ID: 1091686039

View in Genome Browser
Species Human (GRCh38)
Location 12:2563422-2563444
Sequence TGGATTTTCCCCCAAGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091686031_1091686039 14 Left 1091686031 12:2563385-2563407 CCATGTTTTCCACCTGGTGGCCT 0: 1
1: 0
2: 0
3: 20
4: 201
Right 1091686039 12:2563422-2563444 TGGATTTTCCCCCAAGTGGTAGG 0: 1
1: 0
2: 3
3: 15
4: 118
1091686033_1091686039 2 Left 1091686033 12:2563397-2563419 CCTGGTGGCCTGCTTCCCTGTGT 0: 1
1: 0
2: 3
3: 36
4: 433
Right 1091686039 12:2563422-2563444 TGGATTTTCCCCCAAGTGGTAGG 0: 1
1: 0
2: 3
3: 15
4: 118
1091686035_1091686039 -6 Left 1091686035 12:2563405-2563427 CCTGCTTCCCTGTGTAGTGGATT 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1091686039 12:2563422-2563444 TGGATTTTCCCCCAAGTGGTAGG 0: 1
1: 0
2: 3
3: 15
4: 118
1091686032_1091686039 5 Left 1091686032 12:2563394-2563416 CCACCTGGTGGCCTGCTTCCCTG 0: 1
1: 0
2: 4
3: 26
4: 383
Right 1091686039 12:2563422-2563444 TGGATTTTCCCCCAAGTGGTAGG 0: 1
1: 0
2: 3
3: 15
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091686039 Original CRISPR TGGATTTTCCCCCAAGTGGT AGG Intronic
900124354 1:1062888-1062910 GGAATTCTCCCCCAAGTGGCAGG - Intergenic
900382174 1:2390433-2390455 TGGATTTTCTCCCCAGCGATAGG - Intronic
901291880 1:8130572-8130594 TGGTTTGTCACCCAGGTGGTTGG - Intergenic
905278012 1:36831483-36831505 TGCTCTTTCCCCAAAGTGGTGGG + Intronic
905971824 1:42147348-42147370 TGGTTTTTCCCCGGAGAGGTGGG - Intergenic
907454723 1:54567953-54567975 TGGATTTTACTCCAAGTGTGAGG - Intronic
907631565 1:56088501-56088523 TTTATTTTCCCCTAAGGGGTAGG + Intergenic
908154378 1:61337430-61337452 TAGTTTTTCCCCCATGTGGTAGG + Intronic
911042895 1:93605884-93605906 TGGCTTTTCCTCCATGTGTTTGG - Intronic
913052466 1:115129582-115129604 TGCATTGCCCCCCAAGTGATAGG - Intergenic
916897496 1:169180478-169180500 GAGAGTTTGCCCCAAGTGGTTGG - Intronic
917835688 1:178939707-178939729 GGGATTTTCCCCCTGGGGGTGGG + Intergenic
918304681 1:183235161-183235183 TGCTTTGTCCCCCTAGTGGTGGG + Intronic
920135151 1:203763596-203763618 TGGATTTTGCCCCATGGGGAAGG + Intergenic
922902066 1:229144901-229144923 TCCATTTGCCACCAAGTGGTTGG - Intergenic
923866106 1:237941209-237941231 TGCCTTTTCCCCCCAGTGGCGGG + Intergenic
1065170476 10:23022486-23022508 TGTGTTTTCCCCCAAGTCATAGG - Intronic
1068027185 10:51661049-51661071 TGGATTTTCCAAAAAGTGCTTGG + Intronic
1068989391 10:63134826-63134848 TGGGTCTTGCCCCAGGTGGTAGG + Intronic
1074889351 10:117722326-117722348 AGATTTATCCCCCAAGTGGTGGG + Intergenic
1076203518 10:128577028-128577050 TGGATTTTCCCTCCATTGGCAGG + Intergenic
1077334907 11:1998895-1998917 TGGAAATTCCCCCATGTCGTGGG - Intergenic
1078647940 11:13159478-13159500 AGAATTTTCCCCCAAGTGACTGG - Intergenic
1079528499 11:21419676-21419698 TGGCTTTTCTCTCAAATGGTTGG - Intronic
1080685393 11:34511190-34511212 TGGATTTTCCTCCAATTTGGTGG - Intronic
1081147552 11:39581834-39581856 TGAAATTTCCCACAAATGGTGGG - Intergenic
1081543327 11:44051821-44051843 GGCCTTTTCCCCAAAGTGGTGGG + Intronic
1083328738 11:61886945-61886967 TGGATTTTCCCACAGTTGTTAGG + Intronic
1087531677 11:99389746-99389768 TGGAATTTTCCCCAAGTGGTAGG + Intronic
1087825225 11:102757264-102757286 TTCATTTTCCCGGAAGTGGTGGG + Intergenic
1089970793 11:122691658-122691680 GGGATTTTCCCGCAAGTGGTGGG - Intronic
1202817890 11_KI270721v1_random:54077-54099 TGGAAATTCCCCCATGTCGTGGG - Intergenic
1091581634 12:1793905-1793927 TTGCTTTTCCCCCAAAAGGTAGG - Intronic
1091686039 12:2563422-2563444 TGGATTTTCCCCCAAGTGGTAGG + Intronic
1093441268 12:19199507-19199529 TGGTTTTTCTCCCCAGTGGTTGG + Intronic
1093818871 12:23586274-23586296 TTGTTTTTCCCCCAAGTGGTAGG + Intronic
1094591052 12:31821164-31821186 AGGACTTAGCCCCAAGTGGTTGG + Intergenic
1095719434 12:45385023-45385045 TGGATTATTCCCCAGGTGGTGGG + Intronic
1100956209 12:99911764-99911786 TGGATTTTCTTCAAAGTGGGAGG - Intronic
1101474524 12:105031982-105032004 TGGAGTTTCTACCAAGTGGTAGG + Intronic
1103970570 12:124668336-124668358 TGGGGTTTCCCTCAAGTGGTTGG - Intergenic
1106317860 13:28610981-28611003 TGGGTTTTCCACTAAGTGGATGG - Intergenic
1106933915 13:34697142-34697164 GGAAAGTTCCCCCAAGTGGTTGG + Intergenic
1107151416 13:37116421-37116443 TGGATTTTCCCTTCAGTGGAGGG + Intergenic
1112880632 13:104102599-104102621 TGGCTTTTGCCCGAAGTGCTGGG + Intergenic
1120658809 14:87228733-87228755 TGGATTTTTCCCCAGGAGGGTGG - Intergenic
1122597956 14:102906708-102906730 TGGATTCTGCCCCATGTGTTCGG + Exonic
1124218893 15:27832404-27832426 TGGATTTCACTCCAGGTGGTGGG - Intronic
1124335897 15:28856897-28856919 ATGATGTTACCCCAAGTGGTTGG + Intergenic
1124934935 15:34161251-34161273 TTTTTTTTCCCCCAAGTTGTTGG + Intronic
1125091781 15:35801507-35801529 GGTATTTTCCCCCCAGTGCTTGG - Intergenic
1125266209 15:37884256-37884278 TTGCTTTTCCTCCAAGTGGAAGG + Intergenic
1126903551 15:53339594-53339616 TGGATTTTCCCCCTATTTCTAGG - Intergenic
1127460002 15:59190054-59190076 TGTGTTTTCCAGCAAGTGGTGGG - Intronic
1132180438 15:99748934-99748956 TGGATTTTCCCCTAGGGGGAGGG + Intergenic
1137341596 16:47612745-47612767 TGGATATGTCCCCATGTGGTTGG + Intronic
1139076015 16:63449065-63449087 TGGAGTTTTCACCAAGTTGTAGG - Intergenic
1143253162 17:5537411-5537433 GGGATTTTCTTCCCAGTGGTCGG + Intronic
1143955709 17:10667031-10667053 TGGATTTTCTCCAATGTGATTGG - Intergenic
1150316439 17:64173034-64173056 TAATTTTTCCCCCAAATGGTTGG + Intronic
1155157118 18:23167262-23167284 TGGATTTTTCCTCATGTGGCTGG + Intronic
1155708590 18:28847451-28847473 GGGATTTTCTTCCAAGAGGTGGG - Intergenic
1158903288 18:61986390-61986412 TGGATTTGCTCCCATGTGATTGG - Intergenic
1160040219 18:75338449-75338471 TCGAGTTTCTCCCACGTGGTGGG + Intergenic
927207937 2:20621756-20621778 TGGATTTGCTCCCAGGTGGGTGG + Intronic
931792961 2:65681675-65681697 AGGCTTTTCCTCCAAGGGGTGGG + Intergenic
932656669 2:73616557-73616579 TGGAGTTTTCCCCAATTGATTGG + Intergenic
933168792 2:79102088-79102110 TGGATTTTCTCTCAAGTGAAAGG - Intergenic
933284079 2:80365882-80365904 TGCATTTTTCCCCCTGTGGTCGG + Intronic
933502323 2:83129669-83129691 TATACTTTCCTCCAAGTGGTTGG + Intergenic
936508556 2:113127699-113127721 TGGATTTTCTCCCAGAGGGTCGG - Exonic
943609872 2:190019459-190019481 TGGTTGTTCCCACAAGTGGTGGG - Intronic
945213683 2:207411175-207411197 TGGATTATCCCCCAACTGTTTGG - Intergenic
945325692 2:208479975-208479997 TTGATTTTCCCCCATGTGTGGGG + Intronic
947163649 2:227239881-227239903 TTGACTTTCTCCCAAATGGTAGG - Intronic
947966103 2:234282688-234282710 TGGATTTTTACCCAACTGGAAGG + Intergenic
948350028 2:237332440-237332462 TAGATTTTCCCCAAAGGTGTGGG - Intronic
1170851146 20:20005435-20005457 TGGGTTTTCCCTCACGTAGTAGG + Intergenic
1171153353 20:22847264-22847286 TGGCTTTTCACTCAAGTGGTGGG - Intergenic
1172574579 20:35997982-35998004 TGGATAATCCCCCAAATGCTTGG - Intronic
1175779697 20:61674523-61674545 TGGAGGTGGCCCCAAGTGGTGGG - Intronic
1177861201 21:26456659-26456681 TGGATTTTCCCCCTAATGAATGG + Intergenic
1178840494 21:36134575-36134597 TGAATGTGCCCCCAAGTGGGAGG - Intergenic
1179576638 21:42312403-42312425 TGGCTATTCCCCCATGTGGTGGG - Intronic
951088457 3:18542719-18542741 TGGAGTTTCCAGCAAATGGTTGG + Intergenic
952052776 3:29405713-29405735 TGAATTTTCCCCCATGTTTTAGG - Intronic
955203982 3:56878499-56878521 TTCATTTTCCACCAAGTGCTGGG + Intronic
956724611 3:72146564-72146586 TGGATTGTCCCACAAGGGGTGGG + Intergenic
960972534 3:123150133-123150155 TGCATGTTCCCCCGAGTGGTTGG + Intronic
962455888 3:135565224-135565246 TGGAGTTTCCACTAAGTGCTGGG + Intergenic
964454888 3:156852418-156852440 TGAATTTTCCACGAAGTGGGAGG - Intronic
968541837 4:1171972-1171994 TGGACTCTCCCCCAAGAGGCTGG + Exonic
968668301 4:1833671-1833693 TGGCTTGTCCCTCAGGTGGTAGG - Intronic
969539731 4:7780004-7780026 TGGATTGTCCCCACATTGGTTGG - Intronic
970668757 4:18371205-18371227 TGGATTTTAGCCCAAATGGCAGG - Intergenic
977134050 4:93279929-93279951 TGGATTTTACCCCATGTGACAGG + Intronic
980290499 4:130843947-130843969 TGGAGTTTCCCCCAAAAGTTAGG + Intergenic
981364752 4:143889412-143889434 TGGCTTTGCCACCAAATGGTTGG + Intronic
981385868 4:144129884-144129906 TGGCTTTGCCACCAAATGGTTGG + Intronic
984456329 4:179974119-179974141 TGCATTTTCCTCCCACTGGTAGG + Intergenic
984836697 4:184028950-184028972 AGGCTCTTCCCCAAAGTGGTTGG + Intergenic
989160304 5:38384606-38384628 AGGATTTTCCCACATGTGGCTGG - Intronic
992919930 5:81504328-81504350 TGGATTTTCCTCTGAGTGGAGGG - Intronic
994424526 5:99568097-99568119 TGTTTTTTGCCTCAAGTGGTGGG + Intergenic
996171749 5:120301543-120301565 TATATTTTGTCCCAAGTGGTTGG - Intergenic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
996555213 5:124771379-124771401 TGGATTTTTAACGAAGTGGTGGG - Intergenic
999879117 5:155841407-155841429 TGGATTTTTCCCAATTTGGTAGG + Intergenic
1001621665 5:173091204-173091226 TGGCTGTTCACCCAAGTTGTCGG - Exonic
1005788340 6:29270445-29270467 TTGCTGTTCCCTCAAGTGGTAGG + Intergenic
1006596693 6:35198668-35198690 TGGATTTGCCCCAAGGTGCTGGG - Intergenic
1009804805 6:68589828-68589850 TGGCTTTTCCCCCTTGTGTTTGG - Intergenic
1011830481 6:91365402-91365424 TGGGTTTTTGCCCAAGTGCTGGG + Intergenic
1012978274 6:105803114-105803136 TGGATTTTACTCCAAATAGTGGG - Intergenic
1015502746 6:133951373-133951395 TGGACTTTCTTCCAAGTGCTAGG - Intergenic
1017334259 6:153236968-153236990 TGGATTTTCCCCAGAGTCGGGGG + Intergenic
1017686688 6:156920690-156920712 TTGATTTTCCCCAAAGTGCTAGG + Intronic
1018617989 6:165705979-165706001 TTTCTTTTCCCCCAAGTTGTTGG - Intronic
1018945386 6:168344297-168344319 TAAATTTTCCCACAACTGGTAGG - Intergenic
1022304546 7:29134441-29134463 TGGATTTTCTACCAAGTTGGAGG - Intronic
1024161586 7:46681909-46681931 GGAATTTTCCCCAAAGAGGTAGG + Intronic
1026895066 7:74005619-74005641 AGGATTTTCTTCCCAGTGGTGGG - Intergenic
1031419712 7:121536769-121536791 TGGATTTTCACCCAACTGATGGG + Intergenic
1032522223 7:132554033-132554055 TGAATTTTGCCCCAAGTACTTGG - Intronic
1032761032 7:134942074-134942096 TGGAATTTGGCCCCAGTGGTTGG - Intronic
1034905787 7:154944566-154944588 TGAATTTTGCCCAAAGTGGACGG - Exonic
1036621919 8:10429806-10429828 ACGATTTTCCCACAAGTGGGTGG + Intergenic
1038007077 8:23440940-23440962 TGGATTTTCCCCTCAAAGGTGGG - Intronic
1043544004 8:81294979-81295001 TGGCTTTCTCCCCAAGTGCTGGG - Intergenic
1048471958 8:134712140-134712162 TGGATTTTAGCCCAAGTTGGAGG + Intronic
1048565827 8:135596041-135596063 TTCATTTTCCCCCAAGCTGTTGG - Intronic
1059533928 9:115063681-115063703 TGGTATTTCCCCAATGTGGTAGG + Intronic
1189843060 X:45102814-45102836 TTGATTTTCAGCCATGTGGTTGG + Intronic
1193365581 X:80628397-80628419 AATATTTTCCCCCATGTGGTAGG + Intergenic
1198755601 X:139978942-139978964 TTTTTTTTCCCCCAACTGGTTGG - Intergenic
1199849699 X:151716570-151716592 TGGATTTTCCTCCAAATGGCAGG - Intronic
1200150835 X:153950673-153950695 GAGATCTTCCCCCAAGTGGAAGG + Intronic