ID: 1091682349

View in Genome Browser
Species Human (GRCh38)
Location 12:2536118-2536140
Sequence GGGGCCCAGCACTACCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091682349_1091682351 -4 Left 1091682349 12:2536118-2536140 CCTTCAAGGTAGTGCTGGGCCCC 0: 1
1: 0
2: 2
3: 12
4: 144
Right 1091682351 12:2536137-2536159 CCCCTGTAGATCCTCCTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091682349 Original CRISPR GGGGCCCAGCACTACCTTGA AGG (reversed) Intronic
900131622 1:1089645-1089667 GGGGTCCAGCCCTCCCATGATGG - Intronic
900266904 1:1761936-1761958 GGGCCCCAGCACTCACATGATGG + Exonic
900892905 1:5462439-5462461 GAGAGCCAGCACTACCTTGGTGG + Intergenic
901494816 1:9614918-9614940 GGGACCCTGCCCTACCTGGAAGG - Intergenic
904343654 1:29854097-29854119 GGGGCGCAGCACAGCCTTGCGGG + Intergenic
904674183 1:32188117-32188139 GGGGCCCAGGCCTACCTTGAGGG - Exonic
906262951 1:44407113-44407135 GGGGCACAGCCCTACCTGGCCGG + Intronic
907242347 1:53087796-53087818 CGGGCCCATCACTCCCTAGATGG + Exonic
907710475 1:56876094-56876116 GGAGACCAGGACTGCCTTGATGG + Exonic
911496018 1:98632263-98632285 GGTGGTCAGCACTTCCTTGAAGG + Intergenic
920528542 1:206685501-206685523 GGGCCCCAGACCTACTTTGAGGG - Exonic
921972869 1:221169431-221169453 GGGGCCCAGGATTACCTCAATGG - Intergenic
922459072 1:225800891-225800913 GGGGCCCAGCGCTAGATTGGAGG + Intergenic
923296113 1:232596435-232596457 GGGGCCCAGTTCTGCTTTGATGG - Intergenic
923394083 1:233543516-233543538 GTGACCCAGCACTGCCTTGCAGG - Intergenic
1064867277 10:19895256-19895278 GGTGCCCAGCTCTACCATGCTGG - Intronic
1067037589 10:42931652-42931674 GAGGCCCAGCACTCTCCTGAGGG + Intergenic
1074162284 10:110844878-110844900 GGGGACCAGCAATACCTGCAGGG - Intergenic
1077328836 11:1975141-1975163 AGGCCCCAGCACCACCTTGGAGG - Intronic
1077339894 11:2021573-2021595 GGGGCTCAGCACTGCCATGGTGG + Intergenic
1077398142 11:2336722-2336744 GGGGCCTAGCTCTCCCTTGGGGG + Intergenic
1077456112 11:2681859-2681881 GAGGCCCAGCACTACCATCTAGG + Intronic
1077909098 11:6558645-6558667 GTGGCCCAGCATCACCTGGAGGG + Exonic
1078107597 11:8368410-8368432 AGGGCCCAGTTCGACCTTGATGG - Intergenic
1083318774 11:61832548-61832570 GGGTCCATGCACTACCCTGAGGG - Intronic
1084531933 11:69732510-69732532 GGGGCTCAGCCCTGCCTTAATGG - Intergenic
1085877555 11:80426965-80426987 GGGTCTCAGCACTGCCTAGAAGG + Intergenic
1086405285 11:86494191-86494213 GGGGCCCACCATTCCCTGGAGGG + Intronic
1090917392 11:131177587-131177609 TGGGCCCAGCACTTCCCAGAGGG - Intergenic
1091046305 11:132328843-132328865 GGGGCCCAGCAAGCCCTTCAAGG + Intronic
1202811815 11_KI270721v1_random:30320-30342 AGGCCCCAGCACCACCTTGGAGG - Intergenic
1202822879 11_KI270721v1_random:76762-76784 GGGGCTCAGCACTGCCATGGTGG + Intergenic
1091616350 12:2053604-2053626 GGGGTCCAGCCTTACCTTGGTGG - Exonic
1091682349 12:2536118-2536140 GGGGCCCAGCACTACCTTGAAGG - Intronic
1091753524 12:3037373-3037395 GGGACCCAGCAGTGCCTAGAGGG + Intronic
1094525255 12:31227008-31227030 GGGTCCCAGCCCTCCCTCGATGG - Intergenic
1095981857 12:47978635-47978657 GGGGTCCAGCAGGACCTTGGAGG + Exonic
1096575886 12:52552715-52552737 GGGGTCCAGCTCCACGTTGAGGG + Exonic
1098131152 12:67351827-67351849 GGTCCCCAGCACAGCCTTGATGG - Intergenic
1100723841 12:97387485-97387507 TGGGACCAGCACTTCCTTGGGGG - Intergenic
1102315744 12:111885948-111885970 GTGGTCCAGCACTCCCTCGATGG - Exonic
1103019859 12:117525273-117525295 GGGACCCAGCAGGACCATGAGGG - Intronic
1104040528 12:125127274-125127296 GGAGCCCTGCTCAACCTTGATGG + Intronic
1105291927 13:19058768-19058790 GGGGCCCAGCACTGCCGGCAGGG + Intergenic
1105819833 13:24070370-24070392 GGGGGCCATCCCTACCCTGAGGG - Intronic
1114466119 14:22924007-22924029 GGAGCCCAGCACTTCCTAAAAGG - Exonic
1117049658 14:51847421-51847443 GGGGCACAGCTCTACTTTTATGG + Intronic
1118316522 14:64729334-64729356 AGGGCCCAGCAGCCCCTTGAGGG - Intronic
1119805981 14:77482641-77482663 GGGGTCCTCCACCACCTTGATGG + Exonic
1120194481 14:81467220-81467242 GGGTATCAGCACTACCTTCAAGG - Intergenic
1122482125 14:102054145-102054167 TGTGCCCAGCACTGCGTTGAGGG - Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122902695 14:104788330-104788352 GGGGCCCAGCAGGACCCTGAGGG - Intronic
1124417118 15:29481201-29481223 GAGGCTCAGCACTACCTATACGG + Intronic
1125717298 15:41826646-41826668 GGTGCCCAGCACTGCCTTTGAGG - Exonic
1126475462 15:49061414-49061436 GAGGCCCAGAACTAACCTGAAGG + Intergenic
1130302311 15:82689274-82689296 GAGGCACAGCACTAACTAGAGGG + Intronic
1134419118 16:14070212-14070234 GGAGCCCAGCACTACCTTGTAGG - Intergenic
1137744443 16:50810432-50810454 GGGGCCCAGCAGAGCCTTGCAGG - Intergenic
1142260633 16:89041038-89041060 GGAGCCCAGCACTCCCTCCATGG - Intergenic
1142280765 16:89146472-89146494 GGGGCCCAGCACTGGCTTTGGGG - Intronic
1143181241 17:4985834-4985856 GGGGCCCAGCAAGACCTAGTAGG - Intronic
1147232343 17:39028612-39028634 AGGCCCCAGCTCTGCCTTGAGGG + Intergenic
1148215004 17:45829654-45829676 GGGCCCCAGCACTACCGCCAAGG + Intronic
1151509597 17:74550146-74550168 GGGTCCCAGGACTCCCTTGCAGG + Intergenic
1152758354 17:82096542-82096564 GGGGCCAAGCACCACCCTGAGGG + Intronic
1153104584 18:1511765-1511787 GGGACCCAGCACCAACTTGATGG + Intergenic
1153940128 18:9969907-9969929 GGGGCCCTGAACTACAATGAAGG - Intergenic
1160586929 18:79918190-79918212 GGGCCACAGCACTCTCTTGAGGG - Intronic
1161605743 19:5213996-5214018 GGGCCCCAGCCCTGCCTTCAAGG - Intronic
1162470960 19:10871771-10871793 GGGGCCCTGCGCTACCGTGTCGG + Exonic
1162756719 19:12865252-12865274 GGGGCACAGCTCTCCCTTGAGGG + Intronic
1163277865 19:16296785-16296807 GGGGACCATCACCACCTTCAAGG - Intergenic
1164150772 19:22548575-22548597 GGGCACCAGCAGTACCTTCAGGG - Intergenic
1164835668 19:31353653-31353675 GGGGGTCAGCACTGCCTTCATGG - Intergenic
1166916549 19:46199359-46199381 GGAGCCCAGCTCTGCCTTGGTGG - Intergenic
927101362 2:19789967-19789989 GGAGCCCAGCACTGTCTCGACGG + Intergenic
927228650 2:20797441-20797463 GGGACCCAGCATTTCATTGACGG - Intronic
927677159 2:25114581-25114603 GGGGCCCAGGACTGCCTAGGAGG - Intronic
928318704 2:30266457-30266479 GGGTCCCAGCCCTACCGTGCAGG + Intronic
930250448 2:49028769-49028791 GGTGCCCAGAACAACCTTGAAGG + Intronic
931836021 2:66098920-66098942 GGTGCCCAGCACTAGCTAGAAGG + Intergenic
942803912 2:179907440-179907462 GGGTCTCAGCACTACCTTGTTGG + Intergenic
946550011 2:220791149-220791171 AGGGTCCAGAATTACCTTGATGG - Intergenic
947625631 2:231616464-231616486 GGGGCCCAGCCCTGCCATAAGGG + Intergenic
1168771201 20:417966-417988 GGGGCCCTGGACTCACTTGAGGG + Intronic
1169913165 20:10663556-10663578 AGAGCCCAGCACCACCTTTATGG + Intronic
1174189697 20:48731613-48731635 GGTGCCCAGCACAACATGGATGG + Intronic
1176645049 21:9341979-9342001 GTGGCTCAGCACTGGCTTGAAGG - Intergenic
1179591104 21:42409082-42409104 TGGGCCCAGCATCTCCTTGATGG - Intronic
1179624428 21:42640585-42640607 GGGGCCCAGCTCTGCCCTCAGGG + Intergenic
1181002302 22:19993576-19993598 AGGGCCCAGCATTGCCTTGTCGG + Intronic
1181597885 22:23929089-23929111 GGGGGCCGGCACTAGATTGAAGG - Intergenic
1182061934 22:27404645-27404667 GTGGCCCAGCCCTACCCTGGGGG - Intergenic
1182767926 22:32772157-32772179 GTGGCCCAGCACTATCCTCAGGG - Intronic
1182973467 22:34599697-34599719 GTGCCCCAGCCCTACCTTCAAGG + Intergenic
1183296001 22:37029923-37029945 GGGCCCCAGCACTGCTTGGAAGG - Intergenic
1184896656 22:47411238-47411260 GGGGCCCCGGACTACCTGGTTGG + Intergenic
1184898274 22:47425139-47425161 GGGGCCAAACACAGCCTTGAGGG - Intergenic
950635101 3:14308648-14308670 GGGGCCCAGCAGCATCTGGAAGG + Intergenic
954078602 3:48199245-48199267 GGGCCCCAGTGCTGCCTTGAGGG - Intergenic
954138234 3:48592111-48592133 GGGGCCCGCCACTTCCCTGATGG - Exonic
954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG + Exonic
955494769 3:59519858-59519880 GGGGCCCAGGAAGACCTTGAAGG - Intergenic
958458383 3:94362562-94362584 GGTTCCCAGCACTGCCTTGCAGG + Intergenic
961465947 3:127081745-127081767 GGGCCCCAGCACTTCAGTGATGG + Intergenic
963175904 3:142297670-142297692 AGGGCCTAGCACTACCATGGGGG - Intergenic
965306420 3:167069829-167069851 GGGGCCCCACACTTCCATGAGGG + Intergenic
965621231 3:170644141-170644163 GGGGCCCAGCAGTGCATAGAAGG + Intronic
965899655 3:173623008-173623030 GGGACTCAACACTCCCTTGAGGG - Intronic
966863198 3:184241904-184241926 CGGGCCCAGCACTTGCCTGACGG + Exonic
1202741842 3_GL000221v1_random:63089-63111 GTGGCTCAGCACTGGCTTGAAGG + Intergenic
968569378 4:1331458-1331480 GTGGCCCAGCAGCCCCTTGATGG - Intronic
968597257 4:1491876-1491898 AGGGTCCAGCACAACCTAGATGG + Intergenic
969358919 4:6648884-6648906 GGGGCTCAGCACTTCCTTCAGGG - Intergenic
981354671 4:143774472-143774494 GGGACCAAGCACAACCTTGGTGG + Intergenic
981770946 4:148307655-148307677 TGGTGCCAGCACTACCTTGGGGG + Intronic
984614206 4:181877749-181877771 GGGTGCCAGCCCTTCCTTGAAGG + Intergenic
986707620 5:10464389-10464411 GGGGCCCAGCATGACCCGGATGG - Intronic
988451117 5:31344010-31344032 GGGGACAATCACAACCTTGATGG + Intergenic
990517129 5:56540692-56540714 GGGTCCCAACACTCCCTTGGTGG + Intronic
992003920 5:72460150-72460172 GAGGCCCCGCAGTACCTTGTGGG + Exonic
992447919 5:76850539-76850561 GGGGCCAAGCCTCACCTTGAAGG - Intronic
993661176 5:90636679-90636701 GGGGCCCTGAATCACCTTGAGGG - Intronic
996342248 5:122451672-122451694 GTGGGCCCACACTACCTTGAGGG + Intronic
998878207 5:146621092-146621114 TGGGCCAAGCACTGCCTGGAGGG + Intronic
1001733853 5:173982115-173982137 GGGAACCAGGAGTACCTTGAGGG + Intronic
1005957844 6:30676984-30677006 GGGGCACAGAACTCCCTGGAGGG - Exonic
1007812544 6:44496664-44496686 GTGGCCCAGAACTCTCTTGAGGG + Intergenic
1011212140 6:84966662-84966684 GGGTCCCAGCACCATATTGACGG - Intergenic
1018644137 6:165932056-165932078 TGGGACCGGCACTAGCTTGATGG - Intronic
1021197402 7:17688555-17688577 GTGGCCCTGCACTACCAAGAAGG + Intergenic
1027171659 7:75877205-75877227 TGTGCCCAGCAGTACCTTCAAGG - Intronic
1029954047 7:104618827-104618849 TGGTCCCAGCACTACCATTAAGG - Intronic
1030408256 7:109142759-109142781 TGGGCCCAGAAGTACCTTCAGGG + Intergenic
1035750328 8:1991703-1991725 GGGGTCCTGCACTGCCCTGAGGG + Intronic
1037897888 8:22670246-22670268 GGGGCCCAGCAGCACCTGCACGG - Intergenic
1039753128 8:40496373-40496395 GGGGCCCCTCACTTCCTAGACGG + Intergenic
1040510385 8:48088105-48088127 GGAGCCAAGCACTACCTTCCAGG - Intergenic
1043981272 8:86642595-86642617 AGGTCCCAGCATTACTTTGAAGG - Intronic
1046623878 8:116556905-116556927 TGGGCTCAGCACTCCCTTAATGG - Intergenic
1049226164 8:141451530-141451552 GGGCCACAGCACGACCTTGATGG + Intergenic
1049540912 8:143208358-143208380 GGGGCCCTGCAGTCCCTGGAAGG - Intergenic
1050182420 9:2934960-2934982 GGGGCCCTGCAGTTCCTGGAAGG + Intergenic
1051359106 9:16266128-16266150 GGGTCCCAGCACTGCCCTCATGG + Intronic
1057196217 9:93116731-93116753 GGACCCTAGCACTACCTTGCAGG + Intergenic
1057305509 9:93909999-93910021 AGGGCCCAGCACTGGCTGGATGG + Intergenic
1059338606 9:113584354-113584376 GCGGCCCAGCTCTTTCTTGAGGG - Exonic
1059500256 9:114746282-114746304 GAGGCCCAGCAGAACCTTCAGGG + Intergenic
1061840046 9:133353387-133353409 GGACCCCAGCCCTACCTTGAGGG - Intronic
1061866430 9:133493908-133493930 GGGGGTCAGCCCTGCCTTGAGGG + Intergenic
1062198349 9:135287077-135287099 GGGGCCCAGCACTGCCTCCTGGG + Intergenic
1203710473 Un_KI270742v1:93013-93035 GTGGCTCAGCACTGGCTTGAAGG + Intergenic
1185591931 X:1283035-1283057 TGGCCCCATCACTACCTGGATGG - Intronic
1186474905 X:9849635-9849657 GGTGCTCAGCCCTACATTGATGG - Intronic
1187917481 X:24168808-24168830 GAGTCCCAGAAATACCTTGAGGG + Intronic
1192729216 X:73785703-73785725 GGTGACCAGCCCTACCCTGAAGG + Intergenic
1193769452 X:85571827-85571849 GGGGCCCATCACCACCCTGCTGG + Intergenic
1195616757 X:106918462-106918484 GCGGCCCATCCCTACCTTGCAGG - Intronic