ID: 1091685065

View in Genome Browser
Species Human (GRCh38)
Location 12:2555659-2555681
Sequence CCCGCAAAGACTGCCTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091685065_1091685071 6 Left 1091685065 12:2555659-2555681 CCCTCACAGGCAGTCTTTGCGGG 0: 1
1: 0
2: 1
3: 8
4: 108
Right 1091685071 12:2555688-2555710 GAGGTTATTAGCTAACCGTTCGG 0: 1
1: 0
2: 0
3: 1
4: 26
1091685065_1091685072 17 Left 1091685065 12:2555659-2555681 CCCTCACAGGCAGTCTTTGCGGG 0: 1
1: 0
2: 1
3: 8
4: 108
Right 1091685072 12:2555699-2555721 CTAACCGTTCGGAGCAGTAAAGG 0: 1
1: 0
2: 0
3: 0
4: 12
1091685065_1091685074 24 Left 1091685065 12:2555659-2555681 CCCTCACAGGCAGTCTTTGCGGG 0: 1
1: 0
2: 1
3: 8
4: 108
Right 1091685074 12:2555706-2555728 TTCGGAGCAGTAAAGGCGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091685065 Original CRISPR CCCGCAAAGACTGCCTGTGA GGG (reversed) Intronic
900496958 1:2980048-2980070 CCTGCCAAGTCTGCCTGCGAAGG - Intergenic
901032058 1:6312912-6312934 CCTGCCAAAACTGCCTGGGAAGG + Intronic
901209900 1:7518874-7518896 CCCGAAAAAATGGCCTGTGATGG + Intronic
904506379 1:30958617-30958639 TCCCCAAAGACTGACTGTAATGG - Intronic
905425460 1:37880157-37880179 GCCGCAAAGACTGTCTTTGAAGG - Exonic
907870052 1:58434930-58434952 CCATCAAAGACTTCCAGTGAAGG + Intronic
912593551 1:110851541-110851563 ACCGCGAACACTGCCTGTCATGG - Intergenic
918251935 1:182710608-182710630 CCCCCAAAGATTGCATGTAATGG + Intergenic
1063046584 10:2398621-2398643 CCAGCAAGGACTGCCTGTTCTGG + Intergenic
1063843803 10:10102713-10102735 CCTGCAAAGGCTGTGTGTGATGG + Intergenic
1070784169 10:79153558-79153580 CCCGCAAGGACAGCCAGTGGTGG - Intronic
1071588810 10:86851725-86851747 CCTGGAAGGAGTGCCTGTGAAGG + Intronic
1074058502 10:109943606-109943628 CCAGCAAAGCCTGTCTCTGAAGG - Intronic
1075728004 10:124620466-124620488 CCCACAAACCCTGCCTCTGAGGG - Exonic
1076749688 10:132536603-132536625 CGTGCAAAGCCTTCCTGTGAAGG + Intergenic
1077472252 11:2769546-2769568 CCCGCAGAGAATGCCATTGATGG + Intronic
1078091285 11:8266209-8266231 CCCTCCAAGACTTGCTGTGAAGG - Intronic
1080307058 11:30848161-30848183 CCTGCGAAGACAGACTGTGAAGG + Intronic
1081403138 11:42665780-42665802 GACGCAAGGACTGCCTTTGAAGG + Intergenic
1083548581 11:63567535-63567557 TCAGCAAAGACTGGCTCTGAGGG - Intergenic
1084319023 11:68363261-68363283 CTCCCAAACACAGCCTGTGATGG - Intronic
1084425326 11:69081139-69081161 CCCGCAAGGGCTGGCTGGGAAGG + Intronic
1088743412 11:112785153-112785175 TCCCCAAAGACGGCCTGAGATGG + Intergenic
1090254383 11:125273097-125273119 CCCGGAGAGACTGGCTGTGCTGG + Intronic
1091685065 12:2555659-2555681 CCCGCAAAGACTGCCTGTGAGGG - Intronic
1095877465 12:47097826-47097848 CACCCAAAGATTCCCTGTGATGG + Intronic
1100926878 12:99558591-99558613 CATGCACAGACTGCCAGTGAAGG + Intronic
1113251677 13:108460115-108460137 CCCTCAGAGCATGCCTGTGAAGG - Intergenic
1114672456 14:24418523-24418545 TCTGCAAAGAATGGCTGTGAGGG - Exonic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118617973 14:67588074-67588096 CCTGCAAAGACTGCCCCAGAAGG - Exonic
1122997809 14:105275003-105275025 CCTGCAAAGACTACCTGAGGCGG + Intronic
1124890185 15:33725446-33725468 CCGCCAGAGACTGCCTGTGCAGG + Intronic
1125527320 15:40385198-40385220 CCAGAAAAGCCTGCATGTGAGGG + Intronic
1129465986 15:75724445-75724467 GCAGCCAACACTGCCTGTGAGGG - Intronic
1130970068 15:88725399-88725421 CCCACAAATACTGCCAGGGAAGG + Intergenic
1131047140 15:89323498-89323520 CCCTCACAGACTGCCCGTGGTGG - Exonic
1132104631 15:99054483-99054505 TCCGTAAAGACTGGGTGTGAAGG - Intergenic
1133583354 16:7167520-7167542 CCTCCAAAGACTGCATGGGAGGG - Intronic
1136122944 16:28152142-28152164 CAGGCAAAGACTGCTTGTGAAGG + Intronic
1137615560 16:49844525-49844547 CCCACAAAGACTGACTCTCACGG + Intronic
1137774765 16:51045548-51045570 TCCGCAGAGAGTGACTGTGATGG + Intergenic
1139560534 16:67738849-67738871 CCCGCAAAGAAAGCCTGCTAAGG + Intronic
1139711146 16:68777481-68777503 CCCACAAACACTGCTTTTGAAGG - Intronic
1143296328 17:5874597-5874619 CCAGGGAAGACTTCCTGTGATGG + Intronic
1143314718 17:6023649-6023671 CCTGCAGAGACTGGCTGTGAAGG + Intronic
1144136090 17:12296427-12296449 CCTGCAAAGACTGTCTTGGAAGG + Intergenic
1152485521 17:80589245-80589267 CCCGCAAAGACGGCCTGCAGAGG - Intronic
1156920194 18:42512887-42512909 CCTGGAAATACTGCCTATGATGG + Intergenic
1159297033 18:66505069-66505091 CTTGCAAAGACTGCCTGTATAGG + Exonic
1164810054 19:31148398-31148420 CTCACAAAGACTTCCTGTGTTGG - Intergenic
1165275894 19:34751286-34751308 CTTGCAAAGACTGTGTGTGATGG - Intergenic
925768231 2:7258564-7258586 CCGGCAAACAGTCCCTGTGATGG + Intergenic
927869941 2:26616972-26616994 CAGGCAAGCACTGCCTGTGAGGG + Intronic
928186135 2:29113017-29113039 CCCCCAAAGACAGCCTGTGTAGG + Intronic
928284028 2:29973341-29973363 CCTGCAAAGACTGAGTGAGATGG - Intergenic
928819135 2:35339624-35339646 ACAGCAAAGACTAACTGTGAGGG + Intergenic
929769311 2:44878661-44878683 CCAGCCCAGACTGCCTGTGATGG - Intergenic
930656243 2:54009858-54009880 TTCTCAAAGACTTCCTGTGAAGG - Intronic
933270847 2:80231347-80231369 ACCTCTGAGACTGCCTGTGATGG + Intronic
938247688 2:129791753-129791775 CCCACAAAGACTGGCGGTGGGGG + Intergenic
939537987 2:143456142-143456164 TCCTCAAAGACTGGCAGTGAGGG + Intronic
941811097 2:169756799-169756821 CTCGCAGAGGCTGGCTGTGAAGG - Intronic
946856218 2:223952328-223952350 CCCACAGAGACTGCCTGTTGAGG - Intergenic
947790451 2:232864160-232864182 CCAGCAAAGGATTCCTGTGAGGG - Intronic
1172301067 20:33850814-33850836 CCTGCAATGACTCCCTGTGAGGG - Intronic
1175009698 20:55722782-55722804 CACGCATAGACTGTATGTGATGG - Intergenic
1175788101 20:61724368-61724390 CCCGCCAAGACTCCCCATGAAGG + Intronic
1181662565 22:24363301-24363323 CCTGCCAAGAGTGCCTGCGATGG + Exonic
1183017905 22:35005040-35005062 CTTGCAAACACTGCCTGTCATGG - Intergenic
1183587015 22:38758710-38758732 CCGCCAAGGCCTGCCTGTGATGG - Intronic
954580538 3:51700703-51700725 CTCCCAAACACTGCCTGTCAGGG + Intronic
967462457 3:189762211-189762233 CCCACAAAGGCTGCCTGTTAGGG + Intronic
968868444 4:3228229-3228251 ACCGCAATGACTGCCAGTGCGGG + Intronic
969640847 4:8397515-8397537 CCTGGAAAGGCTGCCTGTAATGG - Intronic
971708437 4:30078963-30078985 ACAGCAAAGACTGCCTGTTAGGG + Intergenic
978389958 4:108215128-108215150 CACAGAAAGACAGCCTGTGATGG - Intergenic
984640277 4:182157386-182157408 CCCACAAAAACCCCCTGTGAAGG + Intronic
985084206 4:186296383-186296405 CCCGCTCACACGGCCTGTGAGGG + Intergenic
985472206 5:53393-53415 CCCCCACAGCCTGCCTGAGAAGG - Intergenic
985522889 5:387082-387104 GCCCCAAGGACTGCCTGTCAGGG - Intronic
991001797 5:61790555-61790577 CTCACCAATACTGCCTGTGATGG + Intergenic
992769902 5:80036850-80036872 AGAGCAAAGACTGCCTATGAGGG + Intronic
994450123 5:99930236-99930258 CTCACAAGTACTGCCTGTGATGG - Intergenic
998040532 5:138948455-138948477 CCCGCAATGCCAGGCTGTGAGGG - Intronic
998907069 5:146917232-146917254 ACAGCAAAGACAGCCTGTGCAGG - Intronic
1001444172 5:171770410-171770432 CCCCCAAAGAGGGCCTCTGAAGG - Intergenic
1002549497 5:179976525-179976547 CCGTCAATGACTGCATGTGAAGG + Intronic
1003539272 6:7003863-7003885 CCCGCAAACACTGCCTGGAGAGG + Intergenic
1004645035 6:17552664-17552686 CCCTCTAAGTCTGCCTGTGCAGG + Intronic
1007366798 6:41399761-41399783 CCTGCCAACACTCCCTGTGAGGG + Intergenic
1007922713 6:45625279-45625301 GCCCCAAAGACTGCCTGTAGAGG - Intronic
1007950013 6:45863249-45863271 CCAGCAATGACTGCCTCAGATGG - Intergenic
1009990420 6:70836294-70836316 CAGGCAAAGACAGCCTGTGTAGG + Intronic
1011007261 6:82660154-82660176 CCCATAAAGACTGCCTGTGAAGG + Intergenic
1015155304 6:130088160-130088182 CCCAGAAATACTGGCTGTGAGGG + Intronic
1026125092 7:67572470-67572492 CTCGCAAAGACTTCCTGATATGG - Intergenic
1031156980 7:118121685-118121707 CCCGCAATGCCAGCCTGTCAGGG + Intergenic
1033285515 7:140037670-140037692 CCAGCAGAGCCTGCCTGTGTTGG - Intronic
1037657797 8:20901307-20901329 GGGGCAAAGACTGGCTGTGAGGG - Intergenic
1038883930 8:31641830-31641852 CAAGCAGAGTCTGCCTGTGATGG + Intronic
1043526980 8:81107792-81107814 CCCGCAGAGACAGCCCCTGAGGG - Intronic
1047149202 8:122241568-122241590 CACTCAATGACAGCCTGTGAAGG + Intergenic
1051002849 9:12306267-12306289 CCCAAAAAGAGTGCCTGTTATGG + Intergenic
1057515139 9:95714331-95714353 CCCTCAATGACTGGCTGTGGTGG - Intergenic
1060038614 9:120280935-120280957 CCACCACAGCCTGCCTGTGATGG - Intergenic
1060732611 9:126048017-126048039 ACAGCAAACACTGCCTTTGAGGG + Intergenic
1061204221 9:129153660-129153682 GCTGCAAAGACTGCAGGTGAAGG + Intergenic
1185445909 X:258007-258029 CCCCCCAAGACCGCCTGGGATGG + Intergenic
1185782267 X:2859739-2859761 TCCTCAAAGACAGCCTCTGAAGG - Intronic
1186561351 X:10617135-10617157 CCCAGAAAGACTACCTGTGCAGG - Intronic
1189382733 X:40513322-40513344 CCAGCCCACACTGCCTGTGAAGG - Intergenic
1189453097 X:41157767-41157789 GACGCAGAGACTGCCTTTGAAGG + Intronic
1192377068 X:70573640-70573662 CAAGCAAAGACTGCCTGCAAAGG + Intronic
1193336257 X:80293431-80293453 CCCAGAAAGACTTACTGTGAAGG + Intergenic
1194501797 X:94690664-94690686 CACTCAATGACAGCCTGTGAAGG + Intergenic
1195005139 X:100678413-100678435 CCAGCAATGACTTCCTGGGAGGG - Exonic
1195964388 X:110417070-110417092 CCCAAACAGACTGCCTTTGAAGG - Intronic