ID: 1091682518

View in Genome Browser
Species Human (GRCh38)
Location 12:2537193-2537215
Sequence CTCCCATGACAGATAGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 239}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091682514_1091682518 1 Left 1091682514 12:2537169-2537191 CCTCAGGGCTCTCTTACCCTTGC 0: 1
1: 0
2: 4
3: 22
4: 222
Right 1091682518 12:2537193-2537215 CTCCCATGACAGATAGGAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 239
1091682513_1091682518 10 Left 1091682513 12:2537160-2537182 CCAGCACATCCTCAGGGCTCTCT 0: 1
1: 0
2: 3
3: 27
4: 362
Right 1091682518 12:2537193-2537215 CTCCCATGACAGATAGGAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 239
1091682510_1091682518 23 Left 1091682510 12:2537147-2537169 CCACTTAGTGATGCCAGCACATC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1091682518 12:2537193-2537215 CTCCCATGACAGATAGGAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 239
1091682509_1091682518 26 Left 1091682509 12:2537144-2537166 CCTCCACTTAGTGATGCCAGCAC 0: 1
1: 0
2: 0
3: 4
4: 159
Right 1091682518 12:2537193-2537215 CTCCCATGACAGATAGGAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 239
1091682508_1091682518 29 Left 1091682508 12:2537141-2537163 CCTCCTCCACTTAGTGATGCCAG 0: 1
1: 1
2: 4
3: 11
4: 123
Right 1091682518 12:2537193-2537215 CTCCCATGACAGATAGGAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091682518 Original CRISPR CTCCCATGACAGATAGGAAA AGG Intronic
902189225 1:14749753-14749775 CTCCCAGGAGAGGCAGGAAATGG - Intronic
904751689 1:32744566-32744588 CTCACTTTACAGATGGGAAATGG + Intronic
905772906 1:40649835-40649857 CTCCCATCAGACACAGGAAACGG + Intronic
909067429 1:70952240-70952262 CTCACATAACAGATGAGAAATGG + Intronic
910217494 1:84857045-84857067 CTGCCTTGACAGATGGCAAATGG - Intronic
910577793 1:88786164-88786186 GTCCCATGACTGATTGGAAATGG - Exonic
911473324 1:98345414-98345436 CTCCCATCACAGCTAGAAAACGG - Intergenic
911665324 1:100544643-100544665 CTTCAAAAACAGATAGGAAAAGG + Intergenic
911841487 1:102687533-102687555 CTCCAAAAACAGAAAGGAAAAGG - Intergenic
912006070 1:104903229-104903251 CTCCCATGACATATGGGGATTGG + Intergenic
912363807 1:109116434-109116456 ACCCCATGCCAGATTGGAAATGG + Intronic
913455580 1:119027145-119027167 CTGCATTTACAGATAGGAAATGG + Intergenic
916796005 1:168167903-168167925 GTTCCATGACTGATAGGGAAAGG - Intergenic
918013089 1:180605606-180605628 CTCCCAGGCAAGATGGGAAAGGG + Intergenic
919588490 1:199469469-199469491 CTCACATGACAGAGGGCAAATGG + Intergenic
921196161 1:212760009-212760031 CCACCATGACAGATAGGGCAGGG - Intronic
923370530 1:233307428-233307450 CACTCATGACAGAAAGCAAATGG - Intergenic
923839848 1:237657995-237658017 CTCCCATGACAAATGGTCAATGG + Exonic
924433341 1:244016508-244016530 CTCACATGGCAGAAAGAAAAGGG - Intergenic
1063935092 10:11069258-11069280 CTCCCATGATAGCAAAGAAAAGG + Intronic
1064573977 10:16725617-16725639 CTCCCATGACAGAAGGCAGAAGG - Intronic
1064647697 10:17476402-17476424 CTTACATGAGGGATAGGAAAAGG - Intergenic
1066296690 10:34060175-34060197 CTCCCATGAGAGGTTGGAAGAGG - Intergenic
1066998775 10:42587030-42587052 CTCACATGTCAGAAAGGAGAGGG + Intronic
1067537537 10:47124897-47124919 CTCACATGACAGAAAAGAAGAGG - Intergenic
1068274174 10:54771054-54771076 CTACCAAGACAGATAAGAAAGGG - Intronic
1068631733 10:59304973-59304995 CTCCCATGGCAAAAAGCAAAGGG - Intronic
1068942975 10:62698566-62698588 CTCCTATGACAGAGAGGTAGGGG + Intergenic
1070767324 10:79064259-79064281 CTCCCATGGCAGTGAGGTAATGG - Intergenic
1072476666 10:95767998-95768020 ATCCCATGGCAGAAAGCAAAGGG - Intronic
1073833515 10:107414275-107414297 AGCCAATGACAGAAAGGAAATGG - Intergenic
1074549830 10:114432355-114432377 CTTCCATGAGAGTCAGGAAAAGG + Intronic
1075899841 10:126032322-126032344 CTCCCATCACACATAGGGAACGG - Intronic
1077396859 11:2328529-2328551 CTCACATGGCAGAAAGGGAAAGG + Intergenic
1078781656 11:14444445-14444467 CTCCCACTACAGTTAGGGAAGGG + Intronic
1080892464 11:36421259-36421281 CCCCTAGGACAGATAGGAAAGGG + Intronic
1081429510 11:42961219-42961241 CTCACAAGACAGAGAGAAAATGG + Intergenic
1083074928 11:60027158-60027180 CTTCCGTGACAGTGAGGAAAAGG - Intergenic
1083087982 11:60169705-60169727 CTCCCAAGAGAAATAGAAAAAGG - Intergenic
1084445895 11:69203308-69203330 CTCTCAGGACAAATGGGAAAAGG - Intergenic
1087142320 11:94776732-94776754 CACCCGTGTCAGAAAGGAAAAGG - Intronic
1087277801 11:96177746-96177768 TTTCCATGAAAGATAGGATAAGG + Intronic
1087687717 11:101284245-101284267 CTCACATGGCAGAAAGGACAAGG - Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089073570 11:115719175-115719197 CTCCCTTGACAGATGCGATATGG - Intergenic
1089155842 11:116401775-116401797 CTCCCATGAAAAAGAGGAGAGGG + Intergenic
1089726163 11:120482304-120482326 ATCCTATGACAGATAGAAATTGG + Intronic
1090601696 11:128379045-128379067 CTCACATGGCAGAGAGGAAGAGG + Intergenic
1091394715 12:146921-146943 CTCCCACCACAGATAGACAAGGG + Intronic
1091682518 12:2537193-2537215 CTCCCATGACAGATAGGAAAAGG + Intronic
1092510595 12:9151932-9151954 CACCCAAGAAAGATAGGATATGG - Intronic
1093490494 12:19699498-19699520 CTCCCATGTCAGACAGCAGAAGG - Intronic
1095299680 12:40568890-40568912 CTCACATCACAAACAGGAAATGG - Intronic
1096610826 12:52800366-52800388 CCCCCATCACAGACAGGAAGGGG - Intergenic
1096971484 12:55669964-55669986 CTCTCCTGACAGAAAGAAAAGGG + Intergenic
1099619994 12:84991275-84991297 CTCCTATGGCAGGTATGAAAGGG + Intergenic
1101392333 12:104313187-104313209 TTAACATGACAGATTGGAAATGG - Intronic
1103570872 12:121843970-121843992 GGCCCATGACAGAGAAGAAAGGG - Intronic
1107390022 13:39954045-39954067 CTGCAATGACAGAAAGGCAAGGG - Intergenic
1107416350 13:40204601-40204623 CTCCCAAGACAGATTAGAAATGG + Intergenic
1108152689 13:47552699-47552721 CTACCATGCCAGATGGAAAAGGG + Intergenic
1108901389 13:55412510-55412532 CTGCCATAACAGAAAGTAAAGGG - Intergenic
1109922617 13:69088652-69088674 CTCACATGGCAGAAAGGCAAAGG - Intergenic
1110662320 13:78071748-78071770 CTGACATGACAGAAAGGACATGG - Intergenic
1111283998 13:86064382-86064404 CTCCCATGTCAGAGTGAAAATGG - Intergenic
1111663656 13:91241726-91241748 TTCACAGGACAGATGGGAAATGG + Intergenic
1115473830 14:33795466-33795488 CTCACATGCCAGACAGAAAATGG + Intronic
1115516574 14:34191530-34191552 CACACAAGACAGACAGGAAAAGG + Intronic
1116416244 14:44681273-44681295 ATCCCATGGCAGAAAGCAAAAGG + Intergenic
1116429436 14:44828903-44828925 CTCACATGACAGAAAGGGCAAGG - Intergenic
1116558404 14:46343850-46343872 CTCACATGGCAGACAGCAAAAGG + Intergenic
1119167308 14:72505376-72505398 TTCACATGACAGAAGGGAAAGGG + Intronic
1120856097 14:89213733-89213755 CCCCCAGGACAAATGGGAAAGGG - Intronic
1121421376 14:93818114-93818136 CTCCTATTACAGCAAGGAAAGGG + Intergenic
1121496545 14:94395695-94395717 CTTCCAAGACAGCAAGGAAAGGG - Intergenic
1122149329 14:99716351-99716373 CCCCCAAGACAGCTAGGAGATGG - Intronic
1122520838 14:102342514-102342536 CTCCCAGGAGAGAAGGGAAACGG - Intronic
1123775570 15:23575751-23575773 CACCCATGCCAGAAAGGGAAGGG - Intronic
1124889963 15:33723760-33723782 TTCCCCTCACAGAGAGGAAAAGG + Intronic
1131679000 15:94702113-94702135 TTCCCATGAAAGGTTGGAAAGGG - Intergenic
1133174002 16:3999947-3999969 CTCCCTTGACAGTTTTGAAAAGG - Intronic
1133712613 16:8415822-8415844 CTCCCAGGACAGAGAAGCAAGGG - Intergenic
1136668240 16:31833252-31833274 TTCTCAGGACAAATAGGAAAAGG - Intergenic
1137309522 16:47240460-47240482 CCCAGATGACAAATAGGAAAAGG + Intronic
1137474668 16:48797345-48797367 CACTCATGACAGAAAGCAAAGGG + Intergenic
1138209427 16:55151007-55151029 CTCACATGGCAGAAATGAAAAGG + Intergenic
1138895624 16:61200339-61200361 CTCCCATGACATGTGGGAATTGG - Intergenic
1139445439 16:66995453-66995475 TTCCCATGACAGATGGGCCAGGG + Intronic
1141664879 16:85460899-85460921 GTCTGATGACAGATGGGAAAGGG + Intergenic
1142285649 16:89170532-89170554 CTCCCATCACAGAGAGGAACGGG + Intergenic
1142849423 17:2697094-2697116 CTCCCAAGACAGGAAGAAAAAGG + Intronic
1143290464 17:5824071-5824093 CTCCAATGATACAGAGGAAAAGG + Intronic
1144226951 17:13158459-13158481 CTCACATGACAGAAGGCAAAAGG + Intergenic
1144365987 17:14545408-14545430 CTGTCATGCCAGATAAGAAAGGG - Intergenic
1146377814 17:32306442-32306464 CTCCCATGACAGACTGGGATAGG - Intronic
1146922651 17:36723530-36723552 CTCCCAGGACAGTTGGGAGATGG + Intergenic
1147705975 17:42424997-42425019 CTCATTTGACAGACAGGAAAAGG + Intergenic
1148757785 17:49983384-49983406 CTCCCCTGACAGAGAAGAAAGGG + Intergenic
1148779047 17:50111499-50111521 CTCCCAGCACAGATAGCAGAGGG + Exonic
1150842543 17:68622304-68622326 CTAGCATGAAAGAGAGGAAATGG + Intergenic
1151849522 17:76682160-76682182 CTCTCATGACAATTAGGAAGTGG - Intronic
1152961023 18:80209-80231 CTCCTGTGGCAGATAGGCAAGGG + Intergenic
1154348231 18:13562032-13562054 CTACCATGCCAGAGAGGAGAGGG - Intronic
1161201533 19:3017855-3017877 CTCCACTGACAGATTGGGAATGG + Exonic
1163403698 19:17109790-17109812 ATCCCATGAGAGAAAGGCAAGGG - Intronic
1165093983 19:33400782-33400804 CTCCCATCACTGCTGGGAAATGG + Intronic
1166200435 19:41234008-41234030 CTACCAGGACAGAGAGGAGATGG - Intronic
925335352 2:3095175-3095197 CTCACTTGACTTATAGGAAATGG - Intergenic
925409172 2:3628942-3628964 CTCCTATGGCAGAGAGGGAAGGG + Intronic
926517032 2:13860010-13860032 CACCCATGACACAAAGTAAAAGG + Intergenic
926754653 2:16225321-16225343 CTCCCCTGACAGATAGCCTAGGG - Intergenic
928833594 2:35517963-35517985 CTCTCTTTACAGATAGGTAATGG - Intergenic
930815772 2:55596640-55596662 TTCACAGGACAGACAGGAAAAGG + Intronic
932127754 2:69159852-69159874 CTCCAATGACAAATTGCAAAGGG + Intronic
932464477 2:71907512-71907534 CTACCATGACAACTAGGAAGGGG - Intergenic
932639139 2:73424987-73425009 GTTCCATGGCACATAGGAAAAGG - Intronic
935635334 2:105245489-105245511 CTCGCATGGCAGAAAGGGAAGGG + Intergenic
936673483 2:114686656-114686678 TCCCTATGACAGATAGGATAAGG + Intronic
936888362 2:117339741-117339763 CTCCAAAGACACATAGCAAAGGG + Intergenic
937937981 2:127261281-127261303 ATCCCAGGACACACAGGAAATGG - Exonic
938091408 2:128437146-128437168 CCCCCAGGACCCATAGGAAATGG + Intergenic
938574908 2:132594784-132594806 CTCCCAAGAGAGTTAGTAAATGG - Intronic
938986204 2:136578997-136579019 CTCCCAAGACAGATGTGAAGAGG - Intergenic
939171757 2:138704150-138704172 CTCCCAAAGCACATAGGAAAAGG - Intronic
940900654 2:159123557-159123579 CTGCCCTGACAGAAATGAAATGG + Intronic
943330555 2:186553644-186553666 CATCAATGACAGATAGGATAAGG + Intergenic
943920393 2:193699577-193699599 CTCACAGGACTGACAGGAAAAGG - Intergenic
945010629 2:205459247-205459269 CTCCCAAGACAGCTAGGACTTGG - Intronic
946146288 2:217733620-217733642 CTCTCAAGAGAGAAAGGAAAGGG + Intronic
948383129 2:237564611-237564633 CTCCCATCACCGATAGGAAGTGG + Intergenic
948989439 2:241545234-241545256 CAGCCAAGACAGAAAGGAAACGG + Intergenic
1169500281 20:6153214-6153236 CTCCCTTGACACATGGGAATTGG + Intergenic
1172474755 20:35227937-35227959 CCCCCATGAGATATAGGATAAGG - Intronic
1172647488 20:36480005-36480027 TTCCCAAGACAGGTGGGAAAGGG - Intronic
1173494070 20:43506567-43506589 CTCCCAGGCCAGATGAGAAAAGG - Intergenic
1173537008 20:43823163-43823185 TTCTTATGACAGTTAGGAAAAGG - Intergenic
1174374729 20:50118491-50118513 CTTCCAAGAAAAATAGGAAAAGG + Intronic
1175681847 20:60994926-60994948 CTACAAGGACAGATATGAAAGGG - Intergenic
1175985063 20:62760515-62760537 CTCCTCTCCCAGATAGGAAAAGG + Exonic
1177037026 21:16056912-16056934 TACCCTTGGCAGATAGGAAAGGG - Intergenic
1177542020 21:22506399-22506421 ATACCATGACACATTGGAAAAGG + Intergenic
1179472253 21:41619509-41619531 CTCCCATGACATGTGGGAAGTGG - Intergenic
1179560352 21:42212022-42212044 CTCCCGTGGTAGAAAGGAAAGGG - Intronic
1181362318 22:22347369-22347391 CTCCCAGGACACAGAGGAAGAGG - Intergenic
1183573090 22:38668952-38668974 CACACATGGCAGAGAGGAAAGGG - Intronic
1184898261 22:47425081-47425103 CTCCCAAGACATAGAGGGAAGGG - Intergenic
950166475 3:10804218-10804240 CTCCCATGACTGTTGGCAAAAGG - Intergenic
951061692 3:18215828-18215850 CTCACATGACAGAAAGAGAAAGG - Intronic
953229406 3:41051218-41051240 CTCAAATGACAGATAAGGAAGGG - Intergenic
953439050 3:42902490-42902512 CTCCCATAGGAGATAGGGAAGGG - Intronic
953538759 3:43795958-43795980 CTTCCAGGACAGAGAGGTAAGGG + Intergenic
958605080 3:96347592-96347614 TTTCCATGACATTTAGGAAAAGG + Intergenic
958880512 3:99664104-99664126 CTCCCATCATAGAAAGGACATGG + Intronic
960032678 3:113070508-113070530 CAACCTTGACAGATAGGAAATGG - Intergenic
960231953 3:115238763-115238785 CTCCCATGGCAGAAAGCAAAAGG + Intergenic
961433455 3:126899718-126899740 CTTCCATGGCACATTGGAAAGGG + Intronic
962047419 3:131775485-131775507 CTCCCATAACACATGGGAATTGG - Intronic
963248628 3:143084910-143084932 CTCTCAGGACGGATAGGAAGTGG + Intergenic
964226280 3:154406945-154406967 CAATCATGACAGACAGGAAAAGG + Intronic
967253040 3:187562755-187562777 CACCCATGACAGAAGGCAAAGGG + Intergenic
967385624 3:188908053-188908075 CTCACATGGCAGAAAGCAAAGGG + Intergenic
967612999 3:191530238-191530260 CTCCCATATAAGATAGTAAACGG + Intergenic
969056945 4:4408067-4408089 CTCCTATCACAGATGGGAACTGG + Intronic
969328476 4:6458422-6458444 CTCACATGACAGAAGGGCAAGGG + Intronic
969715579 4:8866668-8866690 ATTCCATACCAGATAGGAAATGG + Intronic
971273634 4:25174680-25174702 GTCCAAAGACAGATAGAAAAAGG + Intronic
971761669 4:30773769-30773791 CTCCCAGAATAGAAAGGAAATGG - Intronic
971859860 4:32089047-32089069 TTCCCATAACAGATTGGACAGGG + Intergenic
972001945 4:34048438-34048460 CTCCCATCACAGTGGGGAAAAGG + Intergenic
973189203 4:47367928-47367950 CTCACATGAAACAAAGGAAAAGG + Intronic
974677409 4:65111419-65111441 CTCACATGGCAGATGGGATAAGG - Intergenic
975245261 4:72113204-72113226 CTTCCATGACAGGAAAGAAAAGG + Intronic
977340921 4:95756488-95756510 CACTCATGAGAGATAGGAACAGG + Intergenic
978731088 4:112027419-112027441 CTCCTTTGACAGATAGCAAGAGG - Intergenic
978820675 4:112961293-112961315 CTCTCATTATAGGTAGGAAAAGG + Intronic
979959796 4:127004072-127004094 ATCCCATGACAGATGGTATACGG - Intergenic
980594321 4:134933144-134933166 TTCACATGGGAGATAGGAAATGG - Intergenic
981525747 4:145705582-145705604 CTGCCATGACAGCTAGTAAGAGG - Intronic
981572055 4:146162274-146162296 ATCCTATGACAGAAAGCAAAAGG - Intergenic
982479286 4:155889602-155889624 CTCACTTCACAGATGGGAAACGG - Intronic
982519202 4:156391909-156391931 TTCCCATGAAATATAGCAAATGG - Intergenic
985048430 4:185965692-185965714 CCCCTATGACAGGGAGGAAACGG - Intergenic
986000245 5:3625344-3625366 CTCCCATGACACATGGGAATTGG + Intergenic
987544177 5:19290886-19290908 TTCACATGACAGAAAGGACAAGG + Intergenic
990073716 5:51816808-51816830 CTCCCATGGCAGATAAGAGGTGG + Intergenic
990741976 5:58921586-58921608 CTCCCATGATAAAAAGGTAAAGG + Intergenic
996033815 5:118735748-118735770 CTTTCATGACAGAGAGGTAAAGG + Intergenic
997579952 5:135010914-135010936 CTCATGTGACAGATGGGAAAGGG - Intronic
999845959 5:155480576-155480598 CTTCCCTGACAGAGAGAAAAGGG - Intergenic
1000828651 5:166076781-166076803 CTACCATTACAAAGAGGAAAAGG + Intergenic
1001547204 5:172577882-172577904 CTCACTTTACAGATGGGAAACGG + Intergenic
1001830850 5:174788202-174788224 ATCCCATGACAGAAAGCAGAAGG + Intergenic
1004157595 6:13183941-13183963 CCCCCATGAAAGAAAGGAAGAGG + Intronic
1004618434 6:17312541-17312563 CCCCCATGACAGAGAAGGAATGG - Intergenic
1007326885 6:41069098-41069120 CTCCCATAACAGTGTGGAAAGGG - Intronic
1008138078 6:47800214-47800236 CAGCCATGCCAGATGGGAAATGG + Intronic
1008809560 6:55479219-55479241 TTCCCATGACAGATGTGGAAAGG - Intronic
1009644048 6:66373828-66373850 CTCTCATGAAAGAAATGAAAAGG - Intergenic
1010860326 6:80901605-80901627 CAACCATATCAGATAGGAAAAGG + Intergenic
1012518866 6:100096108-100096130 CTTCCAGAACAGAAAGGAAAAGG - Intergenic
1013625877 6:111936343-111936365 CTACCATGGAAAATAGGAAAAGG - Intergenic
1014248672 6:119094260-119094282 CTTCCATGACAGCAAGTAAAGGG - Intronic
1014743165 6:125169582-125169604 CTGGCATGACAGACTGGAAATGG - Intronic
1015083745 6:129262269-129262291 CTCCCTAAACAGATAGGACAGGG - Intronic
1016587536 6:145706991-145707013 CTCACATGGCAGAGGGGAAAAGG - Intronic
1017523273 6:155220580-155220602 ATCCAAAGACAGAAAGGAAAGGG - Intronic
1017874545 6:158514030-158514052 TTCCCAGGACAGAAGGGAAATGG - Intergenic
1018615466 6:165682569-165682591 CTCACATGGCAGAGAGGCAAAGG - Intronic
1020564638 7:9779448-9779470 GTCCCATGTCAGACAGGAATGGG - Intergenic
1022477479 7:30721132-30721154 CTCCCATGGCAGAGAAGCAAAGG + Intronic
1022691957 7:32664967-32664989 ATCCAATGCCAGAGAGGAAAGGG + Intergenic
1023119729 7:36897258-36897280 GTCCCTTCACATATAGGAAAGGG + Intronic
1023343945 7:39252035-39252057 CTCCCATTTCAGATAGAAATTGG - Intronic
1024462190 7:49670312-49670334 TTCCCGTGCCAGATGGGAAAAGG + Intergenic
1026162686 7:67883418-67883440 ATGCAATGACAGAAAGGAAAAGG - Intergenic
1026534929 7:71231661-71231683 CTCACATGACAGATAGAGCAAGG + Intronic
1026997528 7:74628058-74628080 CTCCCATGCCAGAGAGACAAAGG + Intergenic
1028640501 7:93037229-93037251 ATCACATGACACATTGGAAAGGG - Intergenic
1030289925 7:107861920-107861942 CTGCCACAACAAATAGGAAAGGG - Intergenic
1031498030 7:122475767-122475789 CATCAATGACAGATAGGAAAAGG + Intronic
1031788450 7:126065975-126065997 CTCCCATGACAGATGGGGATGGG + Intergenic
1032197267 7:129796583-129796605 CTCCCAGGACAGAAGGGACAGGG - Intergenic
1035428224 7:158796754-158796776 CTCCCAGGAGAGACGGGAAAAGG + Intronic
1038254542 8:25938987-25939009 CTCCATGGACAGTTAGGAAATGG + Intronic
1038615112 8:29086554-29086576 CTTTCATGACAGGTGGGAAATGG + Intronic
1039931680 8:41996647-41996669 CACGCAAGACAGAGAGGAAAAGG - Intronic
1040008608 8:42642231-42642253 CTCCCATCAGAGTTGGGAAAAGG + Intergenic
1040560012 8:48515251-48515273 CTCCCATGAAAGACAGAAGATGG + Intergenic
1040835460 8:51725783-51725805 CTGCAAGGACAGATAGTAAATGG + Intronic
1041648483 8:60277866-60277888 TTACCATGACAGAGAGGATAAGG + Intronic
1047888630 8:129281461-129281483 CTCACATGAAAGATAAGAATAGG + Intergenic
1048318163 8:133377229-133377251 GTCCCAGCACAGATAGGGAAGGG + Intergenic
1049235170 8:141508596-141508618 CTCCAAGGACAAATAGGAAAGGG - Intergenic
1050334329 9:4576061-4576083 TTCCCATGGCAAATCGGAAAGGG - Exonic
1050386925 9:5100786-5100808 ATCCCATCAGAGATAGTAAAAGG - Intronic
1051175102 9:14352727-14352749 CTCCAATAACAGACAGGGAAAGG + Intronic
1051700276 9:19815308-19815330 CTTCCATAACAGATTGGAAAAGG - Intergenic
1051940361 9:22498181-22498203 ATCCCATGACAGACATGAATAGG - Intergenic
1053019732 9:34686562-34686584 CTCCCTCAACAAATAGGAAAGGG + Intergenic
1053056462 9:34995849-34995871 CTCCAAAGACATATAGGACAAGG - Intronic
1054957855 9:70933907-70933929 TCCCTATGACAGAAAGGAAAAGG + Intronic
1055539607 9:77289564-77289586 ATACCAAGAAAGATAGGAAATGG - Intronic
1057894291 9:98894772-98894794 CTGCCATGACAGATGAGAATTGG - Intergenic
1059539257 9:115114327-115114349 ATCCCAGGACAGCTTGGAAATGG - Intronic
1061110426 9:128565692-128565714 ATCCCAAGACAGAAAGAAAAGGG - Intronic
1062737139 9:138143778-138143800 CTCCTGTGGCAGATAGGCAAGGG - Intergenic
1190626905 X:52345494-52345516 CTTCCCTGACTGAAAGGAAAAGG - Intergenic
1190701084 X:52990313-52990335 CTTCCCTGACTGAAAGGAAAAGG + Intronic
1192046316 X:67677787-67677809 CTCATTTTACAGATAGGAAAGGG - Intronic
1192072376 X:67954613-67954635 CTCATATGACAGATAGGGAAGGG + Intergenic
1192239514 X:69318288-69318310 CTCTTTTGACAGATGGGAAAAGG + Intergenic
1193287236 X:79726840-79726862 CTGCCCTGACAGCTAGCAAAAGG + Intergenic
1193952157 X:87813069-87813091 CTTCCATGAAAAATAGGAAGGGG - Intergenic
1195604178 X:106783798-106783820 CTATCATGGCAGAAAGGAAAGGG + Intronic
1196317247 X:114242511-114242533 ATCACATGTCAGATAGGAAAGGG - Intergenic
1198636031 X:138701427-138701449 CTACTATAAAAGATAGGAAAGGG - Intronic
1201144051 Y:11052988-11053010 CTCACAGGCCAGACAGGAAAGGG - Intergenic
1201344379 Y:12966907-12966929 CTGCCCTGACAGCTAGGAAGAGG - Intergenic