATTTATTTTGAGATGGAGTCTGG - Intergenic
1168498201 19:56871773-56871795 GTTTGTTTTGAGATGGAGTTTGG - Intergenic
925454355 2:4002423-4002445 TTTTATGTTGATATGGAGGTAGG + Intergenic
925598096 2:5577245-5577267 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
926211738 2:10876066-10876088 ATTTATTTTGAGATGGAGTTTGG + Intergenic
927084908 2:19665271-19665293 CTTTTTGGTAAGAAGGAATTTGG - Intergenic
928545864 2:32328728-32328750 ATTTATTTTGAGATGGAGTCTGG + Intergenic
929764503 2:44832923-44832945 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
929766248 2:44846228-44846250 CTTTATTTGGAGATGGAGTCTGG + Intergenic
930804052 2:55472287-55472309 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
931758219 2:65393341-65393363 CTTTTTTTTGAGATGGAGTCTGG + Intronic
932092103 2:68815460-68815482 TTTTTTTTTGAGATGGAGTTTGG + Intronic
932676228 2:73783741-73783763 ATTTTTTGTGAGATGGAGTCTGG - Intergenic
932676813 2:73788646-73788668 ATTTTTTGTGAGATGGAGTCTGG - Intronic
932677398 2:73793543-73793565 ATTTTTTGTGAGATGGAGTCTGG - Intronic
932677984 2:73798441-73798463 ATTTTTTGTGAGATGGAGTCTGG - Intronic
932678570 2:73803341-73803363 ATTTTTTGTGAGATGGAGTCTGG - Intronic
932679150 2:73808240-73808262 ATTTTTTGTGAGATGGAGTCTGG - Intronic
932905536 2:75746083-75746105 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
934970085 2:98756155-98756177 CTTTATGGGTAGTTGGATTTGGG + Intergenic
936011934 2:108930481-108930503 CTTGATGGTGGGATGGGGCTTGG - Intronic
938450319 2:131412873-131412895 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
939259102 2:139783947-139783969 TTTTATCCTTAGATGGAGTTGGG + Intergenic
939479987 2:142735908-142735930 CTTTTTTTTGAGATGGAGTTTGG + Intergenic
939643566 2:144669647-144669669 CTTTATCAGGAGATAGAGTTAGG + Intergenic
939681369 2:145138197-145138219 CTTTGGGGTTAGATGGACTTGGG - Intergenic
941351561 2:164443519-164443541 TTTTATGGAAAGATGGAGATTGG - Intergenic
941421349 2:165286205-165286227 TTTTTTGGTGAGTTTGAGTTGGG + Intronic
941612925 2:167683541-167683563 TTTTTTGTAGAGATGGAGTTTGG - Intergenic
942199358 2:173555255-173555277 GTTAATGCTGAGATGGAGCTAGG + Intergenic
943036470 2:182752126-182752148 CTTTATGGTCAGCTTAAGTTTGG + Exonic
943181368 2:184546468-184546490 ATTTAGGTTGAGATGGAGGTTGG - Intergenic
943966010 2:194333566-194333588 CTTTATTGTGACAAGGATTTTGG - Intergenic
944767495 2:202879430-202879452 CTTTATTTTGAGATAGAGTCTGG + Exonic
945043295 2:205760589-205760611 TTTTATCGTGAGAGGGAGATGGG + Intronic
945906050 2:215594464-215594486 TTTTTTGTAGAGATGGAGTTTGG - Intergenic
946039839 2:216774014-216774036 CATGAAGGTGAGAAGGAGTTGGG + Intergenic
947331916 2:229037677-229037699 CCTTCTGGTGAGCTGGACTTAGG + Intronic
948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG + Intronic
948719387 2:239889154-239889176 CCTTTGGGTGAGATGGAGCTGGG - Intergenic
1170092161 20:12602312-12602334 CTTTATCTTGAGATAGAGCTTGG + Intergenic
1170712916 20:18808241-18808263 CTTATTTGTGAGATGAAGTTGGG - Intergenic
1171004584 20:21452016-21452038 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
1172480936 20:35271027-35271049 CTTTTTTTTAAGATGGAGTTTGG - Intronic
1172523838 20:35585537-35585559 CTTTTTGTAGAGATGGGGTTTGG + Intergenic
1175359136 20:58393741-58393763 GTTTTTTTTGAGATGGAGTTTGG + Intronic
1178858848 21:36272636-36272658 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1180737733 22:18031154-18031176 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
1182577262 22:31281415-31281437 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
1182932405 22:34187765-34187787 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
1182975950 22:34624277-34624299 ATTTATTTTGAGATGGAGTCTGG - Intergenic
1183599985 22:38834386-38834408 CCTTAGGGTGAGAAGGAGTTTGG - Intronic
1184056265 22:42052292-42052314 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1185387713 22:50543894-50543916 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
950056618 3:10030105-10030127 TTTTTTTTTGAGATGGAGTTTGG + Intronic
950167808 3:10814907-10814929 CTTTCTGGGGAGATGGAGGTTGG + Intergenic
951207171 3:19936855-19936877 TATTATTTTGAGATGGAGTTTGG - Intronic
951543397 3:23804601-23804623 GTTGATGGTTAGAAGGAGTTCGG + Intergenic
951611989 3:24499734-24499756 ATTTATGCTGTGATAGAGTTTGG - Intergenic
951650099 3:24941788-24941810 CTTTATGAGGAGATGGAATCTGG - Intergenic
952286038 3:31970641-31970663 CTTTAAAATGAGATGGAGGTGGG - Intronic
953703876 3:45216911-45216933 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
953736083 3:45495054-45495076 TTTTATTTTGAGATGGAGTCTGG - Intronic
954314781 3:49795246-49795268 ATTCATGGTGAGATTGAGCTTGG + Exonic
954379397 3:50211597-50211619 TTTTTTTTTGAGATGGAGTTTGG + Intronic
955635694 3:61027096-61027118 CTTTTTTTTGAGATGGAGTCTGG + Intronic
955897568 3:63716779-63716801 TTTTATGGAGAGTTGGAGTTAGG - Intergenic
956459081 3:69453771-69453793 CTCTAAGGTGAAATGGAGTAAGG + Intronic
956986586 3:74708614-74708636 ATTTATTTTGAGATGGAGTCTGG + Intergenic
958543294 3:95508718-95508740 ATTTATTTTGAGATGGAGTCTGG - Intergenic
959447219 3:106455187-106455209 TTTTTTTTTGAGATGGAGTTAGG + Intergenic
959489560 3:106971801-106971823 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
960023012 3:112976641-112976663 TTTTAAGTAGAGATGGAGTTTGG - Intergenic
960536691 3:118823067-118823089 TTTTATTTTGAGATGGAGTCTGG - Intergenic
960687006 3:120305166-120305188 CTTTATTTTGAGAAGCAGTTGGG - Intergenic
961241189 3:125413015-125413037 CTTTATGGCTAGGTGCAGTTGGG - Intergenic
961917637 3:130393598-130393620 GGTAGTGGTGAGATGGAGTTTGG + Intronic
961985033 3:131122837-131122859 CCTGATGGGGAGATGGAGATGGG + Intronic
963850597 3:150206850-150206872 CTTTACTGTGAGATGAACTTGGG + Intergenic
964029735 3:152123457-152123479 CTTTTTGGAGAGATGGTGTCTGG + Intergenic
964998786 3:162925121-162925143 TTTTGTTTTGAGATGGAGTTTGG - Intergenic
965580155 3:170259131-170259153 TTTTTTTTTGAGATGGAGTTTGG - Intronic
965821597 3:172689710-172689732 TTTTATTTTGAGATGGAGTTTGG - Intronic
966613511 3:181891243-181891265 CTTTTTTTTGAGATGGAGTTTGG + Intergenic
966897934 3:184459752-184459774 ATGGATGCTGAGATGGAGTTAGG - Intronic
968201002 3:196755467-196755489 TTTTTTTTTGAGATGGAGTTTGG + Intronic
968290128 3:197532885-197532907 CTTTTTTTTGAGATGGAGTTTGG + Intronic
969361648 4:6667888-6667910 TTTTTTTGTGAGATGGAGTTTGG + Intergenic
971699420 4:29950228-29950250 ATTTATTTTGAGATGGAGTCTGG - Intergenic
971855566 4:32039283-32039305 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
972031085 4:34458857-34458879 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
973819508 4:54650436-54650458 TTTTATTTTGAGATGGAGTTTGG - Intergenic
973985485 4:56348137-56348159 CTTTTTTTTGAGATGGAGTCTGG - Intronic
974053623 4:56964076-56964098 TTTTTTTTTGAGATGGAGTTTGG + Intronic
974074575 4:57157048-57157070 GCTGATGCTGAGATGGAGTTTGG + Intergenic
974201739 4:58651199-58651221 ATTCATGGTGAGATGTGGTTGGG - Intergenic
974735886 4:65931539-65931561 TTTTTTGTAGAGATGGAGTTTGG + Intergenic
975378745 4:73674054-73674076 TTTTATTTTGAGATGGAGTCTGG - Intergenic
975733806 4:77362891-77362913 GTCTTTGCTGAGATGGAGTTTGG + Intronic
976216804 4:82722752-82722774 TTTTTTTTTGAGATGGAGTTTGG - Intronic
977637042 4:99311508-99311530 GTTTATGGTGGTATGTAGTTGGG - Exonic
978738893 4:112115356-112115378 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
979436794 4:120702828-120702850 GTTTATGGTGACATTGGGTTTGG - Intronic
980036270 4:127885893-127885915 ATTTCTGGTGAAATGTAGTTAGG - Exonic
985252904 4:188041582-188041604 TTTTTTTATGAGATGGAGTTTGG - Intergenic
985652997 5:1115691-1115713 CTTTCTGGTGAGAAGGAGTGTGG - Intergenic
986057422 5:4152641-4152663 TTTTGTGGGGAGATGGAGTCTGG + Intergenic
986715558 5:10521267-10521289 TTTTTTTTTGAGATGGAGTTTGG + Intronic
988181872 5:27806082-27806104 CTTTATGGTGAGAAGGAGTAGGG - Intergenic
990029426 5:51239296-51239318 ATTTATTTTGAGATGGAGTCTGG + Intergenic
990960884 5:61392622-61392644 ATTTATATTGAGATGGAGTTCGG + Intronic
991289630 5:65020476-65020498 CTTTATGGTGAGGGGAAGATGGG - Intergenic
994986277 5:106937956-106937978 CTTTATGGTTTGGTGGGGTTAGG - Intergenic
996760286 5:126979935-126979957 TTTTTTTTTGAGATGGAGTTTGG - Intronic
997287489 5:132691534-132691556 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
997463954 5:134074291-134074313 ATTTATTTTGAGATGGAGTCTGG - Intergenic
997576921 5:134986153-134986175 TTTTTTTCTGAGATGGAGTTTGG + Intronic
998212732 5:140212787-140212809 TTTTTTGTAGAGATGGAGTTTGG - Intronic
998301980 5:141031139-141031161 GTTTTTTTTGAGATGGAGTTTGG + Intergenic
998739555 5:145184725-145184747 ATTTATTTTGAGATGGAATTTGG - Intergenic
999290501 5:150422337-150422359 CCTGATGGGGAGATGGAGTAAGG + Intergenic
1001979645 5:176030252-176030274 GTAGATGCTGAGATGGAGTTAGG - Intronic
1002237772 5:177813511-177813533 GTAGATGCTGAGATGGAGTTAGG + Intergenic
1003856802 6:10284740-10284762 ATTTACTGTGAGATGGAATTTGG - Intergenic
1004754230 6:18594125-18594147 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1005852127 6:29829677-29829699 CCTCATGCTGAGATGGAGTAAGG + Exonic
1005890762 6:30135977-30135999 CTGGAAGGTGAGATGGACTTTGG - Intergenic
1006582569 6:35085370-35085392 GTTTATGGGGAAATGGAGTTAGG + Intronic
1006972003 6:38055285-38055307 ATTTATAGTCAGATGGGGTTTGG + Intronic
1011161856 6:84399899-84399921 CTTTAGGGGGAGTTGGAGGTGGG + Intergenic
1014369497 6:120586804-120586826 TCTGATGGTGAGATTGAGTTCGG - Intergenic
1014510365 6:122313673-122313695 CTATATGATGAGATGAAGTGAGG + Intergenic
1014929816 6:127321989-127322011 GTTTATTTTGAGATGGAGTCTGG - Intronic
1014955783 6:127614335-127614357 TTATATACTGAGATGGAGTTCGG + Intergenic
1015578632 6:134700520-134700542 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
1015937103 6:138415224-138415246 TTTTAGGCTGAGATGGAGTTAGG - Exonic
1017339316 6:153302200-153302222 CTGTGGGATGAGATGGAGTTTGG - Intergenic
1017362224 6:153587972-153587994 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
1018162754 6:161063451-161063473 CTTAAAGGAGAGAGGGAGTTAGG + Intronic
1018344107 6:162882731-162882753 CATGTTGGTGGGATGGAGTTGGG - Intronic
1020074883 7:5251377-5251399 TTTTTTTGTGAGATGGAGTCAGG + Intergenic
1020903504 7:14036103-14036125 GTATATGTGGAGATGGAGTTTGG + Intergenic
1021546676 7:21821162-21821184 CTTTATGGAGAGATGTATATAGG + Intronic
1022077364 7:26985346-26985368 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1022159258 7:27692436-27692458 TTTTTTGTAGAGATGGAGTTGGG - Intergenic
1022399262 7:30021565-30021587 TTTTTTTTTGAGATGGAGTTTGG + Intronic
1024792497 7:52982930-52982952 CTTTATGAGGAGGAGGAGTTGGG + Intergenic
1025204229 7:56982444-56982466 TTTTTTTGTGAGATGGAGTCAGG - Intergenic
1025269876 7:57500516-57500538 TTTTCTTTTGAGATGGAGTTTGG + Intergenic
1025667711 7:63594489-63594511 TTTTTTTGTGAGATGGAGTCAGG + Intergenic
1025992769 7:66508107-66508129 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1026196260 7:68176246-68176268 TTTTGTGGGGGGATGGAGTTTGG + Intergenic
1027307947 7:76921749-76921771 GTTGTTGTTGAGATGGAGTTTGG + Intergenic
1027517505 7:79160985-79161007 TTTTCTGGTGAAAAGGAGTTTGG - Intronic
1029248025 7:99216571-99216593 TTTTTTTGTGAGATGGAGTCTGG + Intergenic
1029625169 7:101716222-101716244 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
1032076996 7:128840752-128840774 GTTTGAGGGGAGATGGAGTTTGG + Intronic
1032739036 7:134720578-134720600 CTTTATGTTGCCATGGAGATGGG - Intergenic
1034220374 7:149440324-149440346 CTTTATAGTAAGATGGAGATGGG + Intronic
1034342465 7:150366861-150366883 ATTTATTTTGAGATGGAGTCTGG - Intergenic
1036647553 8:10621336-10621358 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1038197896 8:25384919-25384941 TTTTATTTTGAGATGGAGTCTGG - Intronic
1038942581 8:32321801-32321823 CTTGATGGAGATATTGAGTTGGG + Intronic
1039110206 8:34033692-34033714 CCTTATAGTGCTATGGAGTTTGG - Intergenic
1039584611 8:38695654-38695676 CTTTTTGGTTAGATGGGGCTTGG - Intergenic
1039868650 8:41528009-41528031 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1039941246 8:42093149-42093171 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1040432024 8:47352262-47352284 TTTTTTGTTGAGATGGAGTCTGG - Intronic
1040518205 8:48151595-48151617 CTACATGGTGAGATGAAGCTAGG - Intergenic
1041281766 8:56217651-56217673 CTTTCTGGAGGCATGGAGTTAGG + Exonic
1041922568 8:63198632-63198654 CTTTAAGATGAGATGATGTTAGG + Intronic
1042866697 8:73362843-73362865 ATTTATTGTGAGTAGGAGTTGGG - Intergenic
1044664545 8:94622057-94622079 TTTTCTTTTGAGATGGAGTTTGG - Intergenic
1046018922 8:108640135-108640157 TTTTTTGGTGAGACGGAGTCCGG + Intronic
1046631256 8:116625117-116625139 CTTTCTTTTGAGATGGAGTCTGG + Intergenic
1047236144 8:123043272-123043294 CTTTTTTTTGAGATGGAGTCTGG - Intronic
1048368181 8:133756767-133756789 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
1049074219 8:140381191-140381213 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1049361893 8:142215907-142215929 CTTTGTGGTGCCATGGAATTCGG + Intronic
1049761758 8:144334814-144334836 CAGGATGGTGAGAGGGAGTTCGG - Intronic
1051520344 9:17980586-17980608 CATGATGGTGTGATGGGGTTGGG + Intergenic
1051840643 9:21393536-21393558 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1051855849 9:21564351-21564373 CTGAGTGGTGAGATGGAGTATGG + Intergenic
1052863249 9:33449635-33449657 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
1053549436 9:39060392-39060414 CCTTATGGTGAGAGGGAGCGGGG + Intergenic
1053813551 9:41880466-41880488 CCTTATGGTGAGAGGGAGCGGGG + Intergenic
1054617045 9:67306973-67306995 CCTTATGGTGAGAGGGAGCGGGG - Intergenic
1055280240 9:74665962-74665984 CTTTTTGTAGAGATGGGGTTTGG - Intronic
1056120242 9:83480504-83480526 TTTTTTTTTGAGATGGAGTTTGG + Intronic
1056383504 9:86076844-86076866 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1056523536 9:87421859-87421881 ATGTGTGGTGAGATGAAGTTGGG - Intergenic
1056810629 9:89761259-89761281 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
1058040144 9:100293988-100294010 CTTTTTGTAGAGACGGAGTTTGG - Intronic
1058633823 9:107017361-107017383 ATTTCTTGTGAGATGGAGTAGGG + Intergenic
1058939614 9:109801032-109801054 CTGGATGGTGAGTTGGGGTTGGG + Intronic
1059052678 9:110943852-110943874 TTTTTTTTTGAGATGGAGTTGGG - Intronic
1059062719 9:111050430-111050452 TTTTATGGTTACATGGAATTAGG - Intergenic
1059168001 9:112097407-112097429 TTTTTTTTTGAGATGGAGTTTGG + Intronic
1060114581 9:120929956-120929978 TTTTTTTTTGAGATGGAGTTTGG + Intergenic
1185486703 X:487097-487119 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1185511707 X:668572-668594 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1185739921 X:2523532-2523554 CTTCATGATTAGATGGGGTTTGG - Intergenic
1187497523 X:19808340-19808362 TTTTTAGGTGAGATGGAGTGGGG + Intronic
1188683567 X:33041958-33041980 CTATATGATGGGATGGGGTTGGG - Intronic
1190327535 X:49215952-49215974 CTCTGTGGGGAGATGGAGTGGGG - Intronic
1190407441 X:50101869-50101891 CTTTAGGGTGAGATGAAGCCTGG - Intergenic
1190803100 X:53810854-53810876 TTTTATTTTGAGATGGAGTCTGG - Intergenic
1191997498 X:67111911-67111933 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1192127805 X:68518259-68518281 TTTTTTTTTGAGATGGAGTTTGG - Intronic
1192176989 X:68892468-68892490 AATTATGGTGTGATGGAGTCAGG + Intergenic
1192307373 X:69976401-69976423 CTCTATCGTTAGCTGGAGTTTGG + Intronic
1192625549 X:72723621-72723643 TTTTATTGTGAAATGGTGTTTGG + Intergenic
1193940066 X:87671760-87671782 CTTTATAGTAAGTTGTAGTTGGG - Intergenic
1195109138 X:101628149-101628171 ATTTGTGGGGAGATGGAGTGGGG + Intergenic
1196063827 X:111440571-111440593 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
1196093096 X:111768284-111768306 CTATATGGTGATATGTGGTTGGG + Intergenic
1196569010 X:117243985-117244007 CATTAAAGTGAGATGGAATTTGG + Intergenic
1196734480 X:118972586-118972608 TTTTTTTTTGAGATGGAGTTTGG - Intergenic
1197456621 X:126683945-126683967 CTAGATTCTGAGATGGAGTTAGG - Intergenic
1198121218 X:133594083-133594105 GTTTTTTTTGAGATGGAGTTTGG - Intronic
1198737633 X:139804777-139804799 CTTTAAGGTTAGAAGGACTTAGG + Intronic
1200400526 X:156017295-156017317 CTTTTTTTTGAGATGGAGTTTGG - Intergenic
1201463225 Y:14251413-14251435 CTTCATGCTGAGATGGAAGTGGG + Intergenic